Welcome to Acta Agronomica Sinica，

Acta Agronomica Sinica ›› 2019, Vol. 45 ›› Issue (6): 848-855.doi: 10.3724/SP.J.1006.2019.82052

• CROP GENETICS & BREEDING·GERMPLASM RESOURCES·MOLECULAR GENETICS • Previous Articles     Next Articles

Establishment of a CRISPR/Cas9-VQR gene editing system

Kai CHEN,Guo-Liang SUN,Gao-Yuan SONG,Ai-Li LI,Chuan-Xiao XIE,Long MAO(),Shuai-Feng GENG()   

  1. Institute of Crop Sciences, Chinese Academy of Agricultural Sciences, Beijing 100081, China
  • Received:2018-10-24 Accepted:2019-01-19 Online:2019-06-12 Published:2019-06-12
  • Contact: Kai CHEN,Guo-Liang SUN,Long MAO,Shuai-Feng GENG E-mail:maolong@caas.cn;gengshuaifeng@caas.cn
  • Supported by:
    This study was supported by the National Major Project for Developing New GM Crops(2016ZX080009-001)

RichHTML350

11

PDF

1191

Abstract:

Clustered Regularly Interspaced Short Palindromic Repeat and Cas9 (CRISPR/Cas9), a new generation of genome- editing technology, is widely applied among bacteria, yeast, animals and plants, however, the typical CRISRP/Cas9 cannot recognize the NGA proto-spacer-motif (PAM), which limits its application. In order to broaden the applications of CRIPSR/Cas9 system, we modified the Streptococcus pyogenes Cas9 (SpCas9) sequence by the PCR site-direct mutagenesis, which encodes V (1135), Q (1335), and R (1337), to make the CRIPSR/Cas9-VQR able to recognize the NGA PAM motif. We also constructed a binary expression vector of CRISRP/Cas9-VQR with maize ubiquitin as the promoter to drive the Cas9-VQR, optimizing SpCas9-codon, adding conserved nuclear localization signal sequence, and increasing the conserved 3' UTR sequence of monocots, and using OsU6 transcripts of sRNA. CRISPR/Cas9-VQR could recognize the NGA motif and cut targeted sequence in vivo. We assembled the Cas9-VQR protein with the sRNAs in vitro. The Cas9-VQR could cleave the targeted fragments with about 5%-70% of mutation efficiency. In the transformation of rice, we detected about 27.50%-70.50% of mutation ratio, with an average of 46.23%. This system broadens the CRISPR/Cas9 applications in crops, especially in these with higher PAM locus of NGA.

Key words: CRISPR/Cas9-VQR, site-direct mutagenesis, PAM, mutation rate

Table 1

Sequence of OsPDS-gRNAs"

靶位点
Target site		 序列
Targeted sequence (5′-3′)		 GC含量
GC content (%)		 外显子位置
Location
OsPDS-gRNA1 CTTGGAAGGATGAAGATGGAGA 45 3
OsPDS-gRNA2 CCAGGAGAATTCAGCCGGTTTGA 55 6
OsPDS-gRNA3 TCAGGAGAAGCATGGTTCTAAGA 45 8
OsPDS-gRNA4 TCCCGGACTGTGAACCTTGCCGA 60 13

Table 2

Primers used in this research"

