Welcome to Acta Agronomica Sinica，

Acta Agronomica Sinica ›› 2022, Vol. 48 ›› Issue (7): 1635-1644.doi: 10.3724/SP.J.1006.2022.14106

• CROP GENETICS & BREEDING · GERMPLASM RESOURCES · MOLECULAR GENETICS • Previous Articles     Next Articles

Functional validation of Bna-novel-miR36421 regulating plant architecture and flower organ development in Arabidopsis thaliana

DAI Li-Shi1,2(), CHANG Wei1,2(), ZHANG Sai1,2, QIAN Ming-Chao1,2, LI Xiao-Dong1,2, ZHANG Kai1,2, LI Jia-Na1,2,3, QU Cun-Min1,2,3,*(), LU Kun1,2,3,*()   

  1. 1College of Agronomy and Biotechnology, Southwest University, Chongqing 400715, China
    2Engineering Research Center of South Upland Agriculture, Ministry of Education, Chongqing 400715, China
    3Academy of Agricultural Sciences, Southwest University, Chongqing, 400715, China
  • Received:2021-06-22 Accepted:2021-10-19 Online:2022-07-12 Published:2021-11-03
  • Contact: QU Cun-Min,LU Kun E-mail:dls375684@163.com;changwei1919@163.com;drqucunmin@swu.edu.cn;drlukun@swu.edu.cn
  • About author:First author contact:

    ** Contributed equally to this work

  • Supported by:
    National Natural Science Foundation of China(31871653);National Key Research and Development Plan(2018YFD0100500);Project of Intellectual Base for Discipline Innovation in Colleges and Universities “the 111 Project”(B12006);Key Project of Natural Science Foundation;Germplasm Creation Special Program of Southwest University

RichHTML400

38

PDF

637

Abstract:

MicroRNA is involved in the regulation of various biological processes such as development, stress response, and embryonic development in rapeseed, however, only few studies focused on the regulation of miRNA on the plant architecture and floral organ development of rapeseed. In this study, Bna-novel-miR36421 that differentially expressed between the high and low harvest index accessions of rapeseed was identified, whose biological function and regulation mechanism were further characterized through phenotype analysis in transgenic plants, target gene prediction, expression pattern comparison, and dual luciferase reporter system. The results showed that Bna-novel-miR36421 was highly homologous to miR167 family members, and might be a novel miR167 member in rapeseed. The qRT-PCR and dual luciferase reporter system results indicated that Bna-novel-miR36421 could inhibit the relative expression levels of Bna.C03ARF6, Bna.C06ARF8, Bna.A09PATL2, and Bna.C03DUF581. In the overexpressing Arabidopsis plants, the expression of Bna-novel-miR36421 was significantly increased, while the transcription levels of the Arabidopsis orthologs of its target genes were decreased significantly. Phenotypic observation showed that the plant height of overexpression Arabidopsis plants were reduced, with shortened stems and curled leaves. The development of floral organs was abnormal, with enlarged pistil, shortened stamen filaments, unbreakable anthers, and aborted pollens. Hence, it could be proposed that Bna-novel-miR36421 may regulate plant architecture and floral organ development by repressing Bna.C03ARF6, Bna.C06ARF8, Bna.A09PATL2, and Bna.C03DUF581. The results laid a solid foundation for understanding the molecular mechanism of miRNA-mediated plant architecture and flower organ development, and mining the key genes involved in plant developmental processes.

Key words: Brassica napus, Bna-novel-miR36421, miRNA167, plant architecture, flower organ

Table S1

Bna-novel-miR36421 mature sequence and precursor sequence"

类别
Type		 序列
Sequence (5'-3')
成熟体序列
Mature sequence		 TAAGCTGCCAGCATGATCTTG
前体序列-1
Precursor sequence-1		 TAAGCTGCCAGCATGATCTTGTCTTCCTCTCCTAAGCTTCATATATAT
AACTAAGCTAAGGAAATAAATAATTTTCTCGTTCTCATAAGATTATAT
GATAATAGCTTAGAGAGAGAGAGACTAGGTCATGCTGGTAGCTTCAC
前体序列-2
Precursor sequence-2		 TAAGCTGCCAGCATGATCTTGTCTTCCTCTCTTAAGCTTCATATATAAC
TAAGCTAAGGAATAATATAATTTTCTTGTTCTCATAAGAATATATGATAA
TAGCTTAGAGAGAGAGAGAGAGAGACTAGGTCATGCTGGTAGTTTCAC

