Welcome to Acta Agronomica Sinica,

Acta Agronomica Sinica ›› 2020, Vol. 46 ›› Issue (7): 978-986.doi: 10.3724/SP.J.1006.2020.93064

• CROP GENETICS & BREEDING · GERMPLASM RESOURCES · MOLECULAR GENETICS • Previous Articles     Next Articles

Establishment of an efficient genotyping technique based on targeted DNA endonuclease in vitro activity of CRISPR/Cas9 ribonucleoprotein

WANG Nan1,QI Xian-Tao1,2,LIU Chang-Lin1,XIE Chuan-Xiao1,*(),ZHU Jin-Jie1,*()   

  1. 1 Institute of Crop Sciences, Chinese Academy of Agricultural Sciences, Beijing 100081, China
    2 Anhui Agricultural University, Hefei 230036, Anhui, China
  • Received:2019-12-18 Accepted:2020-03-24 Online:2020-07-12 Published:2020-04-10
  • Contact: Chuan-Xiao XIE,Jin-Jie ZHU E-mail:xiechuanxiao@caas.cn;zhujinjie@caas.cn
  • Supported by:
    National Major Project of Developing New GM Crops(2019ZX08010-003)

Abstract:

Establishing a rapid, accurate, high-throughput and easily implementable genotyping method is highly desirable for functional genomics, genetic improvement and mutant screening. Here, we describe a convenient and inexpensive technique for genotyping using the targeted DNA endonuclease activity of Cas9 or Cas9NG ribonucleoproteins complex (sgRNA/Cas9-RNP or sgRNA/Cas9NG-RNP). In this study, Cas9 and Cas9NG protein purified from E. coli extract was assembled with in vitro transcribed single guide RNA (sgRNA)or enhanced sgRNA (esgRNA) as an assembled ribonucleoprotein (RNP) complex to fulfill the targeted endonuclease activity on the PCR amplicons of ZmWx exon 7. The restriction profiles can be converted into genotyping results of wildtype, homozygous or heterozygous mutant, respectively. Our data showed that ZmWx gene-edited mutants can be genotyped rapidly and efficiently by the sgRNA-optimized system esgRNA/Cas9. The reaction component optimization data suggested that 500 ng of DNA substrates could be cleavaged completely by incubating with 1 μg 1:1 molar ratio of esgRNA/Cas9 ribonucleoproteins for 30 minutes at 37℃, or by 4 μg 1:1 molar ratio of esgRNA/Cas9NG ribonucleoproteins for 4 hours at 37℃. Expanding the targeting flexibility of mutant detection via esgRNA/Cas9NG indicated that Cas9NG variant might recognize relax NG PAM (protospacer-adjacent-motif, PAM) at the expense of decreasing restriction activity, which is necessary to improve the activity of esgRNA/Cas9NG by further optimization. Therefore, the establishment and application of esgRNA/Cas9 based PCR/RNP technique provides an easy, simple and low-cost approach to genotyping in functional genomics, molecular breeding and mutant screening. In addition, our in vitro data on esgRNA/Cas9NG has certain and significant reference value for developing it into in vivo genome editing studies.

Key words: sgRNA/Cas9 ribonucleoprotein complex, Cas9NG, enhanced single guide RNA (esgRNA), genotyping, mutant screening

Table 1

Primer sequences used in this paper"

引物名称
Primer name
序列
Sequence (5′-3′)
Cas9 F GACGACGACGACAAGGCCATGATGGACAAGAAGTACTCCA
Cas9 R TCGACGGAGCTCGCTAGCGTCGCCGCCGAGCTGGGAGAGG
Cas9NG F ACGACGACGACAAGGCCATGGACAAGAAGTACTCCATCGGC
Cas9NG R CTCGAGTGCGGCCGCAAGCTTGTCGCCGCCGAGCTGGCTCAG
sgRNA scaffold F GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAG
sgRNA scaffold R AAAAAGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAA
esgRNA scaffold F GTTTCAGAGCTATGCTGGAAACAGCATAGCAAGTTGAAATAAGGCTAGTCCGTTATC
esgRNA scaffold R AAAAAAGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTC
ZmWx F CATACTTCTCCGGACCATACGGTAA
ZmWx R TCCCTGCTGGGGTCCCACTC
T7 F AAGCTAATACGACTCACTATAGGAGGTTCAGCTCCGGGTAGTGTTTTAGAGCTAGAAA
eT7 F AAGCTAATACGACTCACTATAGGAGGTTCAGCTCCGGGTAGTGTTTCAGAGCTATGCT
Target1 T7 F AAGCTAATACGACTCACTATAGGTTCAGCTCCGGGTAGTCGGGTTTCAGAGCTATGCT
Target2 T7 F AAGCTAATACGACTCACTATAGCTCCGGGTAGTCGGAGAAGGGTTTCAGAGCTATGCT
Target3 T7 F AAGCTAATACGACTCACTATAGCTTCTCCGACTACCCGGAGCGTTTCAGAGCTATGCT
Target4 T7 F AAGCTAATACGACTCACTATAGTTCGCCTTCTCCGACTACCCGTTTCAGAGCTATGCT
Target5 T7 F AAGCTAATACGACTCACTATAGGCCTTCTCCGACTACCCGGAGTTTCAGAGCTATGCT
Target6 T7 F AAGCTAATACGACTCACTATAGCAGCTCCGGGTAGTCGGAGAGTTTCAGAGCTATGCT
T7 R AAAAAGCACCGACTCGGTGCCACTTTTT