引物名称
Primer name		 序列
Sequence (5′-3′)
T7-gRNA1-FPg TAATACGACTCACTATAGCTTGGAAGGATGAAGATGGGTTTTAGAGCTAGAAATAGC
T7-gRNA2-FPg TAATACGACTCACTATAGCCAGGAGAATTCAGCCGGTTGTTTTAGAGCTAGAAATAGC
T7-gRNA3-FPg TAATACGACTCACTATAGTCAGGAGAAGCATGGTTCTAGTTTTAGAGCTAGAAATAGC
T7-gRNA4-FPg TAATACGACTCACTATAGTCCCGGACTGTGAACCTTGCGTTTTAGAGCTAGAAATAGC
gRNA-RP AGCACCGACTCGGTGCCACTT
oligo-gRNA1-F TTGCTTGGAAGGATGAAGATGG
oligo-gRNA1-R AACCCATCTTCATCCTTCCAAG
oligo-gRNA2-F TTGCCAGGAGAATTCAGCCGGTT
oligo-gRNA2-R AACAACCGGCTGAATTCTCCTGG
oligo-gRNA4-F TTGTCCCGGACTGTGAACCTTGC
oligo-gRNA4-R AACGCAAGGTTCACAGTCCGGGA
PCR-gRNA1-F TCAGAGTAAAGCAAAGATTC
PCR-gRNA1-R TCAGGCTCCTACGAGATA
PCR-gRNA2-F GAATTTTCGCTTAGAGGC
PCR-gRNA2-R CCAGTTATTTGAGTTCCATC
PCR-gRNA4-F TGTGCCTGTATGTAACCA
PCR-gRNA4-R GAGCAAACTTCACCTTCT

Table 3

Result of Cas9 codon optimized"

名称
Name		 长度
Length
(bp)		 G含量
G contents		 C含量
C contents		 GC百分比
GC percent (%)
SpCas9 4116 733 566 31.56
Cas9-codon optimized 4116 1094 931 49.20

Fig. 1

Number of PAM loci in whole genome CDS of rice and wheat"

Fig. 2

Construction of CRISPR/Cas9-VQR vector ZmUbi: ubiquitin promoter; NLS: nuclear localization signal; D1135V: substituting the 1135D residue with V; R1335Q: substituting the 1335R residue with Q; T1337R: substituting the 1337 T residue with R; 3′ UTR: 3′ untranslated region; Ter: terminator; gRNA: guide RNA; OsU6: OsU6 promoter."

Fig. 3

Cas9-VQR enzyme digestion activity in vitro S1 and S2: standard sample 1 and 2; CK1 and CK2: negative control 1and 2; g1: OsPDS-gRNA1; g2: OsPDS-gRNA2; g3: OsPDS- gRNA3; g4: OsPDS-gRNA4."

Fig. 4

OsPDS-gRNAs activity in vitrog1: OsPDS-gRNA1; g2: OsPDS-gRNA2; g3: OsPDS-gRNA3; g4: OsPDS-gRNA4."

Fig. 5

Phenotype observation A: seedling stage; B: leaf; C: spike. WT: wild type; OsPDS-gRNAs: gRNA vector of OsPDS-gRNA1, OsPDS-gRNA2, and OsPDS-gRNA4."

Fig. 6

Target site mutation A: target site mutation of OsPDS-gRNA1; B: target site mutation of OsPDS-gRNA2; C: target site mutation of OsPDS-gRNA4. WT: wild type; L: line."

Table 5

Number of mutants among transgenic plants"

