Welcome to Acta Agronomica Sinica，

Acta Agronomica Sinica ›› 2022, Vol. 48 ›› Issue (7): 1635-1644.doi: 10.3724/SP.J.1006.2022.14106

• OCROP GENETICS & BREEDING·GERMPLASM RESOURCES·MOLECULAR GENETICS • Previous Articles     Next Articles

Functional validation of Bna-novel-miR36421 regulating plant architecture and flower organ development in Arabidopsis thaliana

DAI Li-Shi1,2(), CHANG Wei1,2(), ZHANG Sai1,2, QIAN Ming-Chao1,2, LI Xiao-Dong1,2, ZHANG Kai1,2, LI Jia-Na1,2,3, QU Cun-Min1,2,3,*(), LU Kun1,2,3,*()   

  1. 1College of Agronomy and Biotechnology, Southwest University, Chongqing 400715, China
    2Engineering Research Center of South Upland Agriculture, Ministry of Education, Chongqing 400715, China
    3Academy of Agricultural Sciences, Southwest University, Chongqing, 400715, China
  • Received:2021-06-22 Accepted:2021-10-19 Online:2022-07-12 Published:2021-11-03
  • Contact: QU Cun-Min,LU Kun E-mail:dls375684@163.com;changwei1919@163.com;drqucunmin@swu.edu.cn;drlukun@swu.edu.cn
  • About author:First author contact:

    ** Contributed equally to this work

  • Supported by:
    National Natural Science Foundation of China(31871653);National Key Research and Development Plan(2018YFD0100500);Project of Intellectual Base for Discipline Innovation in Colleges and Universities “the 111 Project”(B12006);Key Project of Natural Science Foundation;Germplasm Creation Special Program of Southwest University

RichHTML400

31

PDF

537

Abstract:

MicroRNA is involved in the regulation of various biological processes such as development, stress response, and embryonic development in rapeseed, however, only few studies focused on the regulation of miRNA on the plant architecture and floral organ development of rapeseed. In this study, Bna-novel-miR36421 that differentially expressed between the high and low harvest index accessions of rapeseed was identified, whose biological function and regulation mechanism were further characterized through phenotype analysis in transgenic plants, target gene prediction, expression pattern comparison, and dual luciferase reporter system. The results showed that Bna-novel-miR36421 was highly homologous to miR167 family members, and might be a novel miR167 member in rapeseed. The qRT-PCR and dual luciferase reporter system results indicated that Bna-novel-miR36421 could inhibit the relative expression levels of Bna.C03ARF6, Bna.C06ARF8, Bna.A09PATL2, and Bna.C03DUF581. In the overexpressing Arabidopsis plants, the expression of Bna-novel-miR36421 was significantly increased, while the transcription levels of the Arabidopsis orthologs of its target genes were decreased significantly. Phenotypic observation showed that the plant height of overexpression Arabidopsis plants were reduced, with shortened stems and curled leaves. The development of floral organs was abnormal, with enlarged pistil, shortened stamen filaments, unbreakable anthers, and aborted pollens. Hence, it could be proposed that Bna-novel-miR36421 may regulate plant architecture and floral organ development by repressing Bna.C03ARF6, Bna.C06ARF8, Bna.A09PATL2, and Bna.C03DUF581. The results laid a solid foundation for understanding the molecular mechanism of miRNA-mediated plant architecture and flower organ development, and mining the key genes involved in plant developmental processes.

Key words: Brassica napus, Bna-novel-miR36421, miRNA167, plant architecture, flower organ

Table S1

Bna-novel-miR36421 mature sequence and precursor sequence"

类别
Type		 序列
Sequence (5'-3')
成熟体序列
Mature sequence		 TAAGCTGCCAGCATGATCTTG
前体序列-1
Precursor sequence-1		 TAAGCTGCCAGCATGATCTTGTCTTCCTCTCCTAAGCTTCATATATAT
AACTAAGCTAAGGAAATAAATAATTTTCTCGTTCTCATAAGATTATAT
GATAATAGCTTAGAGAGAGAGAGACTAGGTCATGCTGGTAGCTTCAC
前体序列-2
Precursor sequence-2		 TAAGCTGCCAGCATGATCTTGTCTTCCTCTCTTAAGCTTCATATATAAC
TAAGCTAAGGAATAATATAATTTTCTTGTTCTCATAAGAATATATGATAA
TAGCTTAGAGAGAGAGAGAGAGAGACTAGGTCATGCTGGTAGTTTCAC