Fig. 1

Purification of Cas9 and Cas9NG protein A: Schematics diagram of protein expression vector; B: 10% SDS-PAGE of purified Cas9; C: 10% SDS-PAGE of purified Cas9NG. M: Protein marker. 1: Supernatant protein; 2: Ni-column crude purified protein; 3: Cation exchange column purification protein."

Fig. 2

In vitro transcription of sgRNA and esgRNA, as well as the establishment of cleavage assay via esgRNA/Cas9-RNP and esgRNA/Cas9NG-RNP A: Predicted secondary structure of sgRNA; B: Predicted secondary structure of esgRNA; C: 10% Urea-PAGE of sgRNA and esgRNA; D: PCR/RNP cleavage assay; CK: ZmWx wild PCR product without esgRNA and Cas protein."

Fig. 3

Optimization of cleavage assay via esgRNA /Cas9-RNP and esgRNA/ Cas9NG-RNP A: Effect of different gradients of esgRNA; B: Effect of different gradients of Cas9 protein; C: Effect of different gradients of digestion time; D: Digestion of PCR products of different genotypes; E: Effect of different gradients of esgRNA; F: Effect of different gradients of Cas9NG protein; G: Effect of different gradients of digestion time; H: Digestion of PCR products of different genotypes; CK: ZmWx wild PCR product without esgRNA and Cas protein."

Fig. 4

Cleavage assay of different targets for ZmWx locus via esgRNA/Cas9NG-RNP A: Targets selection of Cas9NG; B: 10% Urea-PAGE of 6 target-related esgRNA; C: PCR/RNP cleavage assay; CK: ZmWx wild PCR product without esgRNA and Cas protein."

Fig. 5

Genotyping genome-edited ZmWx mutant via esgRNA/Cas9-RNP A: Genotyping genome-edited ZmWx mutant via esgRNA/Cas9-RNP; B: Sanger sequencing peak graph of different genotypes. WT/WT is a wild type, -1 bp/-1 bp is a homozygous mutant with 1 bp deleted, and WT/-3 bp is a heterozygous mutant with 3 bp allele deleted; CK: ZmWx wild PCR product without esgRNA and Cas protein."

