Welcome to Acta Agronomica Sinica,

Acta Agronomica Sinica ›› 2026, Vol. 52 ›› Issue (10): 2961-2970.doi: 10.3724/SP.J.1006.2026.61021

• CROP GENETICS & BREEDING·GERMPLASM RESOURCES·MOLECULAR GENETICS • Previous Articles     Next Articles

Transcriptional regulator Paf1 negatively regulates wheat resistance to BSMV

Chen Dong-Yang(), Zhao Yu-Jia, Xin Ying-Jie, Cui Yi-Ping, Hu Yi-Ge, Yue Jie-Yu, Wang Hua-Zhong()   

  1. School of Life Sciences, Tianjin Normal University / Tianjin Key Laboratory of Animal and Plant Resistance, Tianjin 300387, China
  • Received:2026-03-11 Accepted:2026-07-15 Online:2026-10-12 Published:2026-07-23
  • Contact: Wang Hua-Zhong, E-mail: skywhz@tjnu.edu.cn
  • Supported by:
    National Natural Science Foundation of China(31971829);Knowledge Innovation and Training Program of Tianjin(135305JF78);Knowledge Innovation Program of Tianjin Normal University(1353P2XC1604)

Abstract:

The RNA polymerase II-associated factor 1 (Paf1) complex is a conserved transcriptional regulator in eukaryotes; however, whether Paf1 plays a role in plant antiviral responses remains unclear. Wheat is one of the natural hosts of barley stripe mosaic virus (BSMV). In this study, analysis of gene expression showed that wheat Paf1 subunit genes are transcriptionally responsive to BSMV infection. Based on the principle of virus-induced gene silencing (VIGS), we engineered BSMV-derived viral clones capable of inducing silencing of distinct host Paf1 subunit genes during infection of wheat. In wheat seedlings infected with these clones, silencing of each Paf1 subunit gene enhanced BSMV-triggered hypersensitive response (HR)-associated cell death. Furthermore, comparative analysis of viral proliferation in wheat seedlings and adult plants infected with either a control BSMV clone or an engineered clone designed to silence the Paf1 subunit gene TaCDC73 revealed that TaCDC73 silencing reduced viral accumulation. These results indicate that TaCDC73 silencing potentiates the antiviral response in BSMV-infected wheat plants. In addition, plants infected with the TaCDC73-silencing BSMV clone exhibited more pronounced growth inhibition than those plants infected with the control BSMV clone. Collectively, our findings demonstrate that the Paf1 complex functions as a negative regulator of resistance to BSMV by suppressing HR-associated cell death. This regulatory role of Paf1 may help maintain the growth-defense balance by preventing hyperactivation of immune responses during BSMV infection.

Key words: wheat, BSMV, Paf1, virus resistance, hypersensitive response

Table 1

Primers used in this study"