名称
Name		 阳性植株
Transplant		 突变植株
Mutated plant		 突变率
Mutation ratio (%)		 纯合突变体
Homo plant		 杂合突变体
Het plant
OsPDS-gRNA1 17/24 12 70.5 4/12 8/12
OsPDS-gRNA2 40/45 11 27.5 5/11 6/11
OsPDS-gRNA4 49/53 20 40.8 7/20 13/20
[1] Song G Y, Jia M L, Chen K, Kong X C, Khattak B, Xie C X, Li A L, Mao L . CRISPR/Cas9: A powerful tool for crop genome editing. Crop J, 2016,4:75-82.
doi: 10.1016/j.cj.2015.12.002
[2] Shukla V K, Doyon Y, Miller J C , DeKelver R C, Moehle E A, Worden S E, Mitchell J C, Arnold N L, Gopalan S, Meng X, Choi V M, Rock J M, Wu Y Y, Katibah G E, Zhifang G, McCaskill D, Simpson M A, Blakeslee B, Greenwalt S A, Butler H J, Hinkley S J, Zhang L, Rebar E J, Gregory P D, Urnov F D . Precise genome modification in the crop speciesZea mays using zinc-finger nucleases. Nature, 2009,459:437-441.
doi: 10.1038/nature07992 pmid: 19404259
[3] Schiml S, Fauser F, Puchta H . The CRISPR/Cas9 system can be used as nuclease for in planta gene targeting and as paired nickases for directed mutagenesis in Arabidopsis resulting in heritable progeny. Plant J, 2014,80:1139-1150.
doi: 10.1111/tpj.12704 pmid: 25327456
[4] Shukla V K, Doyon Y, Miller J C , DeKelver R C, Moehle E A, Worden S E, Mitchell J C, Arnold N L, Gopalan S, Meng X, Choi V M, Rock J M, Wu Y Y, Katibah G E, Zhifang G, McCaskill D, Simpson M A, Blakeslee B, Greenwalt S A, Butler H J, Hinkley S J, Zhang L, Rebar E J, Gregory P D, Urnov F D. Precise genome modification in the crop species Zea mays using zinc-finger nucleases. Nature, 2009,459:437-411.
[5] Fauser F, Schiml S, Puchta H . Both CRISPR/Cas-based nucleases and nickases can be used efficiently for genome engineering in Arabidopsis thaliana. Plant J, 2014,2:348-359.
doi: 10.1111/tpj.12554 pmid: 24836556
[6] Li J F, Norville J E, Aach J , McCormack M, Zhang D, Bush J, Church G M, Sheen J. Multiplex and homologous recombination-mediated genome editing in Arabidopsis and Nicotiana benthamiana using guide RNA and Cas9. Nat Biotechnol, 2013,31:688-691.
[7] Fauser F, Schiml S, Puchta H . Both CRISPR/Cas-based nucleases and nickases can be used efficiently for genome engineering in Arabidopsis thaliana. Plant J, 2014,79:348-359.
doi: 10.1111/tpj.12554 pmid: 24836556
[8] Feng Z, Zhang B, Ding W, Liu X, Yang DL, Wei P, Cao F, Zhu S, Zhang F, Mao Y, Zhu J K . Efficient genome editing in plants using a CSRIPR/Cas system. Cell Res, 2013,23:1229-1232.
[9] Hyun Y B, Kim J, Cho S W, Choi Y, Kim J S, Coupland G . Site-directed mutagenesis in Arabidopsis thaliana using dividing tissue-targeted REGN of the CRISPR/Cas9 system to generate heritable null alleles. Planta, 2015,241:271-284.
[10] Feng Z, Mao Y, Xu N, Zhang B, Wei P, Yang D L, Wang Z, Zhang Z, Zheng R, Yang L, Zeng L, Liu X, Zhu J K . Multigeneration analysis reveals the inheritance, specificity, and patterns of CRISPR/Cas-induced gene modifications in Arabidopsis. Proc Natl Acad Sci USA, 2014,111:4632-4637.
[11] Ali Z , Abul-faraj A, Li L, Ghosh N, Piatek M, Mahjoub A, Aouida M, Piatek A, Baltes N , Voytas D F, Dinesh-Kumar S, Mahfouz M M. Efficient virus-mediated genome editing in plants using the CRISPR/Cas9 system. Mol Plant, 2015,8:1288-1291.
doi: 10.1016/j.molp.2015.02.011 pmid: 25749112