Table S2

Primers used in this study"

引物名称
Prime name		 引物序列
Primer sequence (5'-3')
62sk-miR36421F taagcttgatatcgaattcCAATATGAGATTTCGCAGTGACT
62sk-miR36421R cgctctagaactagtggatccCAAACACAACTAACCTTC
0800-C03ARF6F ttctagagcggccgcggatccGGTACAATGACGACACCTTCTAG
0800-C03ARF6R actggtgatttcagcgaattcTCCCCAAGTCATCACAGTTC
0800-C06ARF8F ttctagagcggccgcggatccCTGGATTTCAGAACACTTTGC
0800-C06ARF8R actggtgatttcagcgaattcGAAATGGGTGAGGTTCTGTG
0800-C03DUF581F ttctagagcggccgcggatccATGACTAAAATCTCTGTTGG
0800-C03DUF581R actggtgatttcagcgaattcAGGAACTATAAATAGCTGGCGT
0800-A09PATL2F ttctagagcggccgcggatccTCAGGAGCTACATATTTGAATATGG
0800-A09PATL2R actggtgatttcagcgaattcGACACGTTGTGATCTACAGCTCGT
OVmiR36421F caccAGTGACTAAGAAAGTTACCGAGGG
OVmiR36421R AGTGACTAAGAAAGTTACCGAGGG
F35S3ND GGAAGTTCATTTCATTTGGAGAG
OCS5ND CGATCATAGGCGTCTCGCATATCTC
F BAR CGACATCCGCCGTGCCACCGA
R BAR GTACCGGCAGGCTGAAGTCCAGC
BnaActin7F TGGGTTTGCTGGTGACGAT
BnaActin7R TGCCTAGGACGACCAACAATACT

Fig. 1

Prediction of secondary stem-loop structure of precursors of Bna-novel-miR36421 A: secondary stem loop structure of Bna-novel-MIR36421-1, dG = -26.500 kcal mol-1; B: secondary stem loop structure of Bna-novel-MIR36421-2, dG = -63.90 kcal mol-1."

Fig. 2

Sequence alignment of mature miRNAs between Bna-novel-miR36421 and rapeseed Bna-miR167 family members A: mature miRNAs alignments; B: precursor miRNAs alignments."

Fig. 3

Relative expression level and phenotypic observation of Bna-novel-miR36421 overexpression transgenic plants inArabidopsis thaliana A: detection of the relative expression level of Bna-novel-miR36421 in transgenic Arabidopsis thaliana. B: phenotypic observation of Bna-novel-miR36421 overexpression transgenic plants in Arabidopsis thaliana. C: phenotypic data statistics of Bna-novel-miR36421 overexpression transgenic plants in Arabidopsis thaliana. *, **, and **** represent significant difference at the 0.05, 0.01, and 0.0001 probability levels, respectively. NS: not significant difference."

Fig. 4

Relative expression levels of Bna-novel-miR36421 and its target genes expression in different materials and tissues P130: high harvest index material of Brassica napus; P202: low harvest index material of Brassica napus; 14dSe: 14 d seed; 14dSp: 14 d silique pericarp; 28dSe: 28 d seed; 28dSp: 28 d silique pericarp. **: P < 0.01."

Fig. 5

Bna-novel-miR36421 negatively regulates its target genes A: the relationship between Bna-novel-miR36421 and target genes validated by dual-luciferase reporter assays; B: qRT-PCR detection of Bna-novel-miR36421 and its target genes expression. **: P < 0.01."

Fig. 6

Proposed model of Bna-novel-miR36421 involved in regulation of plant architecture and floral organ development in rapeseed"