Table S2

Primers used in this study"

引物名称
Prime name		 引物序列
Primer sequence (5'-3')
62sk-miR36421F taagcttgatatcgaattcCAATATGAGATTTCGCAGTGACT
62sk-miR36421R cgctctagaactagtggatccCAAACACAACTAACCTTC
0800-C03ARF6F ttctagagcggccgcggatccGGTACAATGACGACACCTTCTAG
0800-C03ARF6R actggtgatttcagcgaattcTCCCCAAGTCATCACAGTTC
0800-C06ARF8F ttctagagcggccgcggatccCTGGATTTCAGAACACTTTGC
0800-C06ARF8R actggtgatttcagcgaattcGAAATGGGTGAGGTTCTGTG
0800-C03DUF581F ttctagagcggccgcggatccATGACTAAAATCTCTGTTGG
0800-C03DUF581R actggtgatttcagcgaattcAGGAACTATAAATAGCTGGCGT
0800-A09PATL2F ttctagagcggccgcggatccTCAGGAGCTACATATTTGAATATGG
0800-A09PATL2R actggtgatttcagcgaattcGACACGTTGTGATCTACAGCTCGT
OVmiR36421F caccAGTGACTAAGAAAGTTACCGAGGG
OVmiR36421R AGTGACTAAGAAAGTTACCGAGGG
F35S3ND GGAAGTTCATTTCATTTGGAGAG
OCS5ND CGATCATAGGCGTCTCGCATATCTC
F BAR CGACATCCGCCGTGCCACCGA
R BAR GTACCGGCAGGCTGAAGTCCAGC
BnaActin7F TGGGTTTGCTGGTGACGAT
BnaActin7R TGCCTAGGACGACCAACAATACT

Fig. 1

Prediction of secondary stem-loop structure of precursors of Bna-novel-miR36421 A: secondary stem loop structure of Bna-novel-MIR36421-1, dG = -26.500 kcal mol-1; B: secondary stem loop structure of Bna-novel-MIR36421-2, dG = -63.90 kcal mol-1."

Fig. 2

Sequence alignment of mature miRNAs between Bna-novel-miR36421 and rapeseed Bna-miR167 family members A: mature miRNAs alignments; B: precursor miRNAs alignments."

Fig. 3

Relative expression level and phenotypic observation of Bna-novel-miR36421 overexpression transgenic plants inArabidopsis thaliana A: detection of the relative expression level of Bna-novel-miR36421 in transgenic Arabidopsis thaliana. B: phenotypic observation of Bna-novel-miR36421 overexpression transgenic plants in Arabidopsis thaliana. C: phenotypic data statistics of Bna-novel-miR36421 overexpression transgenic plants in Arabidopsis thaliana. *, **, and **** represent significant difference at the 0.05, 0.01, and 0.0001 probability levels, respectively. NS: not significant difference."

Fig. 4

Relative expression levels of Bna-novel-miR36421 and its target genes expression in different materials and tissues P130: high harvest index material of Brassica napus; P202: low harvest index material of Brassica napus; 14dSe: 14 d seed; 14dSp: 14 d silique pericarp; 28dSe: 28 d seed; 28dSp: 28 d silique pericarp. **: P < 0.01."

Fig. 5

Bna-novel-miR36421 negatively regulates its target genes A: the relationship between Bna-novel-miR36421 and target genes validated by dual-luciferase reporter assays; B: qRT-PCR detection of Bna-novel-miR36421 and its target genes expression. **: P < 0.01."