[1] Jinek M, Chylinski K, Fonfara I, Hauer M, Doudna J A, Charpentier E. A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity. Science, 2012,337:816-821.
pmid: 22745249
[2] Cong L, Ran F A, Cox D, Lin S, Barretto R, Habib N, Hsu P D, Wu X B, Jiang W Y, Marraffini L A, Zhang F. Multiplex genome engineering using CRISPR/Cas systems. Science, 2013,339:819-823.
pmid: 23287718
[3] Shalem O, Sanjana N E, Hartenian E, Shi X, Scott D A, Mikkelsen T S, Heckl D, Ebert B, Root1 D E, Doench J G, Zhang F. Genome-scale CRISPR-Cas9 knockout screening in human cells. Science, 2014,343:84-87.
pmid: 24336571
[4] Platt R J, Chen S, Zhou Y, Yim M J, Swiech L, Kempton H R, Dahlman J E, Parnas O, Eisenhaure T M, Jovanovic M, Graham D B, Jhunjhunwala S, Heidenreich M, Xavier R J, Langer R, Anderson D G, Hacohen N, Regev A, Feng G P, Sharp P A, Zhang F. CRISPR-Cas9 knockin mice for genome editing and cancer modeling. Cell, 2014,159:440-455.
pmid: 25263330
[5] Komor A C, Kim Y B, Packer M S, Zuris J A, Liu D R. Programmable editing of a target base in genomic DNA without double-stranded DNA cleavage. Nature, 2016,533:420.
pmid: 27096365
[6] Maddalo D, Manchado E, Concepcion C P, Bonetti C, Vidigal J A, Han Y C, Ogrodowski C, Rekhtman N, Lowe S W, Ventura A. In vivo engineering of oncogenic chromosomal rearrangements with the CRISPR/Cas9 system. Nature, 2014,516:423.
pmid: 25337876
[7] Gaudelli N M, Komor A C, Rees H A, Packer M S, Badran A H, Bryson D I, Liu D R. Programmable base editing of A·T to G·C in genomic DNA without DNA cleavage. Nature, 2017,551:464.
pmid: 29160308
[8] Konermann S, Brigham M D, Trevin A E, Joung J, Abudayye O O, Barcena C, Hsu P D, Habib N, Gootenberg J S, Nishimasu H, Nureki O, Zhang F. Genome-scale transcriptional activation by an engineered CRISPR-Cas9 complex. Nature, 2015,517:583.
doi: 10.1038/nature14136 pmid: 25494202
[9] Kiani S, Beal J, Ebrahimkhani M R, Huh J, Hall R N, Xie Z, Li Y Q, Weiss R. CRISPR transcriptional repression devices and layered circuits in mammalian cells. Nat Methods, 2014,11:723.
pmid: 24797424
[10] Hilton I B, D’ippolito A M, Vockley C M, Thakore P I, Crawford G E, Reddy T E, Gersbach C A. Epigenome editing by a CRISPR-Cas9-based acetyltransferase activates genes from promoters and enhancers. Nat Biotechnol, 2015,33:510.
doi: 10.1038/nbt.3199 pmid: 25849900
[11] Zhou Y, Wang P, Tian F, Gao G, Huang L, Wei W, Xie X S. Painting a specific chromosome with CRISPR/Cas9 for live-cell imaging. Cell Res, 2017,27:298.
pmid: 28084328
[12] Hsu P D, Lander E S, Zhang F. Development and applications of CRISPR-Cas9 for genome engineering. Cell, 2014,157:1262-1278.
pmid: 24906146
[13] Hu J H, Miller S M, Geurts M H, Tang W X, Chen L W, Sun N, Zeina C M, Gao X, Rees H A, Lin Z, Liu D R. Evolved Cas9 variants with broad PAM compatibility and high DNA specificity. Nature, 2018,556:57.
doi: 10.1038/nature26155 pmid: 29512652
[14] Nishimasu H, Shi X, Ishiguro S, Gao L, Hirano S, Okazaki S, Oura S. Engineered CRISPR-Cas9 nuclease with expanded targeting space. Science, 2018,361:1259-1262.
doi: 10.1126/science.aas9129 pmid: 30166441
[15] Nawaz G, Han Y, Usman B, Liu F, Qin B X, Li R G. Knockout of OsPRP1, a gene encoding proline-rich protein, confers enhanced cold sensitivity in rice (Oryza sativa L.) at the seedling stage. 3 Biotech, 2019,9:254.
doi: 10.1007/s13205-019-1787-4 pmid: 31192079
[16] Bao A L, Chen H F, Chen L M, Chen S L, Hao Q G, Guo W, Qiu D Z, Shan Z H, Yang Z G, Yuan S G, Zhang C J, Zhang X J, Liu B H, Kong F J, Li X, Zhou X A, Tran L P, Cao D. CRISPR/ Cas9-mediated targeted mutagenesis of GmSPL9 genes alters plant architecture in soybean. BMC Plant Biol, 2019,19:131.
doi: 10.1186/s12870-019-1746-6 pmid: 30961525
