Welcome to Acta Agronomica Sinica,

Acta Agronomica Sinica ›› 2026, Vol. 52 ›› Issue (10): 3023-3036.doi: 10.3724/SP.J.1006.2026.65003

• CROP GENETICS & BREEDING·GERMPLASM RESOURCES·MOLECULAR GENETICS • Previous Articles     Next Articles

Bioinformatic and expression analyses of the soybean genes GmbHLH119 and GmbHLH120

Wei Jin(), Liao Chun-Mei, Gao Li-Shi, Zhang Ying, Yang Hui, Yue Lin, Liu Bao-Hui, Chen Li-Yu()   

  1. College of Life Sciences, Guangzhou University / Innovative Research Center of Molecular Genetics and Evolution / Guangdong Provincial Key Laboratory of Plant Adaptation and Molecular Design, Guangzhou 510006, Guangdong, China
  • Received:2026-01-05 Accepted:2026-04-13 Online:2026-10-12 Published:2026-05-13
  • Contact: Chen Li-Yu, E-mail: chenliyu1715@gzhu.edu.cn
  • Supported by:
    National Natural Science Foundation of China(32472164);National Natural Science Foundation of China(32372078);National Natural Science Foundation of China(32372158);Guangdong Provincial Basic and Applied Basic Research Foundation Project(2024A1515030288)

Abstract:

To investigate the functions of the soybean GmbHLH119 and GmbHLH120 genes, this study performed bioinformatic analyses, subcellular localization, and expression profiling in different soybean tissues under nitrogen and phosphorus treatments. The results showed that GmbHLH119 and GmbHLH120 share a high degree of structural similarity. Preliminary expression analysis revealed that both genes were relatively highly expressed in soybean leaves. Promoter analysis identified multiple cis-acting elements related to light responsiveness, hormone responsiveness, and abiotic stress responsiveness in the promoter regions of GmbHLH119 and GmbHLH120. Both proteins contain a conserved HLH domain and were predicted to be unstable hydrophilic proteins with highly conserved structures. Subcellular localization assays showed that both GmbHLH119 and GmbHLH120 are localized in the nucleus. In addition, their expression patterns under different nitrogen and phosphorus treatments suggested that these two genes may participate in regulating soybean responses to changes in nitrogen and phosphorus availability. Overall, this study provides a theoretical basis for further functional characterization of GmbHLH119 and GmbHLH120 in soybean.

Key words: soybean, bHLH, bioinformatics analysis, subcellular localization, nitrogen, phosphorus

Table 1

Primer sequences and their uses"

引物
Primer
引物序列
Primer sequence (5′-3′)
用途
Usage
bHLH119-GFP-F GACTTAAGCCTAGGacgcgtATGGACGACGCATCAGAAGC 亚细胞定位载体的构建
Construction of subcellular localization vector
bHLH119-GFP-R ACCATTGGCGCGCCactagtTGACATGGATTTCAAAGTAG
bHLH120-GFP-F GACTTAAGCCTAGGacgcgtATGGAGAATAATAACACATC
bHLH120-GFP-R ACCATTGGCGCGCCactagtTGACATGGATTTCAAAGTAG
GmbHLH119-GFP-JCF GCTTAATCGCTCTAGCTGCT 菌落PCR
Bacterial colony PCR
GmbHLH120-GFP-JCF ATGGACAAGGCATCAGTGCT
GFP-R TAGTTGCCGTCGTCCTTGAA
GmTubulin-F TCTTGGACAACGAAGCCATCT 实时荧光定量PCR
qRT-PCR
GmTubulin-R GGTGAGGGACGAAATGATCT
GmNiR-RTF GCAAAAGGATCCTCACCCT
GmNiR-RTR TCCAAGGGACAATGGTGGAT
GmPLDZ-RTF TTGGGAAACCTGGATATTGTG
GmPLDZ-RTR AAACAGACCATACCTTCTTCCA
GmbHLH119-RTF TGGAAAAGGGGTACAATTTG
GmbHLH119-RTR AACCACCACCAGACCATCCT
GmbHLH120-RTF TGTAATGTTCGTCCTCCAGTC
GmbHLH120-RTR ATCATGTGGATGTTAATTCC

Fig. 1

Gene structures of GmbHLH119 and GmbHLH120 in soybean Green regions indicate untranslated regions, yellow regions indicate exons, and thin black lines indicate introns."