引物名称
Primer name
引物序列
Primer sequence (5'-3')
Primers used for construction of BSMV clones with VIGS ability
vVIP2-300-F CAAACATTTTTTTTTTTTTTTAGCTAGCGCTAAATCGCGCCCTGTCC
vVIP2-300-R GATTCTTCTTCCGTTGCTAGCCCTTACTTCCCAGTGATATTC
vVIP3-300-F CAAACATTTTTTTTTTTTTTTAGCTAGCAAGGGTGTTGCTCTGGCTG
vVIP3-300-R GATTCTTCTTCCGTTGCTAGCTCCACCGGCGAGAACACCA
vVIP4-300-F CAAACATTTTTTTTTTTTTTTAGCTAGCATTGTGCGGTGGAGAACTG
vVIP4-300-R GATTCTTCTTCCGTTGCTAGCCTTGTTCTGGGAATCAACA
vVIP5-300-F CAAACATTTTTTTTTTTTTTTAGCTAGCATGAACGACCATGTTGGGAT
vVIP5-300-R GATTCTTCTTCCGTTGCTAGCCTTCATTATCCCATACAACA
vVIP6-300-F CAAACATTTTTTTTTTTTTTTAGCTAGCGCACTTTGGCACTCAACCA
vVIP6-300-R GATTCTTCTTCCGTTGCTAGCCTCGAAGCTAGCTAAGGAAC
vCDC73-300-F CAAACATTTTTTTTTTTTTTTAGCTAGCGACCTGGACAAGATCATC
vCDC73-300-R GATTCTTCTTCCGTTGCTAGCGGCGTCCTGCGCGAAGGAGG
vGFP-300-F CAAACATTTTTTTTTTTTTTTAGCTAGCTGAGCAAGGGCGAGGAGCTG
vGFP-300-R GATTCTTCTTCCGTTGCTAGCCGTCCTTGAAGAAGATGGTG
vCDC136-F GACCTGGACAAGATCATCTTC
vCDC136-R GATTCTTCTTCCGTTGCTAGCCGAGGAAGACGGCGGCGGAGA
vGFP130-F AAGGGCATCGACTTCAAGGA
vGFP130-R GATTCTTCTTCCGTTGCTAGCGGCGGATCTTGAAGTTCACC
vCDC-PDS-F GATCTTGTCCAGGTCGATGACACCCAAAGACTGA
vGFP-PDS-F TGAAGTCGATGCCCTTGATGACACCCAAAGACTGA
vPDS-R CAAACATTTTTTTTTTTTTTTAGCTAGCCTGATCGAGTCAACGACGA
Primers used in RT-qPCR expression analyses
qAlpha-F GTTGGAACCGATTTGGAAGA
qAlpha-R CTATCAGCCACTCGTGCGTA
qGamma-F TCTTGTGTGTGTTGTGGTACCT
qGamma-R TGGACTTGCAAACACTCCCA
qVIP3-F GATTGCGGTGTATGATGCGG
qVIP3-R CCCTTCTCCTTGGCATCGTA
qVIP4-F TGAGGATGACTTGGAGGCTG
qVIP4-R ATCCAGCTCTTCCCTTCCAC
qVIP5-F GATCAGTTGGAGATGGCCCT
qVIP5-R TTCTCAGCACGGTTCTTCCT
qVIP6-F GGATGGGACTGCTGGTAGTT
qVIP6-R TGAGACGGTAAAGGAGGCTG
qCDC73-F4 TCGTGGCCGTGTTTGTGCTC
qCDC73-R4 GCCTTTTATTCTTGCTTATAG
Tubulin-F GTGGAACTGGCTCTGGC
Tubulin-R CGCTCAATGTCAAGGGA
Primers used for amplification of in vitro transcription templates
M13F GTAAAACGACGGCCAGT
BSMV-R TGGTCTTCCCTTGGGGGACCGAA

Fig. 1

Expression response of wheat Paf1 subunit genes to BSMV infection A: schematic diagram showing the genome structures of the BSMV clones constructed and used in this study, red arrows indicate the positions of the RT-PCR primers used for viral RNA detection. CP: coat protein; TGB1, 2, and 3: triple gene block 1, 2, and 3, respectively. B: RT-qPCR analysis of the expression responses of wheat Paf1 subunit genes to BSMV infection. For each treatment (mock and BSMV:GFP infection), three independent seedlings were used as biological replicates for analysis of all target genes, and each biological replicate was analyzed in technical triplicate for each gene. * indicates significant differences (P < 0.05)."

Fig. 2

Efficiency of silencing wheat Paf1 subunit genes using BSMV-VIGS The silencing efficiency of the target genes was assessed by RT-qPCR. Three independently infected seedlings were used as biological replicates for each BSMV clone, with BSMV:GFP as the control. Each biological replicate was analyzed in technical triplicate. * indicates significant differences (P < 0.05)."