Fig. 6

Proposed model of Bna-novel-miR36421 involved in regulation of plant architecture and floral organ development in rapeseed"

[1] Yu Y, Jia T, Chen X M. The ‘how’ and ‘where’ of plant microRNAs. New Phytol, 2017, 216: 1002-1017.
doi: 10.1111/nph.14834 pmid: 29048752
[2] Jones-Rhoades M W, Bartel D P. Computational identification of plant MicroRNAs and their targets, including a stress-induced miRNA. Mol Cell, 2004, 14: 787-799.
pmid: 15200956
[3] Lewis B P, Burge C B, Ba Rtel D P J C. Conserved seed pairing, often flanked by adenosines, indicates that thousands of human genes are microRNA targets. Cell, 2005, 120: 15-20.
doi: 10.1016/j.cell.2004.12.035
[4] Stark A, Brennecke J, Bushati N, Russell R B, Cohen S M J C. Animal microRNAs confer robustness to gene expression and have a significant impact on 3'UTR evolution. Cell, 2005, 123: 1133-1146.
doi: 10.1016/j.cell.2005.11.023
[5] Cuperus J T, Fahlgren N, Carrington J C J P C. Evolution and functional diversification of MIRNA genes. Plant Cell, 2011, 23: 431-442.
doi: 10.1105/tpc.110.082784
[6] Lee C T, Risom T, Strauss W M. Evolutionary conservation of microRNA regulatory circuits: an examination of microRNA gene complexity and conserved microRNA-target interactions through metazoan phylogeny. DNA Cell Biol, 2007, 26: 209-218.
doi: 10.1089/dna.2006.0545
[7] Heimberg A M, Sempere L F, Moy V N, Donoghue P C J, Peterson K J. MicroRNAs and the advent of vertebrate morphological complexity. Proc Natl Acad Sci USA, 2008, 105: 2946-2950.
doi: 10.1073/pnas.0712259105
[8] Lu J, Fu Y, Kumar S, Shen Y, Zeng K, Xu A, Carthew R, Wu C I. Adaptive evolution of newly emerged micro-RNA genes in Drosophila. Genome Biol Evol, 2008, 25: 929-938.
[9] Berezikov E. Evolution of microRNA diversity and regulation in animals. Nat Rev Genet, 2011, 12: 846-860.
doi: 10.1038/nrg3079 pmid: 22094948
[10] Chen L, Chen L, Zhang X X, Liu T T, Niu S L, Wen J, Yi B, Ma C Z, Tu J X, Fu T D, Shen J X. Identification of miRNAs that regulate silique development in Brassica napus. Plant Sci, 2018, 269: 106-117.
doi: S0168-9452(17)31095-6 pmid: 29606207
[11] Xie F L, Huang S Q, Guo K, Xiang A L, Zhu Y Y, Nie L, Yang Z M. Computational identification of novel microRNAs and targets in Brassica napus . FEBS Lett, 2007, 581: 1464-1474.
doi: 10.1016/j.febslet.2007.02.074
[12] Zhao Y T, Wang M, Fu S X, Yang W C, Qi C K, Wang X J. Small RNA profiling in two Brassica napus cultivars identifies microRNAs with oil production- and development- correlated expression and new small RNA classes. Plant Physiol, 2012, 158: 813-823.
doi: 10.1104/pp.111.187666
[13] Huang D, Koh C, Feurtado J A, Tsang E W, Cutler A J. MicroRNAs and their putative targets in Brassica napus seed maturation. BMC Genomics, 2013, 14: 140.
doi: 10.1186/1471-2164-14-140
[14] Donald C M. The breeding of crop ideotypes. Euphytica, 1968, 17: 385-403.
doi: 10.1007/BF00056241
[15] Peiffer J A, Romay M C, Gore M A, Flint-Garcia S A, Zhang Z, Millard M J, Gardner C A, McMullen M D, Holland J B, Bradbury P J. The genetic architecture of maize height. Genetics, 2014, 196: 1337-1356.
doi: 10.1534/genetics.113.159152 pmid: 24514905
[16] Heimberg A M, Sempere L F, Moy V N, Donoghue P C, Peterson K J. MicroRNAs and the advent of vertebrate morphological complexity. Proc Natl Acad Sci USA, 2008, 105: 2946-2950.
