Welcome to Acta Agronomica Sinica,

Acta Agronomica Sinica ›› 2023, Vol. 49 ›› Issue (12): 3204-3214.doi: 10.3724/SP.J.1006.2023.24268

• CROP GENETICS & BREEDING·GERMPLASM RESOURCES·MOLECULAR GENETICS • Previous Articles     Next Articles

Characteristics of MADS-box and SUPERMAN genes in tobacco cytoplasmic male sterile line K326

CUI Fang-Fang1, MENG Lin-Feng1, LIU Miao-Miao2, ZHANG Jian-Qiang2, WANG Jian-Ge2,*(), LIU Qi-Yuan1,*()   

  1. 1Key Laboratory of Crop Physiology, Ecology and Genetic Breeding, Ministry of Education / College of Agronomy, Jiangxi Agricultural University, Nanchang 330045, Jiangxi, China
    2College of Forestry, Jiangxi Agricultural University, Nanchang 330045, Jiangxi, China
  • Received:2022-12-03 Accepted:2023-05-24 Online:2023-12-12 Published:2023-05-31
  • Contact: * E-mail: wjgsd@126.com; E-mail: qiyuanl@126.com
  • Supported by:
    National Natural Science Foundation of China(3196150292)

Abstract:

Cytoplasmic male sterility (CMS) is an important tool for hybrid production and a good system for studying the interaction between nucleus and cytoplasm, but its mechanism is still unclear. The relationship between stamen abnormality and the relative expression levels of flower development genes in tobacco CMS line K326 was studied. The CMS line K326 was derived from a natural variation in Nicotiana tabacum and was bred by continuous backcross of flue-cured tobacco variety K326. It has not only stamens with carpelloid, but also stamens with petaloid, and the base of abnormal stamens is fused into a whole. In this study, we identified MADS-box genes and SUPERMAN genes of whole genome, which controlled the flower development in N. tabacum and analyzed their chromosomal localization and collinearity. The cis-acting elements of B genes and SUPERMAN genes were predicted, and their expression characteristics in flower buds at different stages in both CMS line and its maintainer line were studied. The results showed that 160 MADS-box genes and 5 SUPERMAN genes were identified in the genome of tobacco, including 4 PI genes, 3 AP3 genes, and 7 B genes. There were 79 MADS-box genes scattered on 22 chromosomes, and 3 SUPERMAN genes distributed on 3 chromosomes. Collinearity analysis showed that tandem and fragment DNA duplication and multiplication were the driving forces of the expansion of MADS- box gene family in tobacco. The abnormal stamens of CMS line K326 appeared at small bud stage, suggesting that the abnormal stamens in CMS line K326 were the result of early meristem development defects. The qRT-PCR showed that 7 B genes and 1 SUPERMAN gene were expressed both in CMS line K326 and its maintainers. The relative expression level of PI gene NitMADS115 in the maintainer line was higher than that in CMS line at all stages. The relative expression levels of AP3 genes NitMADS72 and NitMADS100 in maintainer lines were lower than those in CMS lines. Other genes were down-regulated at small bud stage and large bud stage, and up-regulated at middle bud stage. The SUPERMAN gene could only be detected at small bud and middle bud stage of the maintainer line, but not at bud stages of CMS line. Analysis of cis-acting elements showed that NitMADS115 had an auxin response element AuxRR. The study indicates that auxin might play an important role in cytoplasmic retrograde regulation of nucleus in tobacco.

