Welcome to Acta Agronomica Sinica,

Acta Agronomica Sinica ›› 2021, Vol. 47 ›› Issue (10): 1903-1912.doi: 10.3724/SP.J.1006.2021.03060

• CROP GENETICS & BREEDING · GERMPLASM RESOURCES · MOLECULAR GENETICS • Previous Articles     Next Articles

Fine mapping and candidate gene analysis of maize defective kernel mutant dek54

ZHOU Lian(), LIU Chao-Xian, CHEN Qiu-Lan, WANG Wen-Qin, YAO Shun, ZHAO Zi-Kun, ZHU Si-Ying, HONG Xiang-De, XIONG Yu-Han, CAI Yi-Lin*()   

  1. Maize Research Institute / Academy of Agricultural Sciences / State Cultivation Base of Crop Stress Biology for Southern Mountainous Land, Southwest University, Chongqing 400715, China
  • Received:2020-10-15 Accepted:2021-01-13 Online:2021-10-12 Published:2021-03-02
  • Contact: CAI Yi-Lin E-mail:zhoulianjojo@swu.edu.cn;caiyilin1789@163.com
  • Supported by:
    National Natural Science Foundation of China(31601312)

Abstract:

Maize kernel is closely related to yield and nutritive quality. Study on the function of maize kernel development relative genes provides important basis for the molecular mechanism analysis, yield increasing and nutritive quality improving. B73 pollen was treated with ethyl methylmethanesulfonate (EMS) and a defective maize kernel defective kernel 54 (dek54) was screened. dek54 had small mature kernel, wrinkled and whitened seed coat phenotype. Genetic analysis indicated that dek54 is a recessive mutant controlled by a single gene. Paraffin sections showed starchy endosperm cells of dek54 had irregular shape and dense arrangement at developmental stage. Scanning electron microscopy observation indicated that protein bodies around starch granules in the central region of the dek54 mature kernel endosperm were fewer and arranged more loosely compare to wild type. Total protein, zein, amino acids components contents and total nitrogen content of dek54 mature kernel were significantly lowered compared with the wild type. dek54 was located on chromosome 7 within the interval of the physical distance of about 290 kb between markers SSR6 and SSR7. Sequencing revealed that the 351th base G on the 2nd exon of Zm00001d019294 gene changed into A, which led to the premature termination of the protein translation. Zm00001d019294 gene was specifically expressed in immature maize kernel, and has the highest expression in 12 DAP (days after pollination) immature kernel. Targeted mutation was performed using CRISPR/Cas9 system to identify that mutant phenotype was caused by candidate gene Zm00001d019294. Dek54 encoded an MFS (major facilitator superfamily) protein and had high homology with ZmNRT1.5 (nitrate transporter). Besides, Dek54 protein was localized in the plasma membrane of maize protoplasts. The study of dek54 laid the foundation for the molecular mechanism analysis of maize kernel development.

Key words: maize (Zea mays L.), defective kernel 54, kernel development, fine mapping

Fig. 1

Phenotypic characterization of dek54 mutant A: F2 segregating population of mature ear; B: phenotypes of kernels; C: cross section of kernels; D: longitudinally section of kernels; E: 100-kernel weight, ten-kernel length, and ten-kernel width of WT and dek54 mutant kernels from F2 segregating population. Bar: 0.5 cm. Em: embryo; En: endosperm; SE: starchy endosperm; VE: vitreous endosperm."

Fig. S1

Germination test of wildtype and dek54 mature kernels (5 days after germination) Bar: 1 cm."

Fig. 2

Histological observatin of dek54 mutant A: longitudinal paraffin sections observation of developing WT and dek54 mutant kernels at 16 DAP. Bar: 100 µm. AL: aleurone layer; SG: starch endosperm. B: scanning electron microscopy observation of the central regions of WT and dek54 mutant mature kernel endosperm. Bar: 50 µm. SG: starch granule; PB: protein body."

Fig. 3

Biochemical component analysis of dek54 mutant Protein (A), starch (B), amino acid components (C), and total nitrogen contents (D) of WT and dek54 mutant kernels."