doi: 10.1073/pnas.0712259105
[17] Sun C, Wang B, Wang X, Hu K, Li K, Li Z, Li S, Yan L, Guan C, Zhang J. Genome-wide association study dissecting the genetic architecture underlying the branch angle trait in rapeseed (Brassica napus L.). Sci Rep, 2016, 6: 33673.
doi: 10.1038/srep33673
[18] Wang H, Cheng H, Wang W, Liu J, Hao M, Mei D, Zhou R, Fu L, Hu Q. Identification of BnaYUCCA6 as a candidate gene for branch angle in Brassica napus by QTL-seq. Sci Rep, 2016, 6: 38493.
doi: 10.1038/srep38493 pmid: 27922076
[19] Zhao B, Li H, Li J, Wang B, Dai C, Wang J, Liu K. Brassica napus DS-3, encoding a DELLA protein, negatively regulates stem elongation through gibberellin signaling pathway. Theor Appl Genet, 2017, 130: 727-741.
doi: 10.1007/s00122-016-2846-4 pmid: 28093630
[20] Wang T, Ping X, Cao Y, Jian H, Gao Y, Wang J, Tan Y, Xu X, Lu K, Li J. Genome-wide exploration and characterization of miR172/euAP2 genes in Brassica napus L. for likely role in flower organ development. BMC Plant Biol, 2019, 19: 336.
doi: 10.1186/s12870-019-1936-2
[21] Earley K W, Haag J R, Pontes O, Opper K, Juehne T, Song K, Pikaard C S. Gateway-compatible vectors for plant functional genomics and proteomics. Plant J, 2006, 45: 616-629.
pmid: 16441352
[22] Lu K, Li T, He J, Chang W, Zhang R, Liu M, Yu M, Fan Y, Ma J, Sun W, Qu C, Liu L, Li N, Liang Y, Wang R, Qian W, Tang Z, Xu X, Lei B, Zhang K, Li J. qPrimerDB: a thermodynamics-based gene-specific qPCR primer database for 147 organisms. Nucleic Acids Res, 2018, 46: D1229-D1236.
[23] Lu J, Shen Y, Wu Q, Kumar S, He B, Shi S, Carthew R W, Wang S M, Wu C I. The birth and death of microRNA genes in Drosophila. Nat Genet, 2008, 40: 351.
doi: 10.1038/ng.73
[24] Quah S, Hui J H, Holland P W. A burst of miRNA innovation in the early evolution of butterflies and moths. Mol Biol Evol, 2015, 32: 1161-1174.
doi: 10.1093/molbev/msv004
[25] Zheng L, Nagpal P, Villarino G, Trinidad B, Bird L, Huang Y, Reed J W. miR167 limits anther growth to potentiate anther dehiscence. Development, 2019, 146: dev174375.
[26] Ellis C M, Nagpal P, Young J C, Hagen G, Guilfoyle T J, Reed J W. AUXIN RESPONSE FACTOR1 and AUXIN RESPONSE FACTOR2 regulate senescence and floral organ abscission in Arabidopsis thaliana. Development, 2005, 132: 4563-4574.
doi: 10.1242/dev.02012
[27] Reeves P H, Ellis C M, Ploense S E, Wu M F, Yadav V, Tholl D, Chetelat A, Haupt I, Kennerley B J, Hodgens C, Farmer E E, Nagpal P, Reed J W. A regulatory network for coordinated flower maturation. PLoS Genet, 2012, 8: e1002506.
doi: 10.1371/journal.pgen.1002506
[28] Tabata R, Ikezaki M, Fujibe T, Aida M, Tian C E, Ueno Y, Yamamoto K T, Machida Y, Nakamura K, Ishiguro S. Arabidopsis AUXIN RESPONSE FACTOR6 and 8 regulate jasmonic acid biosynthesis and floral organ development via repression of class 1 KNOX genes. Plant Cell Physiol, 2010, 51: 164-175.
doi: 10.1093/pcp/pcp176 pmid: 20007966
[29] Nagpal P, Ellis C M, Weber H, Ploense S E, Barkawi L S, Guilfoyle T J, Hagen G, Alonso J M, Cohen J D, Farmer E E. Auxin response factors ARF6 and ARF8 promote jasmonic acid production and flower maturation. Development, 2005, 132: 4107-4118.
doi: 10.1242/dev.01955