Fig. 2

Expression patterns of GmbHLH119 and GmbHLH120 in different tissues in soybean"

Fig. 3

Analysis of cis-acting elements in the promoters of GmbHLH119 and GmbHLH120 in soybean"

Fig. 4

Phylogenetic tree of bHLH proteins from Glycine max, Arabidopsis thaliana, Oryza sativa, Triticum aestivum, Medicago truncatula, Lotus japonicus, and Phaseolus vulgaris Numbers at the branch nodes indicate bootstrap values, and branch lengths represent evolutionary distances. The scale bar of 0.20 indicates 0.2 substitutions per site. Gm: Glycine max; At: Arabidopsis thaliana; Os: Oryza sativa; Ta: Triticum aestivum; Mt: Medicago truncatula; Lj: Lotus japonicus; Pv: Phaseolus vulgaris."

Fig. 5

Protein sequence alignment of GmbHLH119 and GmbHLH120 The red underlined region indicates the HLH domain."

Table 2

Basic characteristics of GmbHLH119 and GmbHLH120 proteins in soybean"

蛋白
Protein
氨基酸数目
Number of
amino acid (aa)
分子量
Molecular
weight (Da)
理论等电点
Theoretical
pI
不稳定系数
Instability
index
脂肪系数
Aliphatic
index
亲水性平均值
GRAVY
GmbHLH119 313 35,168.92 6.28 90.35 60.08 -0.517
GmbHLH120 368 41,198.36 5.73 83.18 54.62 -0.560

Table 3

Major secondary structure types of GmbHLH119 and GmbHLH120 proteins"

蛋白
Protein
氨基酸数目
Number of
amino acid (aa)
比例 Proportion (%)
α螺旋
α-helix
β折叠
β-turn
无规则卷曲
Random coil
延伸链
Extended strand
GmbHLH119 313 43.77 1.60 48.24 6.39
GmbHLH120 368 35.05 1.36 57.61 5.98

Fig. 6

Predicted secondary and tertiary structures of GmbHLH119 and GmbHLH120 in soybean A: secondary structures of GmbHLH119 and GmbHLH120; aa: amino acid; the blue area represents the α-helix structure; the purple area represents the extended strand structure; the green area represents the β-turn structure; the yellow area represents the random coil structure. B: tertiary structures of GmbHLH119 and GmbHLH120; pLDDT: confidence score of each residue."

Fig. 7

Construction of subcellular localization vectors A: subcellular localization vector structure; B: PCR identification of pTF101-GmbHLH119-GFP and pTF101-GmbHLH120-GFP vector in Escherichia coli colonies; M is 2 kb ladder DNA marker."

Fig. 8

Subcellular localization of GmbHLH119 and GmbHLH120 proteins GFP indicates the GFP fluorescence channel, Chlorophyll indicates chlorophyll autofluorescence, DAPI indicates DAPI-stained nuclei, Bright indicates bright-field images, and Merged indicates merged images; scale bar = 25 μm."

Fig. 9

Expression of GmNiR in different soybean tissues under different nitrogen treatments LN: low nitrogen (0.5 mmol L-1 N); NN: normal nitrogen (5 mmol L-1 N); HN: high nitrogen (15 mmol L-1 N). Statistical analysis was performed using Student’s t-test; *, ** mean significant difference at P < 0.05 and P < 0.01, respectively."

Fig. 10

Expression of GmbHLH119 and GmbHLH120 in different soybean tissues under different nitrogen treatments A: expression of GmbHLH119 in different tissues of soybean under different nitrogen treatments; B: expression of GmbHLH120 in different tissues of soybean under different nitrogen treatments. LN: low nitrogen (0.5 mmol L-1 N); NN: normal nitrogen (5 mmol L-1 N); HN: high nitrogen (15 mmol L-1 N). Statistical analysis was performed using Student’s t-test; ns: no significant difference; *, **, *** mean significant difference at P < 0.05, P < 0.01 and P < 0.001, respectively."