Table 1

Sequences of SSR markers for dek54 mapping"

标记类型
Type
标记名称
Name
正向引物序列
Forward sequence (5′-3′)
反向引物序列
Reverse sequence (5′-3′)
SSR SSR23403 ACTAGTATGTGGATTGCTCGTCG GCTGCTGAGCTGTATGTACCA
SSR SSR1 CCCTGACGAAAGCATGAATGAG ACAGATGACTCTGCACCTCAAG
SSR SSR2 TGCCCATAAGAGCTTCGAGGATA AGCCTTAGTTGTCAGTCCATCG
SSR SSR3 TGCCCATAAGAGCTTCGAGGATA AGCCTTAGTTGTCAGTCCATCG
SSR SSR4 CCATCTGTACTAATGGCACCTGA GCCAGCAAAGCTTTTCAAGAGT
SSR SSR5 GGCTACATAAGATGCAAAGCGG TACCCTTTGACAGAGCCTACCT
SSR SSR6 GGTGCCAAAAACATCTCCCAAC TAGCGTGGGGTCATAGCAACA
SSR SSR7 CATGGCCAAAATATCGCACGAG TGACGTACATGAACACCTCGG
SSR SSR8 GCTAGGTGCAGTGTCTCTGCTT CCTTGAACGTGGGGTAGGCT
SSR SSR10308 GCAAATGTTCTGTGCAAGGCTA GCCCCACAAGAACTCCATCTAT

Table 2

Gene annotation in the mapping region of dek54 "

编号
No.
基因ID
Gene ID
功能注释
Function annotation
1 Zm00001d019292 无注释 No annotation
2 Zm00001d019293 异柠檬酸/异丙基苹果酸脱氢酶 Isocitric acid/isopropyl malate dehydrogenase
3 Zm00001d019294 MFS家族 Major facilitator superfamily

Fig. 4

Linkage SSR marker screening and fine mapping of dek54 A: the polymorphic PCR products amplified by umc2160 between WP and MP; B: confirmation of linkage SSR marker umc2160 by genotyping 33 dek54 mutant plants; C: fine mapping of dek54 using F2 population including 1566 individuals. dek54 was mapped to an interval about 290 kb flanked by SSR6 and SSR7. The symbols above and below the black vertical solid lines represent the molecular marker and the number of recombinants, respectively."

Fig. 5

Mutation site and spatio-temporal expression analysis of Zm00001d019294 A: gene structure diagram of Zm00001d019294. The red arrow indicates mutation sites. B: the relative expression level of Zm00001d019294 in different tissues and developing immature kernel."

Fig. 6

Phenotypic characterization of CRISPR/Cas9 targeted mutation of Zm00001d019294 A: the sequence in the Zm00001d019294 locus targeted using CRISPR/Cas9. The sgRNA target sequence is green. Protospacer-adjacent motif (PAM) is blue. Red letters and dashes represent insertions and deletions, respectively. B: mature F2 ear of dek54-cas9-1xMo17. C: mature WT and dek54-cas9-1 kernels. D: longitudinal paraffin sections of mature WT and dek54-cas9-1 kernels. Em: embryo; En: endosperm. Bars: 0.5 cm."

Fig. 7

Conserved domain (A) and phylogenetic (B) analysis of Dek54 protein"

Fig. 8

Observation of subcellular localization of Dek54 in maize protoplasts Dek54-GFP was co-localized with a mCherry-labeled plasma membrane marker (mCherry-PM; CD3-1007). Bar: 20 μm."