[1] Yu Y, Jia T, Chen X M. The ‘how’ and ‘where’ of plant microRNAs. New Phytol, 2017, 216: 1002-1017.
doi: 10.1111/nph.14834 pmid: 29048752
[2] Jones-Rhoades M W, Bartel D P. Computational identification of plant MicroRNAs and their targets, including a stress-induced miRNA. Mol Cell, 2004, 14: 787-799.
pmid: 15200956
[3] Lewis B P, Burge C B, Ba Rtel D P J C. Conserved seed pairing, often flanked by adenosines, indicates that thousands of human genes are microRNA targets. Cell, 2005, 120: 15-20.
doi: 10.1016/j.cell.2004.12.035
[4] Stark A, Brennecke J, Bushati N, Russell R B, Cohen S M J C. Animal microRNAs confer robustness to gene expression and have a significant impact on 3'UTR evolution. Cell, 2005, 123: 1133-1146.
doi: 10.1016/j.cell.2005.11.023
[5] Cuperus J T, Fahlgren N, Carrington J C J P C. Evolution and functional diversification of MIRNA genes. Plant Cell, 2011, 23: 431-442.
doi: 10.1105/tpc.110.082784
[6] Lee C T, Risom T, Strauss W M. Evolutionary conservation of microRNA regulatory circuits: an examination of microRNA gene complexity and conserved microRNA-target interactions through metazoan phylogeny. DNA Cell Biol, 2007, 26: 209-218.
doi: 10.1089/dna.2006.0545
[7] Heimberg A M, Sempere L F, Moy V N, Donoghue P C J, Peterson K J. MicroRNAs and the advent of vertebrate morphological complexity. Proc Natl Acad Sci USA, 2008, 105: 2946-2950.
doi: 10.1073/pnas.0712259105
[8] Lu J, Fu Y, Kumar S, Shen Y, Zeng K, Xu A, Carthew R, Wu C I. Adaptive evolution of newly emerged micro-RNA genes in Drosophila. Genome Biol Evol, 2008, 25: 929-938.
[9] Berezikov E. Evolution of microRNA diversity and regulation in animals. Nat Rev Genet, 2011, 12: 846-860.
doi: 10.1038/nrg3079 pmid: 22094948
[10] Chen L, Chen L, Zhang X X, Liu T T, Niu S L, Wen J, Yi B, Ma C Z, Tu J X, Fu T D, Shen J X. Identification of miRNAs that regulate silique development in Brassica napus. Plant Sci, 2018, 269: 106-117.
doi: S0168-9452(17)31095-6 pmid: 29606207
[11] Xie F L, Huang S Q, Guo K, Xiang A L, Zhu Y Y, Nie L, Yang Z M. Computational identification of novel microRNAs and targets in Brassica napus . FEBS Lett, 2007, 581: 1464-1474.
doi: 10.1016/j.febslet.2007.02.074
[12] Zhao Y T, Wang M, Fu S X, Yang W C, Qi C K, Wang X J. Small RNA profiling in two Brassica napus cultivars identifies microRNAs with oil production- and development- correlated expression and new small RNA classes. Plant Physiol, 2012, 158: 813-823.
doi: 10.1104/pp.111.187666
[13] Huang D, Koh C, Feurtado J A, Tsang E W, Cutler A J. MicroRNAs and their putative targets in Brassica napus seed maturation. BMC Genomics, 2013, 14: 140.
doi: 10.1186/1471-2164-14-140
[14] Donald C M. The breeding of crop ideotypes. Euphytica, 1968, 17: 385-403.
doi: 10.1007/BF00056241
[15] Peiffer J A, Romay M C, Gore M A, Flint-Garcia S A, Zhang Z, Millard M J, Gardner C A, McMullen M D, Holland J B, Bradbury P J. The genetic architecture of maize height. Genetics, 2014, 196: 1337-1356.
doi: 10.1534/genetics.113.159152 pmid: 24514905
[16] Heimberg A M, Sempere L F, Moy V N, Donoghue P C, Peterson K J. MicroRNAs and the advent of vertebrate morphological complexity. Proc Natl Acad Sci USA, 2008, 105: 2946-2950.
doi: 10.1073/pnas.0712259105
[17] Sun C, Wang B, Wang X, Hu K, Li K, Li Z, Li S, Yan L, Guan C, Zhang J. Genome-wide association study dissecting the genetic architecture underlying the branch angle trait in rapeseed (Brassica napus L.). Sci Rep, 2016, 6: 33673.