Fig. 11

Expression of GmPLDZ in different soybean tissues under different phosphorus treatments LP: low phosphorus (5 μmol L-1 KH2PO4); NP: normal phosphorus (500 μmol L-1 KH2PO4). Statistical analysis was performed using Student’s t-test; **, **** mean significant difference at P < 0.01 and P < 0.0001, respectively."

Fig. 12

Expression of GmbHLH119 and GmbHLH120 in different soybean tissues under different phosphorus treatments A: expression of GmbHLH119 in different tissues of soybean under different phosphorus treatments; B: expression of GmbHLH120 in different tissues of soybean under different phosphorus treatments. LP: low phosphorus (5 μmol L-1 KH2PO4); NP: normal phosphorus (500 μmol L-1 KH2PO4). Statistical analysis was performed using Student’s t-test; ns: no significant difference; *, **, ***, **** mean significant difference at P < 0.05, P < 0.01, P < 0.001, and P < 0.0001, respectively."

[1] Mishra S, Levengood H, Fan J P, et al. Plants under stress: exploring physiological and molecular responses to nitrogen and phosphorus deficiency. Plants, 2024, 13: 3144.
doi: 10.3390/plants13223144
[2] Robertson G P, Vitousek P M. Nitrogen in agriculture: balancing the cost of an essential resource. Annu Rev Environ Resour, 2009, 34: 97-125.
doi: 10.1146/energy.2009.34.issue-1
[3] Hart M R, Quin B F, Nguyen M L. Phosphorus runoff from agricultural land and direct fertilizer effects: a review. J Env Qual, 2004, 33: 1954-1972.
doi: 10.2134/jeq2004.1954
[4] 周磊, 刘昌良, 陈清华, 等. 豆科植物缺素症及其防治措施. 安徽农业科学, 2014, 42: 4242-4247.
Zhou L, Liu C L, Chen Q H, et al. The nutrient deficiency disease of leguminous plant and its prevention measures. J Anhui Agric Sci, 2014, 42: 4242-4247 (in Chinese with English abstract).
[5] Atchley W R, Fitch W M. A natural classification of the basic helix-loop-helix class of transcription factors. Proc Natl Acad Sci USA, 1997, 94: 5172-5176.
doi: 10.1073/pnas.94.10.5172 pmid: 9144210
[6] Toledo-Ortiz G, Huq E, Quail P H. The Arabidopsis basic/helix- loop-helix transcription factor family. Plant Cell, 2003, 15: 1749-1770.
doi: 10.1105/tpc.013839 pmid: 12897250
[7] Ludwig S R, Habera L F, Dellaporta S L, et al. Lc, a member of the maize R gene family responsible for tissue-specific anthocyanin production, encodes a protein similar to transcriptional activators and contains the myc-homology region. Proc Natl Acad Sci USA, 1989, 86: 7092-7096.
doi: 10.1073/pnas.86.18.7092 pmid: 2674946
[8] Xu F, Tang J Y, Wang S X, et al. Antagonistic control of seed dormancy in rice by two bHLH transcription factors. Nat Genet, 2022, 54: 1972-1982.
doi: 10.1038/s41588-022-01240-7 pmid: 36471073
[9] Li Y K, Xu J F, Xu M, et al. ICE 1 (inducer of CBF expression 1) is essential for the jasmonate-regulated development of stamen in Arabidopsis thaliana. Plant Cell Environ, 2025, 48: 3810-3826.
doi: 10.1111/pce.v48.5
[10] Haghir S, Yamada K, Kato M, et al. The Arabidopsis basic-helix-loop-helix transcription factor LRL1 activates cell wall-related genes during root hair development. Plant Cell Physiol, 2025, 66: 384-399.
doi: 10.1093/pcp/pcaf006
[11] Qi T C, Wu M B, Wang S J, et al. SlMYB72 and SlMYB75 antagonistically regulate trichome formation via the MYB-bHLH- WD40 complex in tomato. J Biol Chem, 2025, 301: 108313.