[1] Sabelli P A, Larkins B A. The development of endosperm in grasses. Plant Physiol, 2009, 149:14-26.
doi: 10.1104/pp.108.129437 pmid: 19126691
[2] Olsen O A. Endosperm development: cellularization and cell fate specification. Annu Rev Plant Physiol Plant Mol Biol, 2001, 52:233-267.
doi: 10.1146/annurev.arplant.52.1.233
[3] Lid S E, Gruis D, Jung R, Lorentzen J A, Ananiev E, Chamberlin M, Niu X, Meeley R, Nichols S, Olsen O A. The defective kernel 1 (dek1) gene required for aleurone cell development in the endosperm of maize grains encodes a membrane protein of the calpain gene superfamily. Proc Natl Acad Sci USA, 2002, 99:5460-5465.
doi: 10.1073/pnas.042098799
[4] Demko V, Perroud P F, Johansen W, Delwiche C F, Cooper E D, Remme P, Ako A E, Kugler K G, Mayer K F, Quatrano R, Olsen O A. Genetic analysis of DEFECTIVE KERNEL1 loop function in three-dimensional body patterning in Physcomitrella patens. Plant Physiol, 2014, 166:903-919.
doi: 10.1104/pp.114.243758
[5] Becraft P W, Li K, Dey N, Asuncion-Crabb Y. The maize dek1 gene functions in embryonic pattern formation and cell fate specification. Development, 2002, 129:5217-5225.
pmid: 12399313
[6] Tian Q, Olsen L, Sun B, Lid S E, Brown R C, Lemmon B E, Fosnes K, Gruis D F, Opsahl-Sorteberg H G, Otegui M S, Olsen O A. Subcellular localization and functional domain studies of DEFECTIVE KERNEL1 in maize and Arabidopsis suggest a model for aleurone cell fate specification involving CRINKLY4 and SUPERNUMERARY ALEURONE LAYER1. Plant Cell, 2007, 19:3127-3145.
doi: 10.1105/tpc.106.048868
[7] Qi W, Yang Y, Feng X, Zhang M, Song R. Mitochondrial function and maize kernel development requires Dek2, a pentatricopeptide repeat Protein involved in nad1 mRNA splicing. Genetics, 2017, 205:239-249.
doi: 10.1534/genetics.116.196105
[8] He Y, Wang J, Qi W, Song R. Maize Dek15 encodes the cohesin-loading complex subunit SCC4 and is essential for chromosome segregation and kernel development. Plant Cell, 2019, 31:465-485.
doi: 10.1105/tpc.18.00921
[9] Wang G, Zhong M, Shuai B, Song J, Zhang J, Han L, Ling H, Tang Y, Wang G, Song R. E+ subgroup PPR protein defective kernel 36 is required for multiple mitochondrial transcripts editing and seed development in maize and Arabidopsis. New Phytol, 2017, 214:1563-1578.
doi: 10.1111/nph.2017.214.issue-4
[10] Dai D, Luan S, Chen X, Wang Q, Feng Y, Zhu C, Qi W, Song R. Maize Dek37 encodes a P-type PPR protein that affects cis-splicing of mitochondrial nad2 intron 1 and seed development. Genetics, 2018, 208:1069-1082.
doi: 10.1534/genetics.117.300602
[11] Li X, Gu W, Sun S, Chen Z, Chen J, Song W, Zhao H, Lai J. Defective Kernel 39 encodes a PPR protein required for seed development in maize. J Integr Plant Biol, 2018, 60:45-64.
doi: 10.1111/jipb.v60.1
[12] Qi W, Lu L, Huang S, Song R. Maize Dek44 encodes mitochondrial ribosomal protein L9 and is required for seed development. Plant Physiol, 2019, 180:2106-2119.
doi: 10.1104/pp.19.00546
[13] Wang G, Wang F, Wang G, Wang F, Zhang X, Zhong M, Zhang J, Lin D, Tang Y, Xu Z, Song R. Opaque1 encodes a myosin XI motor protein that is required for endoplasmic reticulum motility and protein body formation in maize endosperm. Plant Cell, 2012, 24:3447-3462.
doi: 10.1105/tpc.112.101360