doi: 10.1038/srep33673
[18] Wang H, Cheng H, Wang W, Liu J, Hao M, Mei D, Zhou R, Fu L, Hu Q. Identification of BnaYUCCA6 as a candidate gene for branch angle in Brassica napus by QTL-seq. Sci Rep, 2016, 6: 38493.
doi: 10.1038/srep38493 pmid: 27922076
[19] Zhao B, Li H, Li J, Wang B, Dai C, Wang J, Liu K. Brassica napus DS-3, encoding a DELLA protein, negatively regulates stem elongation through gibberellin signaling pathway. Theor Appl Genet, 2017, 130: 727-741.
doi: 10.1007/s00122-016-2846-4 pmid: 28093630
[20] Wang T, Ping X, Cao Y, Jian H, Gao Y, Wang J, Tan Y, Xu X, Lu K, Li J. Genome-wide exploration and characterization of miR172/euAP2 genes in Brassica napus L. for likely role in flower organ development. BMC Plant Biol, 2019, 19: 336.
doi: 10.1186/s12870-019-1936-2
[21] Earley K W, Haag J R, Pontes O, Opper K, Juehne T, Song K, Pikaard C S. Gateway-compatible vectors for plant functional genomics and proteomics. Plant J, 2006, 45: 616-629.
pmid: 16441352
[22] Lu K, Li T, He J, Chang W, Zhang R, Liu M, Yu M, Fan Y, Ma J, Sun W, Qu C, Liu L, Li N, Liang Y, Wang R, Qian W, Tang Z, Xu X, Lei B, Zhang K, Li J. qPrimerDB: a thermodynamics-based gene-specific qPCR primer database for 147 organisms. Nucleic Acids Res, 2018, 46: D1229-D1236.
[23] Lu J, Shen Y, Wu Q, Kumar S, He B, Shi S, Carthew R W, Wang S M, Wu C I. The birth and death of microRNA genes in Drosophila. Nat Genet, 2008, 40: 351.
doi: 10.1038/ng.73
[24] Quah S, Hui J H, Holland P W. A burst of miRNA innovation in the early evolution of butterflies and moths. Mol Biol Evol, 2015, 32: 1161-1174.
doi: 10.1093/molbev/msv004
[25] Zheng L, Nagpal P, Villarino G, Trinidad B, Bird L, Huang Y, Reed J W. miR167 limits anther growth to potentiate anther dehiscence. Development, 2019, 146: dev174375.
[26] Ellis C M, Nagpal P, Young J C, Hagen G, Guilfoyle T J, Reed J W. AUXIN RESPONSE FACTOR1 and AUXIN RESPONSE FACTOR2 regulate senescence and floral organ abscission in Arabidopsis thaliana. Development, 2005, 132: 4563-4574.
doi: 10.1242/dev.02012
[27] Reeves P H, Ellis C M, Ploense S E, Wu M F, Yadav V, Tholl D, Chetelat A, Haupt I, Kennerley B J, Hodgens C, Farmer E E, Nagpal P, Reed J W. A regulatory network for coordinated flower maturation. PLoS Genet, 2012, 8: e1002506.
doi: 10.1371/journal.pgen.1002506
[28] Tabata R, Ikezaki M, Fujibe T, Aida M, Tian C E, Ueno Y, Yamamoto K T, Machida Y, Nakamura K, Ishiguro S. Arabidopsis AUXIN RESPONSE FACTOR6 and 8 regulate jasmonic acid biosynthesis and floral organ development via repression of class 1 KNOX genes. Plant Cell Physiol, 2010, 51: 164-175.
doi: 10.1093/pcp/pcp176 pmid: 20007966
[29] Nagpal P, Ellis C M, Weber H, Ploense S E, Barkawi L S, Guilfoyle T J, Hagen G, Alonso J M, Cohen J D, Farmer E E. Auxin response factors ARF6 and ARF8 promote jasmonic acid production and flower maturation. Development, 2005, 132: 4107-4118.
doi: 10.1242/dev.01955
[30] Tejos R, Rodriguez-Furlan C, Adamowski M, Sauer M, Norambuena L, Friml J. PATELLINS are regulators of auxin-mediated PIN1 relocation and plant development in Arabidopsis thaliana. J Cell Sci, 2018, 131: jcs204198.
[31] Forestan C, Varotto S. The role of PIN auxin efflux carriers in polar auxin transport and accumulation and their effect on shaping maize development. Mol Plant, 2012, 5: 787-798.