doi: 10.1016/j.jbc.2025.108313
[12] Wang W, Chen Y, Jiang Y B, et al. The basic helix-loop-helix transcription factor PpeUNE12 regulates peach ripening by promoting polyamine catabolism and anthocyanin synthesis. Plant Physiol Biochem, 2025, 220: 109537.
doi: 10.1016/j.plaphy.2025.109537
[13] Xu Y, Zhu Z Q. PIF4 and PIF4-interacting proteins: at the nexus of plant light, temperature and hormone signal integrations. Int J Mol Sci, 2021, 22: 10304.
doi: 10.3390/ijms221910304
[14] Li S, Zhao Z C, Liu T Z, et al. The G-protein γ subunit DEP1 facilitates brassinosteroid signaling in rice via a MYB-bHLH-ARF module. Plant Cell, 2025, 37: koaf122.
[15] Wang R M, Wang Z J, Wang Z C, et al. The basic helix-loop- helix (bHLH) transcription factor bHLH130 negatively regulates tomato resistance to Phytophthora infestans. Int J Biol Macromol, 2025, 311: 143908.
doi: 10.1016/j.ijbiomac.2025.143908
[16] Yan Z W, Zhang F J, Mu C H, et al. The ZmbHLH47-ZmSnRK2.9 module promotes drought tolerance in maize. Int J Mol Sci, 2024, 25: 4957.
doi: 10.3390/ijms25094957
[17] Zhang C, Li G D, Pan Y T, et al. Brassinosteroid-signaling kinase 4 activates mitogen-activated protein kinase 4 to enhance cold stress tolerance in maize. Plant Cell, 2025, 37: koaf234.
[18] Xin Z, Huang H M, Li T T, et al. Comprehensive analysis of bHLH genes in wheat and functional characterization of TabHLH319 in salt tolerance. Plant Cell Rep, 2025, 44: 199.
doi: 10.1007/s00299-025-03570-2
[19] Li C Y, Zhao J H, Ping H Q, et al. OsbHLH 062 negatively regulates Fe homeostasis by enhancing OsHRZ1 targeting OsPRIs for degradation. New Phytol, 2025, 247: 160-177.
doi: 10.1111/nph.v247.1
[20] Nacry P, Bouguyon E, Gojon A. Nitrogen acquisition by roots: physiological and developmental mechanisms ensuring plant adaptation to a fluctuating resource. Plant Soil, 2013, 370: 1-29.
doi: 10.1007/s11104-013-1645-9
[21] Zhang Z L, Liao H, Lucas W J. Molecular mechanisms underlying phosphate sensing, signaling, and adaptation in plants. J Integr Plant Biol, 2014, 56: 192-220.
doi: 10.1111/jipb.12163
[22] Yang T R, Hao L, Yao S F, et al. TabHLH1, a bHLH-type transcription factor gene in wheat, improves plant tolerance to Pi and N deprivation via regulation of nutrient transporter gene transcription and ROS homeostasis. Plant Physiol Biochem, 2016, 104: 99-113.
doi: 10.1016/j.plaphy.2016.03.023
[23] Li T, Feng Z Q, Yang Y Y, et al. Functional identification of the bHLH transcription factor MdSAT1 in the phosphate deficiency response. Fruit Res, 2023, 3: 26.
[24] Li T, Feng Z Q, Zhu B H, et al. Functional identification of bHLH transcription factor MdSAT1 in the ammonium response. Fruit Res, 2022, 2: 1-9.
[25] Wang X N, Chai X F, Gao B B, et al. Multi-omics analysis reveals the mechanism of bHLH130 responding to low-nitrogen stress of apple rootstock. Plant Physiol, 2023, 191: 1305-1323.
doi: 10.1093/plphys/kiac519
[26] Li J R, Liu K, Shang C Q, et al. Overexpression of MdNRT2.4 improved low-nitrogen tolerance in transgenic tobacco lines. Horticulturae, 2025, 11: 662.
doi: 10.3390/horticulturae11060662
[27] Yang F, Li X P, Liu S Y, et al. TabHLH489 suppresses nitrate signaling by inhibiting the function of TaNLP7-3 A in wheat. J Integr Plant Biol, 2025, 67: 1162-1178.