[14] Schmidt R J, Burr F A, Burr B. Transposon tagging and molecular analysis of the maize regulatory locus opaque-2. Science, 1987, 238:960-963.
pmid: 2823388
[15] Schmidt R J, Burr F A, Aukerman M J, Burr B. Maize regulatory gene opaque-2 encodes a protein with a “leucine-zipper” motif that binds to zein DNA. Proc Natl Acad Sci USA, 1990, 87:46-50.
doi: 10.1073/pnas.87.1.46
[16] Myers A M, James M G, Lin Q, Yi G, Stinard P S, Hennen-Bierwagen T A, Becraft P W. Maize opaque5 encodes monogalactosyldiacylglycerol synthase and specifically affects galactolipids necessary for amyloplast and chloroplast function. Plant Cell, 2011, 23:2331-2347.
doi: 10.1105/tpc.111.087205
[17] Wang G, Sun X, Wang G, Wang F, Gao Q, Sun X, Tang Y, Chang C, Lai J, Zhu L, Xu Z, Song R. Opaque7 encodes an acyl-activating enzyme-like protein that affects storage protein synthesis in maize endosperm. Genetics, 2011, 189:1281-1295.
doi: 10.1534/genetics.111.133967
[18] Feng F, Qi W, Lü Y, Yan S, Xu L, Yang W, Yuan Y, Chen Y, Zhao H, Song R. OPAQUE11 is a central hub of the regulatory network for maize endosperm development and nutrient metabolism. Plant Cell, 2018, 30:375-396.
doi: 10.1105/tpc.17.00616
[19] Sarika K, Hossain F, Muthusamy V, Zunjare R U, Baveja A, Goswami R, Thirunavukkarasu N, Jha S K, Gupta H S. Opaque16, a high lysine and tryptophan mutant, does not influence the key physico-biochemical characteristics in maize kernel. PLoS One, 2018, 13:e0190945.
doi: 10.1371/journal.pone.0190945
[20] Kim C S, Gibbon B C, Gillikin J W, Larkins B A, Boston R S, Jung R. The maize Mucronate mutation is a deletion in the 16-kDa gamma-zein gene that induces the unfolded protein response. Plant J, 2006, 48:440-451.
doi: 10.1111/tpj.2006.48.issue-3
[21] Kim C S, Hunter B G, Kraft J, Boston R S, Yans S, Jung R, Larkins B A. A defective signal peptide in a 19-kD alpha-zein protein causes the unfolded protein response and an opaque endosperm phenotype in the maize De*-B30 mutant. Plant Physiol, 2004, 134:380-387.
doi: 10.1104/pp.103.031310
[22] Holding D R, Otegui M S, Li B, Meeley R B, Dam T, Hunter B G, Jung R, Larkins B A. The maize floury1 gene encodes a novel endoplasmic reticulum protein involved in zein protein body formation. Plant Cell, 2007, 19:2569-2582.
pmid: 17693529
[23] Coleman C E, Lopes M A, Gillikin J W, Boston R S, Larkins B A. A defective signal peptide in the maize high-lysine mutant floury 2. Proc Natl Acad Sci USA, 1995, 92:6828-6831.
doi: 10.1073/pnas.92.15.6828
[24] 李强, 万建民. SSRHunter: 一个本地化的SSR位点搜索软件的开发. 遗传, 2005, 27:808-810.
Li Q, Wan J M. SSRHunter: development of a local searching software for SSR sites. Hereditas, 2005, 27:808-810.
[25] Zhou L, Zhou J, Xiong Y, Liu C, Wang J, Wang G, Cai Y. Overexpression of a maize plasma membrane intrinsic protein ZmPIP1;1 confers drought and salt tolerance in Arabidopsis. PLoS One, 2018, 13:e0198639.
doi: 10.1371/journal.pone.0198639
[26] Sheridan W F, Neuffer M G. Defective kernel mutants of maize: II. morphological and embryo culture studies. Genetics, 1980, 95:945-960.
pmid: 17249054
[27] Zhu C, Jin G, Fang P, Zhang Y, Feng X, Tang Y, Qi W, Song R. Maize pentatricopeptide repeat protein DEK41 affects cis-splicing of mitochondrial nad4 intron 3 and is required for normal seed development. J Exp Bot, 2019, 70:3795-3808.