Fig. 3

Paf1 subunit genes negatively regulate BSMV-induced hypersensitive response-associated cell death in wheat A-C: comparison of cell death in the systemic leaves of wheat seedlings inoculated with infectious RNA of BSMV or BSMV:CDC73. Cell death in systemic leaves was assessed based on symptom observation (A), trypan blue staining (B), and electrolyte leakage analysis (C). For the electrolyte leakage analysis, three independent seedlings for each treatment were used as biological replicates. ns indicates no significant difference (P > 0.05). D: comparison of cell death in the systemic leaves of wheat seedlings inoculated with virion preparations of BSMV or BSMV:CDC73. The left panel shows cell death symptoms in systemic leaves, and the right panel shows the comparable virion concentrations of the two virion preparations used for inoculation, as indicated by coat protein abundance. CP: coat protein; RbcL: Rubisco large subunit. E: BSMV clones capable of silencing different Paf1 subunit genes consistently enhanced cell death when infecting wheat seedlings."

Fig. 4

Silencing of TaCDC73 does not alter BSMV-induced ROS levels in wheat ROS accumulation in the systemic leaves of seedlings inoculated with infectious RNA (A) or virions (B) was examined by DAB staining for H2O2 and NBT staining for O2?."

Fig. 5

TaCDC73 silencing enhances wheat resistance to BSMV A-B: immunoblot detection of viral proteins in immature, unexpanded (A) and fully expanded (B) fourth leaves, corresponding to the second systemic leaves, of BSMV-infected wheat seedlings. Numbers 1-3 represent three individual plants. TGB1: triple gene block 1. C: immunoblot detection of viral proteins in the leaves of BSMV-infected adult wheat plants. CP: coat protein; RbcL: Rubisco large subunit. D: RT-PCR detection of viral RNA in the leaves of BSMV-infected adult wheat plants, with Tubulin used as an internal control. For RNAγ detection, amplification from the plasmid vector was used as a size reference for the amplicon containing the full-length insert. P: plasmid; M: molecular marker."

Fig.6

TaCDC73 silencing inhibits wheat growth during the response to BSMV infection A: growth phenotypes of wheat plants infected with BSMV:GFP or BSMV:CDC73. B: measurement and statistical analysis of plant height and the length and width of the uppermost fully expanded leaves of the two groups of plants shown in panel A. Six plants per group were used as biological replicates for all measurements. * indicates significant differences (P < 0.05)."

Fig. 7

TaCDC73 silencing reduces the efficiency of BSMV- mediated VIGS VIGS: virus-induced gene silencing. The extent of TaPDS silencing, reflected by the degree of leaf bleaching, was used to evaluate VIGS efficiency."