[28] Yi K K, Wu Z C, Zhou J, et al. OsPTF1, a novel transcription factor involved in tolerance to phosphate starvation in rice. Plant Physiol, 2005, 138: 2087-2096.
pmid: 16006597
[29] Li Z X, Gao Q, Liu Y Z, et al. Overexpression of transcription factor ZmPTF1 improves low phosphate tolerance of maize by regulating carbon metabolism and root growth. Planta, 2011, 233: 1129-1143.
doi: 10.1007/s00425-011-1368-1 pmid: 21312041
[30] Yang Z J, Gao Z, Zhou H W, et al. GmPTF1 modifies root architecture responses to phosphate starvation primarily through regulating GmEXPB2 expression in soybean. Plant J, 2021, 107: 525-543.
doi: 10.1111/tpj.v107.2
[31] He Q J, Lu H, Guo H X, et al. OsbHLH6 interacts with OsSPX4 and regulates the phosphate starvation response in rice. Plant J, 2021, 105: 649-667.
doi: 10.1111/tpj.v105.3
[32] Zhu C L, Lin Z M, Liu Y, et al. A bamboo bHLH transcription factor PeRHL4 has dual functions in enhancing drought and phosphorus starvation tolerance. Plant Cell Environ, 2024, 47: 3015-3029.
doi: 10.1111/pce.v47.8
[33] Chen Z H, Nimmo G A, Jenkins G I, et al. BHLH32 modulates several biochemical and morphological processes that respond to Pi starvation in Arabidopsis. Biochem J, 2007, 405: 191-198.
[34] Ariel F, Brault-Hernandez M, Laffont C, et al. Two direct targets of cytokinin signaling regulate symbiotic nodulation in Medicago truncatula. Plant Cell, 2012, 24: 3838-3852.
doi: 10.1105/tpc.112.103267
[35] Chen C J, Wu Y, Li J W, et al. TBtools-II: a “one for all, all for one” bioinformatics platform for biological big-data mining. Mol Plant, 2023, 16: 1733-1742.
doi: 10.1016/j.molp.2023.09.010
[36] Lescot M, Déhais P, Thijs G, et al. PlantCARE, a database of plant cis-acting regulatory elements and a portal to tools for in silico analysis of promoter sequences. Nucleic Acids Res, 2002, 30: 325-327.
[37] Qin L, Guo Y X, Chen L Y, et al. Functional characterization of 14 Pht1 family genes in yeast and their expressions in response to nutrient starvation in soybean. PLoS One, 2012, 7: e47726.
[38] Wei K F, Chen H Q. Comparative functional genomics analysis of bHLH gene family in rice, maize and wheat. BMC Plant Biol, 2018, 18: 309.
doi: 10.1186/s12870-018-1529-5 pmid: 30497403
[39] Suzuki H, Seki H, Muranaka T. Insights into the diversification of subclade IVa bHLH transcription factors in Fabaceae. BMC Plant Biol, 2021, 21: 109.
doi: 10.1186/s12870-021-02887-w pmid: 33622255
[40] Kavas M, Baloğlu M C, Atabay E S, et al. Genome-wide characterization and expression analysis of common bean bHLH transcription factors in response to excess salt concentration. Mol Genet Genom, 2016, 291: 129-143.
doi: 10.1007/s00438-015-1095-6
[41] Wang R C, Guegler K, LaBrie S T, et al. Genomic analysis of a nutrient response in Arabidopsis reveals diverse expression patterns and novel metabolic and potential regulatory genes induced by nitrate. Plant Cell, 2000, 12: 1491-1509.
doi: 10.1105/tpc.12.8.1491 pmid: 10948265
[42] Li M Y, Welti R, Wang X M. Quantitative profiling of Arabidopsis polar glycerolipids in response to phosphorus starvation. Roles of phospholipases D zeta1 and D zeta2 in phosphatidylcholine hydrolysis and digalactosyldiacylglycerol accumulation in phosphorus-starved plants. Plant Physiol, 2006, 142: 750-761.