[12] Gao J, Wang G, Ma S, Xie X, Wu X, Zhang X, Wu Y, Zhao P, Xia Q . CRISPR/Cas9-mediated targeted mutagenesis in Nicotiana tabacum. Plant Mol Biol, 2015,87:99-110.
[13] Nekrasov V, Staskawicz B, Weigel D, Jones J D, Kamoun S . Targeted mutagenesis in the model plant Nicotiana benthamiana using Cas9 RNA-guided endonuclease. Nat Biotechnol, 2013,31:691-693.
[14] Shan Q, Wang Y, Li J, Zhang Y, Chen K, Liang Z, Zhang K, Liu J, Xi J J, Qiu J L, Gao C . Targeted genome modification of crop plants using a CRISPR-Cas system. Nat Biotechnol, 2013,31:686-688.
doi: 10.1038/nbt.2650 pmid: 23929338
[15] Miao J, Guo D S, Zhang J Z, Huang Q P, Qin G J, Zhang X, Wan J M, Gu H Y, Qu L J . Targeted mutagenesis in rice using CRISPR-Cas system. Cell Res, 2013,23:1233-1236.
doi: 10.1038/cr.2013.123 pmid: 23999856
[16] Zhang H, Zhang J, Wei P, Zhang B, Gou F, Feng Z, Mao Y, Yang L, Zhang H, Xu N, Zhu J K . The CRISPR/Cas9 system produces specific and homozygous targeted gene editing in rice in one generation. Plant Biotechnol J, 2014,12:797-807.
doi: 10.1111/pbi.12200 pmid: 24854982
[17] Xie K B, Yang Y N . RNA-guided genome editing in plants using a CRISPR-Cas system. Mol Plant, 2013,6:1975-1983.
doi: 10.1093/mp/sst119 pmid: 23956122
[18] Xu R, Li H, Qin R, Wang L, Li L, Wei P, Yang J . Gene targeting using the Agrobacterium tumefaciens-mediated CRISPR-Cas system in rice. Rice, 2014,1:5-7.
[19] Xie K B, Minkenberg B, Yang Y N . Boosting CRISPR/Cas9 multiplex editing capability with the endogenous tRNA-processing system. Proc Natl Acad Sci USA, 2015,112:3570-3575.
doi: 10.1073/pnas.1420294112 pmid: 25733849
[20] Ma X, Zhang Q, Zhu Q, Liu W, Chen Y, Qiu R, Wang B, Yang Z, Li H, Lin Y, Xie Y, Shen R, Chen S, Wang Z, Chen Y, Guo J, Chen L, Zhao X, Dong Z, Liu Y G . A robust CRISPR/Cas9 system for convenient high-efficiency multiplex genome editing in monocot and dicot plants. Mol Plant, 2015,8:1274-1284.
doi: 10.1016/j.molp.2015.04.007 pmid: 25917172
[21] Zhou H, Liu B, Weeks D P, Spalding M H, Yang B . Large chromosomal deletions and heritable small genetic changes induced by CRISPR/Cas9 in rice. Nucleic Acids Res, 2014,42:10903-10914.
doi: 10.1093/nar/gku806 pmid: 4176183
[22] Sun X, Hu Z, Chen R, Jiang Q, Song G, Zhang H, Xi Y . Targeted mutagenesis in soybean using the CRISPR-Cas9 system. Sci Rep, 2015,5:10342.
doi: 10.1038/srep10342 pmid: 26022141
[23] Pan C T, Ye L, Qin L, Liu X, He Y J, Wang J, Chen L F, Lu G . CRISPR/Cas9-mediated efficient and heritable targeted mutagenesis in tomato plants in the first and later generations. Sci Rep, 2016,6:24765.
doi: 10.1038/srep24765 pmid: 27097775
[24] Jiang W, Zhou H, Bi H, Fromm M, Yang B, Weeks D P . Demonstration of CRISPR/Cas9/sgRNA-mediated targeted gene modification in Arabidopsis, tobacco, sorghum and rice. Nucleic Acids Res, 2013,41:e188.
[25] Liang Z, Zhang K, Chen K, Gao C . Targeted mutagenesis in Zea mays using TALENs and the CRISPR/Cas system. J Genet Genomics, 2014,41:63-68.
doi: 10.1016/j.jgg.2013.12.001 pmid: 24576457
[26] Li C, Unver T, Zhang B H . A high-efficiency CRISPR/Cas9 system for targeted mutagenesis in cotton (Gossypium hirsutum L.). Sci Rep, 2017,7:43902.
doi: 10.1038/srep43902 pmid: 5335549