Key words: tobacco, cytoplasmic male sterility, MADS-box, SUPERMAN, auxin

Table 1

Primers for qRT-PCR used in this study"

基因
Gene name
正向引物
Forward primer (5°-3°)
反向引物
Reverse primer (5°-3°)
NitMADS100 TTTGCCAATGGAGTACACA TTAACCCCATTACCAAATTGC
NitMADS72 CAGGCAAGTCACTTACTCCA CAAGCGTCCTCTGATACTGA
NitMADS23 AAATTGAACTCAAGCACCT TTACGGATACTAGTTAGTCCA
NitMADS105 ATGGACTCACTAGTATCCGTA TGGTGAAACACTTCCCCTA
NitMADS152 GCATATTAGCCTTACGCCTT TTCACTTTGCGTAGATTGACT
NitMADS22 TGCATGAATATTGTAGCCCTT GCTTAACCTGCATACTGTCA
NitMADS115 TGCATGAATATTGTAGCCCTT GCTTAACCTGCATACTGTCA
NitSUP1 TCGAATAACAACGACGACAAC GGCACATCTGAATTCCCTT
NitSUP2 AGCAGCCCATTTAAGTTACCG GCTTAAACTCACACGCCAA
NitSUP3 CCTAGTTTTGTTTCATCCCC CAAATCTCCATTTCTTAGCTGA
NitSUP4 CCATTAAATCACTTGAGCC CTAAGCAATCCAATTCCCAA
NitSUP5 GGCAGCTCATTTAAGTTTCCG CACGCCAATCATCTCCGAA
Actin CCGCTTTTGCTATTATGTCC GCACCTCACAAATATGCTG

Fig. 1

Morphological observation of stamen in CMS line K326 and its maintainer line at different bud stages A: maintainer line buds at small bud stage; B: maintainer line buds at mid-size bud stage; C: maintainer line buds at big bud stage; D: CMS line buds at small bud stage; E: CMS line buds at mid-size bud stage; F: CMS line buds at big bud stage."

Table S1

The MADS-box and SUPERMAN genes of Nicotiana tabacum"