doi: 10.1104/pp.106.085647
[43] Yang Y Y, Zheng P F, Ren Y R, et al. Apple MdSAT1 encodes a bHLHm 1 transcription factor involved in salinity and drought responses. Planta, 2021, 253: 46.
doi: 10.1007/s00425-020-03528-6
[44] Carretero-Paulet L, Galstyan A, Roig-Villanova I, et al. Genome-wide classification and evolutionary analysis of the bHLH family of transcription factors in Arabidopsis, poplar, rice, moss, and algae. Plant Physiol, 2010, 153: 1398-1412.
doi: 10.1104/pp.110.153593 pmid: 20472752
[45] Hudson K A, Hudson M E. A classification of basic helix-loop-helix transcription factors of soybean. Int J Genom, 2015, 2015: 603182.
[46] Wu N, Jiang T, Feng Y Q, et al. Genome-wide identification and expression analysis of soybean bHLH transcription factor and its molecular mechanism on grain protein synthesis. Front Plant Sci, 2025, 16: 1481565.
doi: 10.3389/fpls.2025.1481565
[47] Li L, Gao W W, Peng Q, et al. Two soybean bHLH factors regulate response to iron deficiency. J Integr Plant Biol, 2018, 60: 608-622.
doi: 10.1111/jipb.12651
[48] Qian Y C, Zhang T Y, Yu Y, et al. Regulatory mechanisms of bHLH transcription factors in plant adaptive responses to various abiotic stresses. Front Plant Sci, 2021, 12: 677611.
doi: 10.3389/fpls.2021.677611
[49] Zhang Z X, Cheng J, Wang W X, et al. Transcription factors dealing with Iron-deficiency stress in plants: focus on the bHLH transcription factor family. Physiol Plant, 2023, 175: e14091.
[50] Cui Y, Chen C L, Cui M, et al. Four IVa bHLH transcription factors are novel interactors of FIT and mediate JA inhibition of iron uptake in Arabidopsis. Mol Plant, 2018, 11: 1166-1183.
doi: 10.1016/j.molp.2018.06.005
[1] Tang Hai-Jiang, Guo Fu-Cheng, Xiao Dong-Hao, Yang Jiu-Ju, Su Jing, Liao Ting-Lu, Wang Yan-Qi, Luo Cheng-Ke. Study on the regulatory mechanism of carbon-nitrogen metabolism and yield-increasing effects of exogenous sodium nitroprusside spraying on rice in saline-alkaline soil [J]. Acta Agronomica Sinica, 2026, 52(9): 2744-2759.
[2] Huang Ying, Liu Pei-Qi, Xie Sen, Xu Luo, Ren Yuan, Liu Xu-Yang, He Guan-Hua, Li Yong-Xiang, Wang Tian-Yu, Li Yu, Zhou Tao, Liao Jiang-Lin, Li Chun-Hui, Zhang Deng-Feng. Genome-wide association study of nitrogen use efficiency and candidate gene mining in maize [J]. Acta Agronomica Sinica, 2026, 52(9): 2558-2572.
[3] Yu Lin-Feng, Li Jing, Zhang Sheng-Rui, Ma Cai-You, Hao Zhao-Yi, Li Bin, Sun Jun-Ming. Construction of a Fourier transform near-infrared (FT-NIR) prediction model for oil content in single soybean seeds [J]. Acta Agronomica Sinica, 2026, 52(9): 2809-2821.
[4] Cui Wen-Jie, Yan Zhe-Lin, Ren Qiang, Fan Zhi-Long, Yin Wen, Sun Ya-Li, Fan Hong, He Wei, Wang Feng, Hu Fa-Long, Chai Qiang. Photosynthetic-physiological mechanisms of N fertilizer postponing application on yield improvement of maize in the wheat-maize intercropping system [J]. Acta Agronomica Sinica, 2026, 52(9): 2700-2712.
[5] Wang Ya-Feng, Nan Yun-You, Zhang Huan-Huan, Zhang Diao-Liang, Jiang Long-Xiu, Zhu Dong-Yang, Li Han-Ting, Chai Qiang, Hu Fa-Long, Yin Wen, Fan Zhi-Long. Response of spring wheat nitrogen utilization to green manure combined with wheat straw returning and nitrogen application rates [J]. Acta Agronomica Sinica, 2026, 52(8): 2410-2423.