[30] Tejos R, Rodriguez-Furlan C, Adamowski M, Sauer M, Norambuena L, Friml J. PATELLINS are regulators of auxin-mediated PIN1 relocation and plant development in Arabidopsis thaliana. J Cell Sci, 2018, 131: jcs204198.
[31] Forestan C, Varotto S. The role of PIN auxin efflux carriers in polar auxin transport and accumulation and their effect on shaping maize development. Mol Plant, 2012, 5: 787-798.
doi: 10.1093/mp/ssr103
[32] Gallavotti A. The role of auxin in shaping shoot architecture. J Exp Bot, 2013, 64: 2593-2608.
doi: 10.1093/jxb/ert141 pmid: 23709672
[33] Laxmi A. DUF581 is plant specific FCS-like zinc finger involved in protein-protein interaction. PLoS One, 2014, 9: e99074.
doi: 10.1371/journal.pone.0099074
[34] Nietzsche M, Schießl I, Börnke F. The complex becomes more complex: protein-protein interactions of SnRK1 with DUF581 family proteins provide a framework for cell- and stimulus type-specific SnRK1 signaling in plants. Front Plant Sci 2014, 5: 54.
doi: 10.3389/fpls.2014.00054 pmid: 24600465
[35] Bitrian M, Roodbarkelari F, Horvath M, Koncz C. BAC- recombineering for studying plant gene regulation: developmental control and cellular localization of SnRK1 kinase subunits. Plant J, 2011, 65: 829-842.
doi: 10.1111/j.1365-313X.2010.04462.x
[36] Jiao Y Q, Wang Y H, Xue D W, Wang J, Yan M X, Liu G F, Dong G J, Zeng D L, Lu Z F, Zhu X D, Qian Q, Li J Y. Regulation of OsSPL14 by OsmiR156 defines ideal plant architecture in rice. Nat Genet, 2010, 42: 541-544.
doi: 10.1038/ng.591
[37] Che R H, Tong H N, Shi B H, Liu Y Q, Fang S R, Liu D P, Xiao Y H, Hu B, Liu L C, Wang H R, Zhao M F, Chu C C. Control of grain size and rice yield by GL2-mediated brassinosteroid responses. Nat Plants, 2015, 2: 15195.
doi: 10.1038/nplants.2015.195
[38] Nair S K, Wang N, Turuspekov Y, Pourkheirandish M, Sinsuwongwat S, Chen G X, Sameri M, Tagiri A, Honda I, Watanabe Y, Kanamori H, Wicker T, Stein N, Nagamura Y, Matsumoto T, Komatsuda T. Cleistogamous flowering in barley arises from the suppression of microRNA-guided HvAP2 mRNA cleavage. Proc Natl Acad Sci USA, 2010, 107: 490-495.
doi: 10.1073/pnas.0909097107
[39] Silva G F F, Silva E M, da Silva Azevedo M, Guivin M A C, Ramiro D A, Figueiredo C R, Carrer H, Peres L E P, Nogueira F T S. microRNA156-targeted SPL/SBP box transcription factors regulate tomato ovary and fruit development. Plant J, 2014, 78: 604-618.
doi: 10.1111/tpj.12493
[40] Tang J, Chu C. microRNAs in crop improvement: fine-tuners for complex traits. Nat Plants, 2017, 3: 17077.
doi: 10.1038/nplants.2017.77
[1] CHEN Song-Yu, DING Yi-Juan, SUN Jun-Ming, HUANG Deng-Wen, YANG Nan, DAI Yu-Han, WAN Hua-Fang, QIAN Wei. Genome-wide identification of BnCNGC and the gene expression analysis in Brassica napus challenged with Sclerotinia sclerotiorum and PEG-simulated drought [J]. Acta Agronomica Sinica, 2022, 48(6): 1357-1371.
[2] WANG Xiao-Lei, LI Wei-Xing, OU-YANG Lin-Juan, XU Jie, CHEN Xiao-Rong, BIAN Jian-Min, HU Li-Fang, PENG Xiao-Song, HE Xiao-Peng, FU Jun-Ru, ZHOU Da-Hu, HE Hao-Hua, SUN Xiao-Tang, ZHU Chang-Lan. QTL mapping for plant architecture in rice based on chromosome segment substitution lines [J]. Acta Agronomica Sinica, 2022, 48(5): 1141-1151.