doi: 10.1093/jxb/erz193
[28] Ren R C, Wang L L, Zhang L, Zhao Y J, Wu J W, Wei Y M, Zhang X S, Zhao X Y. DEK43 is a P-type pentatricopeptide repeat (PPR) protein responsible for the cis-splicing of nad4 in maize mitochondria. J Integr Plant Biol, 2020, 62:299-313.
doi: 10.1111/jipb.v62.3
[29] Dai D, Jin L, Huo Z, Yan S, Ma Z, Qi W, Song R. Pentatricopeptide repeat protein DEK46 is required for multi-sites mitochondrial RNA editing and maize seed development. J Exp Bot, 2020
[30] Fujii S, Small I. The evolution of RNA editing and pentatricopeptide repeat genes. New Phytol, 2011, 191:37-47.
doi: 10.1111/j.1469-8137.2011.03746.x pmid: 21557747
[31] Liang Z, Demko V, Wilson R C, Johnson K A, Ahmad R, Perroud P F, Quatrano R, Zhao S, Shalchian-Tabrizi K, Otegui M S, Olsen O A, Johansen W. The catalytic domain CysPc of the DEK1 calpain is functionally conserved in land plants. Plant J, 2013, 75:742-754.
doi: 10.1111/tpj.2013.75.issue-5
[32] Saier M H, Jr Reddy V S, Tamang D G, Västermark A. The transporter classification database. Nucleic Acids Res, 2014, 42:D251-258.
doi: 10.1093/nar/gkt1097
[33] Yan N. Structural biology of the Major Facilitator Superfamily transporters. Annu Rev Biophys, 2015, 44:257-283.
doi: 10.1146/annurev-biophys-060414-033901
[34] Parker J L, Newstead S. Molecular basis of nitrate uptake by the plant nitrate transporter NRT1.1. Nature, 2014, 507:68-72.
doi: 10.1038/nature13116
[35] Liu K H, Tsay Y F. Switching between the two action modes of the dual-affinity nitrate transporter CHL1 by phosphorylation. EMBO J, 2003, 22:1005-1013.
doi: 10.1093/emboj/cdg118
[36] Liu K H, Huang C Y, Tsay Y F. CHL1 is a dual-affinity nitrate transporter of Arabidopsis involved in multiple phases of nitrate uptake. Plant Cell, 1999, 11:865-874.
pmid: 10330471
[37] Lin S H, Kuo H F, Canivenc G, Lin C S, Lepetit M, Hsu P K, Tillard P, Lin H L, Wang Y Y, Tsai C B, Gojon A, Tsay Y F. Mutation of the Arabidopsis NRT1.5 nitrate transporter causes defective root-to-shoot nitrate transport. Plant Cell, 2008, 20:2514-2528.
doi: 10.1105/tpc.108.060244
[38] Li J Y, Fu Y L, Pike S M, Bao J, Tian W, Zhang Y, Chen C Z, Zhang Y, Li H M, Huang J, Li L G, Schroeder J I, Gassmann W, Gong J M. The Arabidopsis nitrate transporter NRT1.8 functions in nitrate removal from the xylem sap and mediates cadmium tolerance. Plant Cell, 2010, 22:1633-1646.
doi: 10.1105/tpc.110.075242
[1] YUAN Xin, ZHAO Zhuo-Fan, ZHAO Rui-Qing, LIU Xiao-Wei, ZHENG Ming-Min, LIU Yu-Sheng, DONG Hao-Sheng, DENG Li-Juan, CAO Mo-Ju, HUANG Qiang. Genetic analysis and molecular identification of a small kernel mutant mn-like1 in maize [J]. Acta Agronomica Sinica, 2025, 51(6): 1569-1581.
[2] LI Xue-Ting, REN Hao, WANG Hong-Zhang, ZHANG Ji-Wang, ZHAO Bin, REN Bai-Zhao, LIU Ying, YAO Hai-Yan, LIU Peng. Effects of salt stress on photosynthetic performance and dry matter accumulation and distribution in leaves of different salt-tolerant maize varieties [J]. Acta Agronomica Sinica, 2025, 51(4): 1091-1101.
[3] ZHU Jian-Ping, LI Wen-Qi, XU Yang, WANG Fang-Quan, LI Xia, JIANG Yan-Jie, FAN Fang-Jun, TAO Ya-Jun, CHEN Zhi-Hui, WU Ying-Ying, YANG Jie. Phenotypic analysis and gene mapping of a floury endosperm mutant we2 in rice [J]. Acta Agronomica Sinica, 2025, 51(4): 1110-1117.