[6] Huang Ya-Li, Yu Ai-Zhong, Jiang Ke-Qiang, Cai Hong-Wei, Wang Peng-Fei, Wang Yu-Long, Shang Yong-Pan, Huo Jian-Zhe, Pang Xiao-Neng. Effects of partial substitution of chemical fertilizer with organic fertilizer on sweet corn yield and soil N2O emission in the oasis irrigation area of Northwest China [J]. Acta Agronomica Sinica, 2026, 52(8): 2396-2409.
[7] Liu Yi, Gao Shang, Yan Zhen-Hua, Liang Chen, Wu Li-Qian, Yu Hai-Bing, Wang Ke-Ru, Ming Bo, Xie Rui-Zhi, Li Shao-Kun. Synergistic optimization of yield and nitrogen use efficiency in densely planted summer maize through urea ammonium nitrate solution and split application under drip fertigation [J]. Acta Agronomica Sinica, 2026, 52(8): 2496-2508.
[8] Xiang Yu-Xin, Zhang Jie-Yu, Li Gui-Zhen, Wang Lin, Liu Han, Qin Yu-Xing, Ma Gen, Xiang Da-Bing. Effects of the interaction between nitrogen application and planting density on the canopy light environment, yield, and quality of Tartary buckwheat [J]. Acta Agronomica Sinica, 2026, 52(8): 2480-2495.
[9] Liu Feng, Dong Hong-Wei, Zhang Yue, Li Ran, Sun Ruo-Nan, Liu Jia-Cheng, Sun Shu-Jie, Zhang Xu-Dong, Han Qing-Fang. Photosynthetic mechanisms underlying yield stability under reduced nitrogen in maize-soybean intercropping: enhanced conversion efficiency of photosynthates [J]. Acta Agronomica Sinica, 2026, 52(7): 2095-2108.
[10] Wu Ying-Jie, Hu Guo-Qing, Liu Feng-Zhen, Liu Zhao-Xin, Dong Yuan-Jie, Wan Yong-Shan. Effects and mechanisms of nitrogen topdressing combined with fertilizer efficiency enhancers under drip irrigation under mulch on peanut growth and nitrogen use efficiency [J]. Acta Agronomica Sinica, 2026, 52(7): 2144-2158.
[11] Tan Xiao-Qiang, Wang Jian, Kuai Jie, Wang Bo, Wang Jing, Xu Zheng-Hua, Zhao Jie, Zhang Peng-Peng, Zhang Jian, Zhou Guang-Sheng. Synergistic monitoring of rapeseed based on nitrogen nutrition index and comprehensive growth index [J]. Acta Agronomica Sinica, 2026, 52(7): 2109-2126.
[12] Chen Meng-Yao, Chen Qiang, Shi Xiao-Lei, Suo Wen-Ying, Zhang Meng-Chen, Yang Chun-Yan, Yan Long, Zhang Kai, Meng Qing-Min. QTL mapping and KASP marker development for seed oil content in soybean [J]. Acta Agronomica Sinica, 2026, 52(7): 1985-1996.
[13] Zeng Jian, Wang Ru-Meng, Wang Xu, Cui Shi-Yao, He Da-Wei, Li Jiang-He, Zhang Zhen-Hua, Gong Pan. Screening and comprehensive evaluation of low-nitrogen-tolerant germplasm in Brassica juncea at the seedling stage [J]. Acta Agronomica Sinica, 2026, 52(7): 2057-2072.
[14] Gao Pei-Yang, Li Jin-Xuan, Dong Yu-Kui, Shi Yu, Zhang Zhen, Zhang Yong-Li. Response of wheat tillering and spike formation to nitrogen rate under supplementary irrigation based on soil moisture content [J]. Acta Agronomica Sinica, 2026, 52(6): 1847-1858.
[15] Hu Chuan, Zhao Kai-Nan, Huang Xiu-Li, Wu Jin-Zhi, Ren Kai-Ming, Wang He-Zheng, Fu Guo-Zhan, Huang Ming, Li You-Jun. Effects of tillage methods and nitrogen rates on yield and quality of dryland wheat under one-off irrigation [J]. Acta Agronomica Sinica, 2026, 52(6): 1830-1846.
Viewed
Full text


Abstract

Cited

  Shared   
  Discussed   
No Suggested Reading articles found!