基因
Gene name
转录本
Transcript
蛋白长度
Protein length (aa)
TAIR10_描述
TAIR10_description
NitMADS1 Nitab4.5_0000001g0140.1 391 FEM111, AGL80, AGAMOUS-like 80
NitMADS2 Nitab4.5_0000009g0060.1 444 FEM111, AGL80, AGAMOUS-like 80
NitMADS3 Nitab4.5_0000014g0510.1 231 SEP1, AGL2, K-box region and MADS-box family protein
NitMADS4 Nitab4.5_0000016g0430.1 217 STK, AGL11, K-box region and MADS-box family protein
NitMADS5 Nitab4.5_0000027g0070.1 209 SEP2, AGL4, K-box region and MADS-box family protein
NitMADS6 Nitab4.5_0000036g0460.1 160 AGL21
NitMADS7 Nitab4.5_0000047g0250.1 219 AGL62
NitMADS8 Nitab4.5_0000093g0040.1 177 AGL29
NitMADS9 Nitab4.5_0000131g0290.1 133 SVP, AGL22, K-box region and MADS-box family protein
NitMADS10 Nitab4.5_0000140g0130.1 210 AGL20, SOC1, ATSOC1, AGAMOUS-like 20
NitMADS11 Nitab4.5_0000146g0060.1 197 AGL62
NitMADS12 Nitab4.5_0000154g0260.1 186 SEP2, AGL4, K-box region and MADS-box family protein
NitMADS13 Nitab4.5_0000163g0010.1 239 MADS-box protein AGL71-like
NitMADS14 Nitab4.5_0000167g0220.1 270 AGL2
NitMADS15 Nitab4.5_0000214g0110.1 260 AGL8 homolog
NitMADS16 Nitab4.5_0000290g0080.1 62 AGL42
NitMADS17 Nitab4.5_0000323g0030.1 268 SEP3, AGL9, K-box region and MADS-box family protein
NitMADS18 Nitab4.5_0000354g0070.1 85 ANR1, AGL44, AGAMOUS-like 44
NitMADS19 Nitab4.5_0000365g0070.1 271 AGL2
NitMADS20 Nitab4.5_0000367g0080.1 169 AGL1
NitMADS21 Nitab4.5_0000396g0070.1 165 AGL29
NitMADS22 Nitab4.5_0000418g0050.1 212 PI
NitMADS23 Nitab4.5_0000508g0030.1 209 PI
NitMADS24 Nitab4.5_0000514g0010.1 240 AGL21
NitMADS25 Nitab4.5_0000518g0100.1 175 AGL8 homolog
NitMADS26 Nitab4.5_0000579g0010.1 249 SEP3, AGL9, K-box region and MADS-box family protein
NitMADS27 Nitab4.5_0000592g0010.1 434 vegetative cell wall protein gp1-like
NitMADS28 Nitab4.5_0000599g0020.1 89 AGL20, SOC1, ATSOC1 AGAMOUS-like 20
NitMADS29 Nitab4.5_0000622g0180.1 177 AGL29
NitMADS30 Nitab4.5_0000654g0110.1 193 AGL62
NitMADS31 Nitab4.5_0000715g0210.1 442 AGL104
NitMADS32 Nitab4.5_0000738g0160.1 221 AGL80
NitMADS33 Nitab4.5_0000748g0100.1 190 AGL12, XAL1, AGAMOUS-like 12
NitMADS34 Nitab4.5_0000772g0010.1 201 AGL62
NitMADS35 Nitab4.5_0000787g0180.1 370 AGL80
NitMADS36 Nitab4.5_0000832g0060.1 97 AGL20, SOC1, ATSOC1, AGAMOUS-like 20
NitMADS37 Nitab4.5_0000885g0080.1 71 ANR1, AGL44, AGAMOUS-like 44
NitMADS38 Nitab4.5_0000902g0340.1 186 SVP, AGL22 K-box region and MADS-box family protein
NitMADS39 Nitab4.5_0000915g0190.1 159 AGL1
NitMADS40 Nitab4.5_0000927g0060.1 90 AGL12, XAL1, AGAMOUS-like 12
NitMADS41 Nitab4.5_0000934g0190.1 327 AGL66
NitMADS42 Nitab4.5_0000935g0220.1 66 AGL21
NitMADS43 Nitab4.5_0001026g0080.1 189 SVP, AGL22, K-box region and MADS-box family protein
NitMADS44 Nitab4.5_0001030g0180.1 191 AGL62
NitMADS45 Nitab4.5_0001099g0010.1 185 AGL62
NitMADS46 Nitab4.5_0001113g0010.1 101 MAF4
NitMADS47 Nitab4.5_0001121g0240.1 260 AG
NitMADS48 Nitab4.5_0001127g0140.1 250 AGL6
NitMADS49 Nitab4.5_0001209g0020.1 532 vegetative cell wall protein gp1-like
NitMADS50 Nitab4.5_0001242g0040.1 78 AGL15
NitMADS51 Nitab4.5_0001244g0010.1 333 AGL15
NitMADS52 Nitab4.5_0001262g0020.1 164 AGL1
NitMADS53 Nitab4.5_0001339g0170.1 245 SEP2, AGL4, K-box region and MADS-box family protein
NitMADS54 Nitab4.5_0001376g0040.1 68 AGL20, SOC1 ATSOC1,AGAMOUS-like 20