[4] WAN Ying-Chun, BAN Yi-Jie, JIANG Yu-Dong, WANG Ya-Xin, LIU Jing-Jing, LIU Xiao-Qing, CHENG Yu-Lin, WANG Nan, FENG Ping. Phenotypic identification and fine mapping of male sterile mutant tpa1 in rice [J]. Acta Agronomica Sinica, 2024, 50(5): 1104-1114.
[5] HU Yao-Jie, LIU Ya-Ping, ZHENG Jun-Yan, HAN Ting, MA Bo-Jun, YE Ya-Feng, LIU Bin-Mei, CHEN Xi-Feng. Phenotype identification and gene mapping of lesion mimic and early senescence mutant lmes6 in rice [J]. Acta Agronomica Sinica, 2024, 50(11): 2764-2774.
[6] YUE Run-Qing, LI Wen-Lan, MENG Zhao-Dong. Acquisition and resistance analysis of transgenic Maize Inbred Line LG11 with insect and herbicide resistance [J]. Acta Agronomica Sinica, 2024, 50(1): 89-99.
[7] YANG Ye, SUN Qi, XING Xin-Xin, ZHANG Hai-Tao, ZHAO Zhi-Chao, CHENG Zhi-Jun. Identification of sheathed panicle mutant sui1-5 and screening of OsPSS1 interaction protein in rice (Oryza sativa L.) [J]. Acta Agronomica Sinica, 2023, 49(3): 597-607.
[8] ZHOU Wen-Qi, QIANG Xiao-Xia, LI Si-Yu, WANG Sen, WEI Wan-Rong. Identification of a rolling leaf allelic mutant e202 and fine mapping of E202 gene in rice [J]. Acta Agronomica Sinica, 2023, 49(11): 3029-3041.
[9] DING Meng-Li, WANG Ru-Yin, SHI Dong-Sheng, LI Ying-Bo, LEI Jie, CHEN Hong-Yu, SHEN Qing-Wen, WANG Gui-Feng. Map-based cloning and transcriptomic analysis of a maize miniature kernel mutant mn-Mu [J]. Acta Agronomica Sinica, 2023, 49(11): 3122-3130.
[10] ZOU Xiao-Xia, LIN Yi-Min, ZHAO Ya-Fei, LIU Yan, LIU Juan, WANG Yue-Fu, WANG Wei- Hua. Effects of calcium application on the distribution of photosynthetic carbon in plant-soil system at different peanut pod development stages [J]. Acta Agronomica Sinica, 2023, 49(1): 239-248.
[11] WANG Hao-Rang, ZHANG Yong, YU Chun-Miao, DONG Quan-Zhong, LI Wei-Wei, HU Kai-Feng, ZHANG Ming-Ming, XUE Hong, YANG Meng-Ping, SONG Ji-Ling, WANG Lei, YANG Xing-Yong, QIU Li-Juan. Fine mapping of yellow-green leaf gene (ygl2) in soybean (Glycine max L.) [J]. Acta Agronomica Sinica, 2022, 48(4): 791-800.
[12] TIAN Biao, DING Shi-Lin, LIU Chao-Lei, RUAN Ban-Pu, JIANG Hong-Zhen, GUO Rui, DONG Guo-Jun, HU Guang-Lian, GUO Long-Biao, QIAN Qian, GAO Zhen-Yu. Genetic analysis of seedling root traits and fine mapping of the QTL qLRL4 for the longest root length in rice [J]. Acta Agronomica Sinica, 2021, 47(10): 1863-1873.
[13] ZHANG Xue-Cui,ZHONG Chao,DUAN Can-Xing,SUN Su-Li,ZHU Zhen-Dong. Fine mapping of Phytophthora resistance gene RpsZheng in soybean cultivar Zheng 97196 [J]. Acta Agronomica Sinica, 2020, 46(7): 997-1005.
[14] REN Meng-Meng, ZHANG Hong-Wei, WANG Jian-Hua, WANG Guo-Ying, ZHENG Jun. Fine mapping of a major QTL qMES20-10 associated with deep-seeding tolerance in maize and analysis of differentially expressed genes [J]. Acta Agronomica Sinica, 2020, 46(7): 1016-1024.
[15] Li-Ping QIN,Er-Fei DONG,Yang BAI,Lian ZHOU,Lan-Yang REN,Ren-Feng ZHANG,Chao-Xian LIU,Yi-Lin CAI. Genetic analysis and molecular characterization of tasselseed mutant ts12 in maize [J]. Acta Agronomica Sinica, 2020, 46(5): 690-699.
Viewed
Full text


Abstract

Cited

  Shared   
  Discussed   
No Suggested Reading articles found!