[3] YUAN Da-Shuang, DENG Wan-Yu, WANG Zhen, PENG Qian, ZHANG Xiao-Li, YAO Meng-Nan, MIAO Wen-Jie, ZHU Dong-Ming, LI Jia-Na, LIANG Ying. Cloning and functional analysis of BnMAPK2 gene in Brassica napus [J]. Acta Agronomica Sinica, 2022, 48(4): 840-850.
[4] HUANG Cheng, LIANG Xiao-Mei, DAI Cheng, WEN Jing, YI Bin, TU Jin-Xing, SHEN Jin-Xiong, FU Ting-Dong, MA Chao-Zhi. Genome wide analysis of BnAPs gene family in Brassica napus [J]. Acta Agronomica Sinica, 2022, 48(3): 597-607.
[5] WANG Rui, CHEN Xue, GUO Qing-Qing, ZHOU Rong, CHEN Lei, LI Jia-Na. Development of linkage InDel markers of the white petal gene based on whole-genome re-sequencing data in Brassica napus L. [J]. Acta Agronomica Sinica, 2022, 48(3): 759-769.
[6] WANG Yan-Hua, LIU Jing-Sen, LI Jia-Na. Integrating GWAS and WGCNA to screen and identify candidate genes for biological yield in Brassica napus L. [J]. Acta Agronomica Sinica, 2021, 47(8): 1491-1510.
[7] LI Jie-Hua, DUAN Qun, SHI Ming-Tao, WU Lu-Mei, LIU Han, LIN Yong-Jun, WU Gao-Bing, FAN Chu-Chuan, ZHOU Yong-Ming. Development and identification of transgenic rapeseed with a novel gene for glyphosate resistance [J]. Acta Agronomica Sinica, 2021, 47(5): 789-798.
[8] TANG Xin, LI Yuan-Yuan, LU Jun-Xing, ZHANG Tao. Morphological characteristics and cytological study of anther abortion of temperature-sensitive nuclear male sterile line 160S in Brassica napus [J]. Acta Agronomica Sinica, 2021, 47(5): 983-990.
[9] ZHOU Xin-Tong, GUO Qing-Qing, CHEN Xue, LI Jia-Na, WANG Rui. Construction of a high-density genetic map using genotyping by sequencing (GBS) for quantitative trait loci (QTL) analysis of pink petal trait in Brassica napus L. [J]. Acta Agronomica Sinica, 2021, 47(4): 587-598.
[10] LI Shu-Yu, HUANG Yang, XIONG Jie, DING Ge, CHEN Lun-Lin, SONG Lai-Qiang. QTL mapping and candidate genes screening of earliness traits in Brassica napus L. [J]. Acta Agronomica Sinica, 2021, 47(4): 626-637.
[11] TANG Jing-Quan, WANG Nan, GAO Jie, LIU Ting-Ting, WEN Jing, YI Bin, TU Jin-Xing, FU Ting-Dong, SHEN Jin-Xiong. Bioinformatics analysis of SnRK gene family and its relation with seed oil content of Brassica napus L. [J]. Acta Agronomica Sinica, 2021, 47(3): 416-426.
[12] MENG Jiang-Yu, LIANG Guang-Wei, HE Ya-Jun, QIAN Wei. QTL mapping of salt and drought tolerance related traits in Brassica napus L. [J]. Acta Agronomica Sinica, 2021, 47(3): 462-471.
[13] WEI Li-Juan, SHEN Shu-Lin, HUANG Xiao-Hu, MA Guo-Qiang, WANG Xi-Tong, YANG Yi-Ling, LI Huan-Dong, WANG Shu-Xian, ZHU Mei-Chen, TANG Zhang-Lin, LU Kun, LI Jia-Na, QU Cun-Min. Genome-wide association analysis reveals zinc-tolerant loci of rapeseed at germination stage [J]. Acta Agronomica Sinica, 2021, 47(2): 262-274.
[14] LI Qian, Nadil Shah, ZHOU Yuan-Wei, HOU Zhao-Ke, GONG Jian-Fang, LIU Jue, SHANG Zheng-Wei, ZHANG Lei, ZHAN Zong-Xiang, CHANG Hai-Bin, FU Ting-Dong, PIAO Zhong-Yun, ZHANG Chun-Yu. Breeding of a novel clubroot disease-resistant Brassica napus variety Huayouza 62R [J]. Acta Agronomica Sinica, 2021, 47(2): 210-223.
[15] WANG Rui-Li, WANG Liu-Yan, LEI Wei, WU Jia-Yi, SHI Hong-Song, LI Chen-Yang, TANG Zhang-Lin, LI Jia-Na, ZHOU Qing-Yuan, CUI Cui. Screening candidate genes related to aluminum toxicity stress at germination stage via RNA-seq and QTL mapping in Brassica napus L. [J]. Acta Agronomica Sinica, 2021, 47(12): 2407-2422.
Viewed
Full text