[27] Shan Q W, Wang Y P, Li J, Gao C X . Genome editing in rice and wheat using the CRISPR/Cas9 system. Nat Protocol, 2014,9:2395-2410.
doi: 10.1038/nprot.2014.157 pmid: 25232936
[28] Li B, Cui G, Shen G, Zhan Z, Huang L, Chen J, Qi X . Targeted mutagenesis in the medicinal plant Salvia miltiorrhiza. Sci Rep, 2017,7:43320.
[29] Xu R, Li H, Qin R, Wang L, Li L, Wei P, Yang J . Gene targeting using the Agrobacterium tumefaciens-mediated CRISPR-Cas system in rice. Rice, 2014,7:1-5.
[30] Mao Y, Zhang H, Xu N, Zhang B, Gou F, Zhu J K . Application of the CRISPR-Cas system for efficient genome engineering in plants. Mol Plant, 2013,6:2008-2011
doi: 10.1093/mp/sst121 pmid: 23963532
[31] Xing H L, Dong L, Wang Z P, Zhang H Y, Han C Y, Liu B, Wang X C, Chen Q J . A CRISPR/Cas9 toolkit for multiplex genome editing in plants. BMC Plant Biol, 2014,14:327-328.
doi: 10.1186/s12870-014-0327-y pmid: 4262988
[32] Li J F, Norville J E, Aach J , McCormack M, Zhang D, Bush J, Church G M, Sheen J. Multiplex and homologous recombination-mediated genome editing in Arabidopsis and Nicotiana benthamiana using guide RNA and Cas9. Nat Biotechnol, 2013,8:688.
[33] Liu W, Zhu X, Lei M, Xia Q, Botella J R, Zhu J K, Mao Y . A detailed procedure for CRISPR/Cas9-mediated gene editing in Arabidopsis thaliana. Sci Bull, 2015,15:1332-1347.
[34] Wang Y, Cheng X, Shan Q, Zhang Y, Liu J, Gao C, Qiu J L . Simultaneous editing of three homoeoalleles in hexaploid bread wheat confers heritable resistance to powdery mildew. Nat Biotechnol, 2014,32:947-951.
doi: 10.1038/nbt.2969 pmid: 25038773
[35] Wang F, Wang C, Liu P, Lei C, Hao W, Gao Y, Liu Y G, Zhao K . Enhanced rice blast resistance by CRISPR/Cas9-targeted mutagenesis of the ERF transcription factor gene OsERF922. PLoS One, 2016,11:e0154027.
doi: 10.1371/journal.pone.0154027 pmid: 27116122
[36] Ran F A, Cong L, Yan W X, Scott D A, Gootenberg J S, Kriz A J, Zetsche B, Shalem O, Wu X, Makarova K S, Koonin E V, Sharp P A, Zhang F . In vivo genome editing using Staphylococcus aureus Cas9. Nature, 2015,520:186-191.
[37] Kleinstiver B P, Prew M S, Tsai S Q, Topkar V V, Nguyen N T, Zheng Z, Gonzales A P, Li Z, Peterson R T, Yeh J R, Aryee M J, Joung J K . Engineering CRISPR-Cas9 nucleases with altered PAM specificities. Nature, 2015,523:481-485.
[38] Hu X X, Wang C, Fu Y P, Liu Q, Jiao X Z, Wang K J . Expanding the range of CRISPR/Cas9 genome editing in rice. Mol Plant, 2016,9:943-945.
doi: 10.1016/j.molp.2016.03.003 pmid: 26995294
[39] Hu X X, Meng X B, Liu Q, Li J Y, Wang C J . Increasing the efficiency of CRISPR-Cas9-VQR precise genome editing in rice. Plant Biotechnol J, 2018,16:292-297.
doi: 10.1111/pbi.12771 pmid: 28605576
[40] Hiei Y, Komari T, Kubo T . Transformation of rice mediated by Agrobacterium tumefaciens. Plant Mol Biol, 1997,35:205-218.
[41] Wang K, Liu H Y, Du L P, Ye X G . Generation of marker-free transgenic hexaploid wheat via an Agrobacterium-mediated co-transformation strategy in commercial Chinese wheat varieties. Plant Biotechnol J, 2017,15:614-623.
No related articles found!
Viewed
Full text


Abstract

Cited
  Shared   
  Discussed   
No Suggested Reading articles found!
Add: No. 80 Xueyuan South Rd, Beijing 100081, P. R. China E-mail: zwxb301@caas.cn
Supported by Beijing Magtech Co.Ltd