NitMADS55 Nitab4.5_0001434g0020.1 227 SEP2, AGL4, K-box region and MADS-box family protein
NitMADS56 Nitab4.5_0001436g0060.1 277 MADS-box transcription factor 23-like
NitMADS57 Nitab4.5_0001463g0160.1 361 FEM111,AGL80, AGAMOUS-like 80
NitMADS58 Nitab4.5_0001468g0090.1 190 SVP, AGL22, K-box region and MADS-box family protein
NitMADS59 Nitab4.5_0001477g0020.1 222 AGL62
NitMADS60 Nitab4.5_0001541g0050.1 258 AGL8, FUL, AGAMOUS-like 8
NitMADS61 Nitab4.5_0001714g0110.1 119 AGL14
NitMADS62 Nitab4.5_0001797g0040.1 210 SEP4, AGL3, K-box region and MADS-box family protein
NitMADS63 Nitab4.5_0001932g0030.1 200 AGL62
NitMADS64 Nitab4.5_0001997g0120.1 75 AGL17
NitMADS65 Nitab4.5_0002011g0030.1 242 AGL62
NitMADS66 Nitab4.5_0002041g0030.1 245 SEP4, AGL3, K-box region and MADS-box family protein
NitMADS67 Nitab4.5_0002060g0090.1 67 AGL42
NitMADS68 Nitab4.5_0002207g0020.1 172 AGL29
NitMADS69 Nitab4.5_0002210g0020.1 179 AGL61
NitMADS70 Nitab4.5_0002228g0010.1 140 AGL20, SOC1, ATSOC1, AGAMOUS-like 20
NitMADS71 Nitab4.5_0002249g0010.1 185 AP1, AGL7, K-box region and MADS-box family protein
NitMADS72 Nitab4.5_0002266g0050.1 118 AP3, ATAP3, K-box region and MADS-box family protein
NitMADS73 Nitab4.5_0002290g0100.1 146 ANR1, AGL44, AGAMOUS-like 44
NitMADS74 Nitab4.5_0002324g0050.1 243 AGL62
NitMADS75 Nitab4.5_0002449g0010.1 256 AGL8, FUL, AGAMOUS-like 8
NitMADS76 Nitab4.5_0002467g0090.1 160 AP1, AGL7, K-box region and MADS-box family protein
NitMADS77 Nitab4.5_0002502g0010.1 185 AGL2
NitMADS78 Nitab4.5_0002516g0060.1 120 FEM111, AGL80, AGAMOUS-like 80
NitMADS79 Nitab4.5_0002583g0020.1 185 AGL61, DIA, AGAMOUS-like 61
NitMADS80 Nitab4.5_0002779g0020.1 185 AGL 2
NitMADS81 Nitab4.5_0002840g0130.1 173 MADS-box transcription factor 23-like
NitMADS82 Nitab4.5_0002860g0020.1 190 AGL61, DIA, AGAMOUS-like 61
NitMADS83 Nitab4.5_0002947g0010.1 185 AGL2
NitMADS84 Nitab4.5_0002949g0060.1 182 AGL104
NitMADS85 Nitab4.5_0003151g0030.1 228 AGL 2
NitMADS86 Nitab4.5_0003182g0070.1 214 AGL20, SOC1, ATSOC1, AGAMOUS-like 20
NitMADS87 Nitab4.5_0003184g0040.1 86 AGL16
NitMADS88 Nitab4.5_0003248g0010.1 237 MAF4
NitMADS89 Nitab4.5_0003336g0080.1 231 AGL21
NitMADS90 Nitab4.5_0003356g0030.1 78 AGL20, SOC1, ATSOC1, AGAMOUS-like 20
NitMADS91 Nitab4.5_0003390g0060.1 116 AGL29
NitMADS92 Nitab4.5_0003480g0010.1 177 AGL29
NitMADS93 Nitab4.5_0003504g0010.1 609 AGL30
NitMADS94 Nitab4.5_0003507g0010.1 232 AG
NitMADS95 Nitab4.5_0003563g0030.1 242 AGL62
NitMADS96 Nitab4.5_0003707g0020.1 80 STK, AGL11, K-box region and MADS-box family protein
NitMADS97 Nitab4.5_0003863g0050.1 242 TT16, ABS, AGL32, K-box region and MADS-box family protein
NitMADS98 Nitab4.5_0004004g0010.1 219 AGL62
NitMADS99 Nitab4.5_0004036g0060.1 183 AGL104
NitMADS100 Nitab4.5_0004086g0040.1 237 AP3, ATAP3, K-box region and MADS-box family protein
NitMADS101 Nitab4.5_0004114g0070.1 175 MADS-box protein AGL24-like
NitMADS102 Nitab4.5_0004153g0060.1 187 SVP, AGL22, K-box region and MADS-box family protein
NitMADS103 Nitab4.5_0004222g0040.1 345 AGL15
NitMADS104 Nitab4.5_0004263g0020.1 218 STK, AGL11, K-box region and MADS-box family protein
NitMADS105 Nitab4.5_0004346g0030.1 209 PI
NitMADS106 Nitab4.5_0004520g0010.1 133 SEP4, AGL3, K-box region and MADS-box family protein
NitMADS107 Nitab4.5_0004622g0050.1 225 AGL6
NitMADS108 Nitab4.5_0004673g0050.1 69 AGL16