[1] Viswanath K K, Kuo S Y, Tu C W, et al. The role of plant transcription factors in the fight against plant viruses. Int J Mol Sci, 2023, 24: 8433.
doi: 10.3390/ijms24098433
[2] Van Oss S B, Cucinotta C E, Arndt K M. Emerging insights into the roles of the Paf1 complex in gene regulation. Trends Biochem Sci, 2017, 42: 788-798.
doi: S0968-0004(17)30150-0 pmid: 28870425
[3] Francette A M, Tripplehorn S A, Arndt K M. The Paf1 complex: a keystone of nuclear regulation operating at the interface of transcription and chromatin. J Mol Biol, 2021, 433: 166979.
doi: 10.1016/j.jmb.2021.166979
[4] Obermeyer S, Kapoor H, Markusch H, et al. Transcript elongation by RNA polymerase II in plants: factors, regulation and impact on gene expression. Plant J, 2024, 118: 645-656.
doi: 10.1111/tpj.v118.3
[5] 崔祎平, 李玲珑, 陈冬阳, 等. 小麦转录调控因子Paf1亚基基因的鉴定和逆境响应表达分析. 华北农学报, 2025, 40(2): 1-9.
doi: 10.7668/hbnxb.20195457
Cui Y P, Li L L, Chen D Y, et al. Identification and stress-responsive expression analysis of the genes for subunits of transcription regulator Paf1 in wheat. Acta Agric Boreali-Sin, 2025, 40(2): 1-9 (in Chinese with English abstract).
doi: 10.7668/hbnxb.20195457
[6] He Y H, Doyle M R, Amasino R M. PAF1-complex-mediated histone methylation of FLOWERING LOCUS C chromatin is required for the vernalization-responsive, winter-annual habit in Arabidopsis. Genes Dev, 2004, 18: 2774-2784.
doi: 10.1101/gad.1244504
[7] Cao Y, Wen L G, Wang Z, et al. SKIP interacts with the Paf1 complex to regulate flowering via the activation of FLC transcription in Arabidopsis. Mol Plant, 2015, 8: 1816-1819.
doi: 10.1016/j.molp.2015.09.004
[8] Nasim Z, Susila H, Jin S, et al. Polymerase II-associated factor 1 complex-regulated FLOWERING LOCUS C-clade genes repress flowering in response to chilling. Front Plant Sci, 2022, 13: 817356.
doi: 10.3389/fpls.2022.817356
[9] Jackson A O, Lim H S, Bragg J, et al. Hordeivirus replication, movement, and pathogenesis. Annu Rev Phytopathol, 2009, 47: 385-422.
doi: 10.1146/annurev-phyto-080508-081733 pmid: 19400645
[10] Jiang Z H, Yang M, Li D W. Advances in understanding multifunctionality of barley stripe mosaic virus γb protein. PLoS Pathog, 2025, 21: e1013299.
[11] Jiang Z H, Jin X J, Yang M, et al. Barley stripe mosaic virus γb protein targets thioredoxin h-type 1 to dampen salicylic acid-mediated defenses. Plant Physiol, 2022, 189: 1715-1727.
doi: 10.1093/plphys/kiac137 pmid: 35325212
[12] Zhang X, Dong K, Xu K, et al. Barley stripe mosaic virus infection requires PKA-mediated phosphorylation of γb for suppression of both RNA silencing and the host cell death response. New Phytol, 2018, 218: 1570-1585.
doi: 10.1111/nph.15065 pmid: 29453938
[13] Yang M, Li Z G, Zhang K, et al. Barley stripe mosaic virus γb interacts with glycolate oxidase and inhibits peroxisomal ROS production to facilitate virus infection. Mol Plant, 2018, 11: 338-341.
doi: S1674-2052(17)30306-4 pmid: 29066357
[14] Yang M, Zhang Y L, Xie X L, et al. Barley stripe mosaic virus γb protein subverts autophagy to promote viral infection by disrupting the ATG7-ATG8 interaction. Plant Cell, 2018, 30: 1582-1595.