doi: 10.1093/mp/ssr103
[32] Gallavotti A. The role of auxin in shaping shoot architecture. J Exp Bot, 2013, 64: 2593-2608.
doi: 10.1093/jxb/ert141 pmid: 23709672
[33] Laxmi A. DUF581 is plant specific FCS-like zinc finger involved in protein-protein interaction. PLoS One, 2014, 9: e99074.
doi: 10.1371/journal.pone.0099074
[34] Nietzsche M, Schießl I, Börnke F. The complex becomes more complex: protein-protein interactions of SnRK1 with DUF581 family proteins provide a framework for cell- and stimulus type-specific SnRK1 signaling in plants. Front Plant Sci 2014, 5: 54.
doi: 10.3389/fpls.2014.00054 pmid: 24600465
[35] Bitrian M, Roodbarkelari F, Horvath M, Koncz C. BAC- recombineering for studying plant gene regulation: developmental control and cellular localization of SnRK1 kinase subunits. Plant J, 2011, 65: 829-842.
doi: 10.1111/j.1365-313X.2010.04462.x
[36] Jiao Y Q, Wang Y H, Xue D W, Wang J, Yan M X, Liu G F, Dong G J, Zeng D L, Lu Z F, Zhu X D, Qian Q, Li J Y. Regulation of OsSPL14 by OsmiR156 defines ideal plant architecture in rice. Nat Genet, 2010, 42: 541-544.
doi: 10.1038/ng.591
[37] Che R H, Tong H N, Shi B H, Liu Y Q, Fang S R, Liu D P, Xiao Y H, Hu B, Liu L C, Wang H R, Zhao M F, Chu C C. Control of grain size and rice yield by GL2-mediated brassinosteroid responses. Nat Plants, 2015, 2: 15195.
doi: 10.1038/nplants.2015.195
[38] Nair S K, Wang N, Turuspekov Y, Pourkheirandish M, Sinsuwongwat S, Chen G X, Sameri M, Tagiri A, Honda I, Watanabe Y, Kanamori H, Wicker T, Stein N, Nagamura Y, Matsumoto T, Komatsuda T. Cleistogamous flowering in barley arises from the suppression of microRNA-guided HvAP2 mRNA cleavage. Proc Natl Acad Sci USA, 2010, 107: 490-495.
doi: 10.1073/pnas.0909097107
[39] Silva G F F, Silva E M, da Silva Azevedo M, Guivin M A C, Ramiro D A, Figueiredo C R, Carrer H, Peres L E P, Nogueira F T S. microRNA156-targeted SPL/SBP box transcription factors regulate tomato ovary and fruit development. Plant J, 2014, 78: 604-618.
doi: 10.1111/tpj.12493
[40] Tang J, Chu C. microRNAs in crop improvement: fine-tuners for complex traits. Nat Plants, 2017, 3: 17077.
doi: 10.1038/nplants.2017.77
[1] Wang Chu-Rui, Li Kai-Xiang, Zhao Zhi, Xiao Lu, Tang Guo-Yong, Zhao Zhi-Gang, Xu Liang, Du De-Zhi, Liu Hai-Dong. Development and application of KASP markers for functional sites of the early flowering gene BnCRY2 in Brassica napus L. spring rapeseed [J]. Acta Agronomica Sinica, 2026, 52(3): 708-721.
[2] Ma Yi-Na, Wu Xiao-Ming-Yu, Li Ou-Qi, Wang Yuan, Chen Li, Zhang Ying-Chuan, Zhao Lun, Wen Jing, Fu Ting-Dong, Shen Jin-Xiong. Functional analysis of the Bna-miR1040-EIF3A module in regulating flowering time in rapeseed (Brassica napus) [J]. Acta Agronomica Sinica, 2026, 52(2): 349-362.
[3] Lou Hong-Xiang, Xing Ren-Peng, Wang Bo, Wang Jing, Xu Zheng-Hua, Zhao Jie, Kuai Jie, Zhou Guang-Sheng. Effects of sowing date on the utilization efficiency of light and temperature resources and yield in Brassica napus in the middle reaches of the Yangtze River [J]. Acta Agronomica Sinica, 2026, 52(2): 539-551.
[4] WANG Bin, MENG Jiang-Yu, QIU Hao-Liang, HE Ya-Jun, QIAN Wei. Identification and expression pattern analysis of the BnaDUF579 gene family in Brassica napus [J]. Acta Agronomica Sinica, 2025, 51(8): 2100-2110.