NitMADS109 Nitab4.5_0004674g0030.1 196 AGL8, FUL, AGAMOUS-like 8
NitMADS110 Nitab4.5_0004907g0010.1 179 AGL1
NitMADS111 Nitab4.5_0004911g0040.1 121 AGL20, SOC1, ATSOC1, AGAMOUS-like 20
NitMADS112 Nitab4.5_0005046g0020.1 396 AGL62
NitMADS113 Nitab4.5_0005138g0050.1 248 AG
NitMADS114 Nitab4.5_0005163g0010.1 85 AGL21
NitMADS115 Nitab4.5_0005166g0020.1 212 PI
NitMADS116 Nitab4.5_0005183g0060.1 164 MADS-box transcription factor 23-like
NitMADS117 Nitab4.5_0005362g0010.1 123 AGL28
NitMADS118 Nitab4.5_0005468g0020.1 65 AGL15
NitMADS119 Nitab4.5_0005565g0020.1 154 MADS-box protein JOINTLESS-like isoform X4
NitMADS120 Nitab4.5_0005597g0030.1 495 AGL104
NitMADS121 Nitab4.5_0005688g0010.1 173 MADS-box transcription factor 23-like
NitMADS122 Nitab4.5_0005766g0030.1 181 AGL65
NitMADS123 Nitab4.5_0005772g0040.1 180 STK, AGL11, K-box region and MADS-box family protein
NitMADS124 Nitab4.5_0005798g0020.1 183 AGL2
NitMADS125 Nitab4.5_0006437g0030.1 96 SEP3, K-box region and MADS-box family protein
NitMADS126 Nitab4.5_0006477g0040.1 229 STK, AGL11, K-box region and MADS-box family protein
NitMADS127 Nitab4.5_0006520g0020.1 79 MADS-box transcription factor 16-like
NitMADS128 Nitab4.5_0006522g0010.1 156 AGL20, SOC1, ATSOC1, AGAMOUS-like 20
NitMADS129 Nitab4.5_0007204g0030.1 248 AG
NitMADS130 Nitab4.5_0007275g0010.1 325 AGL104
NitMADS131 Nitab4.5_0007355g0010.1 267 AGL 2
NitMADS132 Nitab4.5_0007505g0060.1 68 AGL8, FUL, AGAMOUS-like 8
NitMADS133 Nitab4.5_0007530g0020.1 208 AGL8, FUL, AGAMOUS-like 8
NitMADS134 Nitab4.5_0007721g0040.1 70 AGL16
NitMADS135 Nitab4.5_0008133g0010.1 167 AGL19, GL19, AGAMOUS-like 19
NitMADS136 Nitab4.5_0009469g0040.1 69 AGL24
NitMADS137 Nitab4.5_0009635g0020.1 177 AGL2
NitMADS138 Nitab4.5_0009637g0010.1 157 AGL80
NitMADS139 Nitab4.5_0010043g0030.1 83 ANR1, AGL44, AGAMOUS-like 44
NitMADS140 Nitab4.5_0010230g0020.1 169 AGL61, DIA, AGAMOUS-like 61
NitMADS141 Nitab4.5_0010657g0020.1 185 AGL2
NitMADS142 Nitab4.5_0010693g0010.1 180 SHP1, AGL1, K-box region and MADS-box family protein
NitMADS143 Nitab4.5_0010703g0030.1 162 AGL1
NitMADS144 Nitab4.5_0011208g0020.1 210 AGL62
NitMADS145 Nitab4.5_0011644g0010.1 623 AGL30
NitMADS146 Nitab4.5_0011705g0040.1 208 AGL62
NitMADS147 Nitab4.5_0012101g0010.1 196 SEP1, AGL2, K-box region and MADS-box transcription factor family protein
NitMADS148 Nitab4.5_0012471g0010.1 185 AGL1
NitMADS149 Nitab4.5_0012476g0010.1 185 AGL2
NitMADS150 Nitab4.5_0012816g0020.1 210 MAF4, FCL4, AGL69, K-box region and MADS-box family protein
NitMADS151 Nitab4.5_0013517g0010.1 118 AGL91
NitMADS152 Nitab4.5_0014584g0010.1 270 AP3, ATAP3, K-box region and MADS-box family protein
NitMADS153 Nitab4.5_0014719g0010.1 74 AGL16
NitMADS154 Nitab4.5_0015237g0010.1 76 SEPALLATA2
NitMADS155 Nitab4.5_0021852g0010.1 113 AGL20, SOC1, ATSOC1, AGAMOUS-like 20
NitMADS156 Nitab4.5_0023347g0010.1 151 AGL2
NitMADS157 Nitab4.5_0024332g0010.1 208 AGL62
NitMADS158 Nitab4.5_0024971g0010.1 91 AGL61, DIA, AGAMOUS-like 61
NitMADS159 Nitab4.5_0025184g0010.1 407 AGL62
NitMADS160 Nitab4.5_0027705g0010.1 201 AGL62
NitSUP1 Nitab4.5_0003721g0010.1 183 SUPERMAN
NitSUP2 Nitab4.5_0000086g0190.1 174 SUPERMAN
NitSUP3 Nitab4.5_0000342g0280.1 234 SUPERMAN
NitSUP4 Nitab4.5_0009537g0030.1 227 SUPERMAN
NitSUP5 Nitab4.5_0011666g0020.1 175 SUPERMAN