Abstract

Cited
  Shared   
  Discussed   
[1] Li Shaoqing, Li Yangsheng, Wu Fushun, Liao Jianglin, Li Damo. Optimum Fertilization and Its Corresponding Mechanism under Complete Submergence at Booting Stage in Rice[J]. Acta Agronomica Sinica, 2002, 28(01): 115 -120 .
[2] Wang Lanzhen;Mi Guohua;Chen Fanjun;Zhang Fusuo. Response to Phosphorus Deficiency of Two Winter Wheat Cultivars with Different Yield Components[J]. Acta Agron Sin, 2003, 29(06): 867 -870 .
[3] YANG Jian-Chang;ZHANG Jian-Hua;WANG Zhi-Qin;ZH0U Qing-Sen. Changes in Contents of Polyamines in the Flag Leaf and Their Relationship with Drought-resistance of Rice Cultivars under Water Deficiency Stress[J]. Acta Agron Sin, 2004, 30(11): 1069 -1075 .
[4] Yan Mei;Yang Guangsheng;Fu Tingdong;Yan Hongyan. Studies on the Ecotypical Male Sterile-fertile Line of Brassica napus L.Ⅲ. Sensitivity to Temperature of 8-8112AB and Its Inheritance[J]. Acta Agron Sin, 2003, 29(03): 330 -335 .
[5] Wang Yongsheng;Wang Jing;Duan Jingya;Wang Jinfa;Liu Liangshi. Isolation and Genetic Research of a Dwarf Tiilering Mutant Rice[J]. Acta Agron Sin, 2002, 28(02): 235 -239 .
[6] WANG Li-Yan;ZHAO Ke-Fu. Some Physiological Response of Zea mays under Salt-stress[J]. Acta Agron Sin, 2005, 31(02): 264 -268 .
[7] TIAN Meng-Liang;HUNAG Yu-Bi;TAN Gong-Xie;LIU Yong-Jian;RONG Ting-Zhao. Sequence Polymorphism of waxy Genes in Landraces of Waxy Maize from Southwest China[J]. Acta Agron Sin, 2008, 34(05): 729 -736 .
[8] HU Xi-Yuan;LI Jian-Ping;SONG Xi-Fang. Efficiency of Spatial Statistical Analysis in Superior Genotype Selection of Plant Breeding[J]. Acta Agron Sin, 2008, 34(03): 412 -417 .
[9] WANG Yan;QIU Li-Ming;XIE Wen-Juan;HUANG Wei;YE Feng;ZHANG Fu-Chun;MA Ji. Cold Tolerance of Transgenic Tobacco Carrying Gene Encoding Insect Antifreeze Protein[J]. Acta Agron Sin, 2008, 34(03): 397 -402 .
[10] ZHENG Xi;WU Jian-Guo;LOU Xiang-Yang;XU Hai-Ming;SHI Chun-Hai. Mapping and Analysis of QTLs on Maternal and Endosperm Genomes for Histidine and Arginine in Rice (Oryza sativa L.) across Environments[J]. Acta Agron Sin, 2008, 34(03): 369 -375 .
Add: No. 80 Xueyuan South Rd, Beijing 100081, P. R. China E-mail: zwxb301@caas.cn
Supported by Beijing Magtech Co.Ltd