[5] XIA Qi, GUO Ying, WANG Kun-Mei, WANG Si-Yi, JU Jian-Ye, PENG Ya-Wen, LIU Zhong-Song, XIA Shi-Tou. Correlation between salicylic acid and anthocyanins accumulation in seeds of different varieties in Brassica napus [J]. Acta Agronomica Sinica, 2025, 51(5): 1189-1197.
[6] ZHANG Qin, DAI Cheng, MA Chao-Zhi. Auxin response reporter gene transformation of Brassica napus and dynamic signal analysis of GUS in different tissues [J]. Acta Agronomica Sinica, 2025, 51(3): 667-675.
[7] SUN Cheng-Ming, ZHOU Xiao-Ying, CHEN Feng, ZHANG Wei, WANG Xiao-Dong, PENG Qi, GUO Yue, GAO Jian-Qin, HU Mao-Long, FU San-Xiong, ZHANG Jie-Fu. Functional analysis and prediction of long non-coding RNA (lncRNA) in the regulation of branch angle in Brassica napus L. [J]. Acta Agronomica Sinica, 2025, 51(3): 559-567.
[8] ZHUANG Yue-Ming, SONG Yi, CHEN Hang-Hang, LU Zhi-Feng, LIAO Shi-Peng, LI Xiao-Kun, CONG Ri-Huan, REN Tao, LU Jian-Wei. Effects of application of nitrogen on endophytic microbiota and seed quality in rapeseed (Brassica napus L.) seeds [J]. Acta Agronomica Sinica, 2025, 51(12): 3357-3368.
[9] HUANG Rong, ZHOU Qu-Chen, CHEN Chu-Ming, LUO Qian, YI Dong, DU Chang-Huan, HUANG Xiang-Yu, SHENG Feng, DU Xue-Zhu. Effects of BnNRT2.3-like overexpression on nitrogen uptake, utilization efficiency, and yield in Brassica napus L. [J]. Acta Agronomica Sinica, 2025, 51(12): 3184-3197.
[10] JU Jian-Ye, YANG Liu, CHEN Hao, KANG Lei, XIA Shi-Tou, LIU Zhong-Song. Single-nucleus transcriptome analysis reveals the cellular differentiation trajectories and molecular mechanisms underlying yellow seed coat formation in rapeseed [J]. Acta Agronomica Sinica, 2025, 51(11): 2860-2874.
[11] ZHANG Wen, LI Yu, WANG Chuang, SHI Lei, DING Guang-Da. Functional study of the phosphate transporter protein BnaPT48 in Brassica napus [J]. Acta Agronomica Sinica, 2025, 51(11): 2983-2995.
[12] ZHAO Hui-Xia, GUO Yan-Li, ZHENG Yu-Ling, HE Ling, CHEN Rui, WANG Shan-Shan, ZENG Chang-Li, ZOU Jun, SHEN Jin-Xiong, FU Ting-Dong, LIU Xiao-Yun, WAN He-Ping. Differential gene expression analysis of response to alkaline salt stress in Brassica napus L. [J]. Acta Agronomica Sinica, 2025, 51(11): 3105-3118.
[13] HU Zhi-Kang, SHU Yu, WANG Hui, YANG Ying-Ying, LIAO Jun-Yu, LIU Jia, CHENG Hong-Tao, GUO Chen, ZHANG Yuan-Yuan, LIU Sheng-Yi, HU Qiong, MEI De-Sheng, LI Chao. Comprehensive evaluation of alkaline tolerance in Brassica napus at the seedling stage [J]. Acta Agronomica Sinica, 2025, 51(10): 2681-2692.
[14] WANG Chen, HE Dan, YAO Min, QIU Ping, HE Xin, XIONG Xing-Hua, KANG Lei, LIU Zhong-Song, QIAN Lun-Wen. Transcriptome-based identification of flowering candidate genes and functional characterization of BnaCOR27 in Brassica napus [J]. Acta Agronomica Sinica, 2025, 51(10): 2693-2704.
[15] XU Lin-Shan, GAO Geng-Dong, WANG Yu, WANG Jia-Xing, YANG Ji-Zhao, WU Ya-Rui, ZHANG Xiao-Han, CHANG Ying, LI Zhen, XIE Xiong-Ze, GONG De-Ping, WANG Jing, GE Xian-Hong. Analysis of expression patterns of laccase gene family members in Brassica napus and their association with stem fracture resistance [J]. Acta Agronomica Sinica, 2025, 51(1): 134-148.
Viewed
Full text


Abstract

Cited
  Shared   
  Discussed   
No Suggested Reading articles found!
Add: No. 80 Xueyuan South Rd, Beijing 100081, P. R. China E-mail: zwxb301@caas.cn
Supported by Beijing Magtech Co.Ltd