[15] Li Z L, Yang X X, Li W L, et al. SAMDC3 enhances resistance to barley stripe mosaic virus by promoting the ubiquitination and proteasomal degradation of viral γb protein. New Phytol, 2022, 234: 618-633.
doi: 10.1111/nph.17993 pmid: 35075654
[16] Wu Q H, Cui Y, Jin X J, et al. The CC-NB-LRR protein BSR1 from Brachypodium confers resistance to barley stripe mosaic virus in gramineous plants by recognising TGB1 movement protein. New Phytol, 2022, 236: 2233-2248.
doi: 10.1111/nph.v236.6
[17] Kenaston M W, Shah P S. The archer and the prey: the duality of PAF1C in antiviral immunity. Viruses, 2023, 15: 1032.
doi: 10.3390/v15051032
[18] Guo Y Y, Li C L, Liu Y, et al. The polymerase-associated factor 1 complex modulates the growth-defense tradeoff in Arabidopsis. Sci Adv, 2025, 11: eady5876.
[19] Kant R, Dasgupta I. Gene silencing approaches through virus-based vectors: speeding up functional genomics in monocots. Plant Mol Biol, 2019, 100: 3-18.
doi: 10.1007/s11103-019-00854-6 pmid: 30850930
[20] 高源, 王宇琦, 姜佳宁, 等. 玉米低温响应基因ZmNTL1和ZmNTL5的鉴定及功能分析. 作物学报, 2025, 51: 2318-2329.
doi: 10.3724/SP.J.1006.2025.53011
Gao Y, Wang Y Q, Jiang J N, et al. Identification and functional analysis of low temperature responsive genes ZmNTL1 and ZmNTL5 in maize. Acta Agron Sin, 2025, 51: 2318-2329 (in Chinese with English abstract).
doi: 10.3724/SP.J.1006.2025.53011
[21] Livak K J, Schmittgen T D. Analysis of relative gene expression data using real-time quantitative PCR and the 2-ΔΔCT method. Methods, 2001, 25: 402-408.
doi: 10.1006/meth.2001.1262 pmid: 11846609
[22] Deng Y W, He Z H. The seesaw action: balancing plant immunity and growth. Sci Bull, 2024, 69: 3-6.
doi: 10.1016/j.scib.2023.11.051 pmid: 38042702
[23] Ning Y S, Liu W D, Wang G L. Balancing immunity and yield in crop plants. Trends Plant Sci, 2017, 22: 1069-1079.
doi: S1360-1385(17)30206-6 pmid: 29037452
[1] Chen Jia, Sun Dai-Zhen, Li Chao-Nan, Li Long, Jing Rui-Lian, Yang Jin-Wen, Wang Jing-Yi. Mapping and molecular marker development of QTL for wheat grain length under drought stress [J]. Acta Agronomica Sinica, 2026, 52(9): 2549-2558.
[2] Yang Lu-Yao, Cui Ru-Ying, Dong Xue-Rui, Yan Peng, Zhang Juan, Zhang Cai-Xia, Wang Yong-Jun, Dong Zhi-Qiang, Lu Lin. Alleviating effect of a compound agent of potassium polyaspartate and betaine on assimilate accumulation, translocation and yield of wheat under high temperature stress during grain-filling stage [J]. Acta Agronomica Sinica, 2026, 52(9): 2760-2774.
[3] Wu Yu-Xuan, Ma Jing-Fu, Wang Hao-Dong, Guo Li-Jian, Chen Tao, Yang De-Long. Genome-wide association study of plant height and peduncle length in dryland wheatand identification of elite haplotypes [J]. Acta Agronomica Sinica, 2026, 52(8): 2366-2381.
[4] Jia Kang-Nan, Li Hui-Yuan, Guo Hui-Jun, Zhao Lin-Shu, Xie Yong-Dun, Xiong Hong-Chun, Gu Jia-Yu, Zhang Yu-Mei, Liu Lu-Xiang. Functional analysis of the wheat copper transporter gene TaCOPT3 in response to cadmium stress [J]. Acta Agronomica Sinica, 2026, 52(8): 2244-2256.