[17] Doll N M, Gilles L M, Gérentes M F, Richard C, Just J, Fierlej Y, Borrelli V M G, Gendrot G, Ingram G C, Rogowsky P M, Widiez T. Single and multiple gene knockouts by CRISPR-Cas9 in maize. Plant Cell Rep, 2019,38:487-501.
doi: 10.1007/s00299-019-02378-1 pmid: 30684023
[18] Meng X, Yu H, Zhang Y, Zhuang F, Song X, Gao S, Gao C X, Li J. Construction of a genome-wide mutant library in rice using CRISPR/Cas9. Mol Plant, 2017,10:1238-1241.
doi: 10.1016/j.molp.2017.06.006 pmid: 28645639
[19] Qi X T, Dong L, Liu C L, Mao L, Liu F, Zhang X, Cheng B J, Xie C X. Systematic identification of endogenous RNA polymerase III promoters for efficient RNA guide-based genome editing technologies in maize. Crop J, 2018,6:314-320.
[20] Dong L, Qi X T, Zhu J J, Liu C L, Zhang X, Cheng B J, Mao L, Xie C X. Supersweet and waxy: meeting the diverse demands for specialty maize by genome editing. Plant Biotechnol J, 2019,17:1853-1855
doi: 10.1111/pbi.13144 pmid: 31050154
[21] Li C X, Liu C L, Qi X T, Wu Y, Fei X, Mao L, Cheng B J, Li X H, Xie C X. RNA-guided Cas9 as an in vivo desired-target mutator in maize. Plant Biotechnol J, 2017,15:1566-1576.
doi: 10.1111/pbi.2017.15.issue-12 pmid: 28379609
[22] Dong L, Li L N, Liu C L, Liu C X, Geng S F, Li X H, Huang C L, Mao L, Chen S J, Xie C X. Genome editing and double-fluores-cence proteins enable robust maternal haploid induction and identification in maize. Mol Plant, 2018,11:1214-1217.
doi: 10.1016/j.molp.2018.06.011 pmid: 30010025
[23] Datta S, Budhauliya R, Chatterjee S, Vanlalhmuaka, Veer V, Chakravarty R. Enhancement of PCR detection limit by single- tube restriction endonuclease-PCR (re-PCR). Mol Diagn Ther, 2016,20:297-305.
doi: 10.1007/s40291-016-0195-2 pmid: 26993322
[24] Vouillot L, Thélie A, Pollet N. Comparison of T7E1 and surveyor mismatch cleavage assays to detect mutations triggered by engineered nucleases. G3: Genes Genom Genet, 2015,5:407-415.
[25] Liu W, Wang C, Jiao X Z, Zhang H W, Song L L, Li Y X, Gao C X, Wang K J. Hi-TOM: a platform for high-throughput tracking of mutations induced by CRISPR/Cas systems. Sci China Life Sci, 2019,62:1-7.
doi: 10.1007/s11427-018-9402-9 pmid: 30446870
[26] Liang Z, Chen K, Yan Y, Zhang Y, Gao C X. Genotyping genome-edited mutations in plants using CRISPR ribonucleoprotein complexes. Plant Biotechnol J, 2018,16:2053-2062.
doi: 10.1111/pbi.12938 pmid: 29723918
[27] Dang Y, Jia G G, Choi J, Ma H, Anaya E, Ye C, Shankar P, Wu H. Optimizing sgRNA structure to improve CRISPR-Cas9 knockout efficiency. Genome Biol, 2015,16:280.
doi: 10.1186/s13059-015-0846-3 pmid: 26671237
[28] Yin H, Song C Q, Suresh S, Wu Q, Walsh S, Rhym L H, Mintzer E, Bolukbasi M F, Zhu L J, Kauffman K, Mou H, Oberholzer A, Ding J, Kwan S Y, Bogorad R L, Zatsepin T, Koteliansky V, Wolfe S A, Xue W, Langer R, Anderson D G. Structure-guided chemical modification of guide RNA enables potent non-viral in vivo genome editing. Nat Biotechnol, 2017,35:1179.
doi: 10.1038/nbt.4005 pmid: 29131148
[1] MEI Piao, LIU Ding-Ding, YE Yuan-Yuan, ZHANG Chen-Yu, DING Shi-Qi, LI Ya-Qi, WANG Pei-Xin, MEI Ju-Fen, MA Chun-Lei. Genetic diversity analysis of domestic albino tea germplasm resources based on the tea plant liquid phase functional chip [J]. Acta Agronomica Sinica, 2025, 51(9): 2358-2370.
[2] Jun-Hua YE,Qi-Tai YANG,Zhang-Xiong LIU,Yong GUO,Ying-Hui LI,Rong-Xia GUAN,Li-Juan QIU. Genotyping of SCN, SMV Resistance, Salinity Tolerance and Screening of Pyramiding Favorable Alleles in Introduced Soybean Accessions [J]. Acta Agronomica Sinica, 2018, 44(9): 1263-1273.
[3] WANG Hui-Na,CHU Zhi-Zhan,MA Xing-Liang,LI Ri-Qing,LIU Yao-Guang*. A High Through-Put Protocol of Plant Genomic DNA Preparation for PCR [J]. Acta Agron Sin, 2013, 39(07): 1200-1205.
Viewed
Full text


Abstract

Cited

  Shared   
  Discussed   
No Suggested Reading articles found!