[5] Liu Hao, Sun Hao, Liang Xiao-Dong, Li Jian-Jiang, Wei Hai-Peng, Zhang Min, Liao Bing-Lin, Jia Yong-Hong, Ma Xing-Guo, Zeng Chao-Wu, Zhang Hong. Evaluation of drought resistance and molecular detection of drought resistance functional genes in 94 Xinjiang spring wheat varieties [J]. Acta Agronomica Sinica, 2026, 52(8): 2382-2395.
[6] Gao Wang-Nan, Meng Tian-Qi, Sun Zhao-Xin, Shang Xu-Ge, Wu Jun, Liu Yu-Xiu. Research progress and breeding applications of wheat solid stem trait [J]. Acta Agronomica Sinica, 2026, 52(8): 2233-2243.
[7] Wang Bi-Sheng, Sun Xiao-Lu, Cui Yu-Sha, Zhao Zhong-Qing, Ma Qing-Min, Ding He-Yang, Fang Quan-Xiao. Simulation improvement and validation of winter wheat yield formation in response to planting density and row spacing [J]. Acta Agronomica Sinica, 2026, 52(8): 2438-2453.
[8] Wang Ya-Feng, Nan Yun-You, Zhang Huan-Huan, Zhang Diao-Liang, Jiang Long-Xiu, Zhu Dong-Yang, Li Han-Ting, Chai Qiang, Hu Fa-Long, Yin Wen, Fan Zhi-Long. Response of spring wheat nitrogen utilization to green manure combined with wheat straw returning and nitrogen application rates [J]. Acta Agronomica Sinica, 2026, 52(8): 2410-2423.
[9] Xiang Yu-Xin, Zhang Jie-Yu, Li Gui-Zhen, Wang Lin, Liu Han, Qin Yu-Xing, Ma Gen, Xiang Da-Bing. Effects of the interaction between nitrogen application and planting density on the canopy light environment, yield, and quality of Tartary buckwheat [J]. Acta Agronomica Sinica, 2026, 52(8): 2480-2495.
[10] Yang Wan-Qing, Jiang Yu-Fan, Liu Yi-De, Liu Yi-Ke, Ning Qiang, Wang Shu-Ping. Identification of the wheat ANK gene family and analysis of its response to Fusarium graminearum infection [J]. Acta Agronomica Sinica, 2026, 52(7): 2013-2026.
[11] Jiang Yu-Fan, Yang Wan-Qing, Deng Yuan-Kai, Jiang Jun-Long, Wang Ruo-Yu, Chen Ling, Ning Qiang, Liu Yi-Ke, Zhu Zhan-Wang, He Zhong-Hu, Hao Yuan-Feng, Fang Zheng-Wu, Ding Fu-Gong. QTL mapping and validation of grain-related traits in a wheat RIL population [J]. Acta Agronomica Sinica, 2026, 52(7): 1997-2012.
[12] Zhai Sheng-Nan, Cao Xin-You, Li Hao-Sheng, Li Ji-Hu, Li Fa-Ji, Liu Jin-Dong, Xia Xian-Chun, Lyu Ying-Ying, Ma Rui-Feng, Wang Ying, Geng Hong-Wei, Liu Jian-Jun. Analysis of the genetic effects of allelic variation at the Pod-A1, Pod-D1, and Pod-2D loci on peroxidase activity in wheat grains [J]. Acta Agronomica Sinica, 2026, 52(6): 1593-1603.
[13] Xi Qian-Hui, Xu Zi-Yuan, Liu Meng-Meng, Wang Hong-Yi, Lang Kai-Lin, Jing Zhen-Hai, Chen Feng, Zhao Lei. Genome-wide association study and candidate gene prediction of grain copper content in wheat [J]. Acta Agronomica Sinica, 2026, 52(6): 1604-1617.
[14] Mao Jia-Qi, Huang Peng-Yu, Zhao Jia-Jia, Zheng Xing-Wei, Wu Bang-Bang, Hao Yu-Qiong, Qu Fei, Liu Cheng, Ma Peng-Tao, Zheng Jun. Evaluation of powdery mildew resistance in wheat cultivars and molecular detection of resistance genes in Shanxi province, China [J]. Acta Agronomica Sinica, 2026, 52(6): 1669-1681.
[15] Hu Chuan, Zhao Kai-Nan, Huang Xiu-Li, Wu Jin-Zhi, Ren Kai-Ming, Wang He-Zheng, Fu Guo-Zhan, Huang Ming, Li You-Jun. Effects of tillage methods and nitrogen rates on yield and quality of dryland wheat under one-off irrigation [J]. Acta Agronomica Sinica, 2026, 52(6): 1830-1846.
Viewed
Full text


Abstract

Cited

  Shared   
  Discussed   
No Suggested Reading articles found!