Table 2

MADS-box and SUPERMAN genes of Nicotiana tabacum"

基因
Gene name
转录本
Transcript
蛋白长度
Protein length (aa)
TAIR10_描述
TAIR10_description
NitMADS22 Nitab4.5_0000418g0050.1 212 PI
NitMADS23 Nitab4.5_0000508g0030.1 209 PI
NitMADS72 Nitab4.5_0002266g0050.1 118 AP3, ATAP3 K-box region and MADS-box family protein
NitMADS100 Nitab4.5_0004086g0040.1 237 AP3, ATAP3 K-box region and MADS-box family protein
NitMADS105 Nitab4.5_0004346g0030.1 209 PI
NitMADS115 Nitab4.5_0005166g0020.1 212 PI
NitMADS152 Nitab4.5_0014584g0010.1 270 AP3, ATAP3 K-box region and MADS-box family protein
NitSUP1 Nitab4.5_0003721g0010.1 183 SUPERMAN
NitSUP2 Nitab4.5_0000086g0190.1 174 SUPERMAN
NitSUP3 Nitab4.5_0000342g0280.1 234 SUPERMAN
NitSUP4 Nitab4.5_0009537g0030.1 227 SUPERMAN
NitSUP5 Nitab4.5_0011666g0020.1 175 SUPERMAN

Fig. 2

Chromosomal locations of MADS-box and SUPERMAN genes in tobacco"

Fig. 3

Collinearity graph of tobacco MADS-box genomes"

Fig. 4

Collinearity of species within MADS-box genes in N. tabacum, N. attenuata, and S. lycopersicum Nitab: N. tabacum; Niatt: N. attenuata; Nsly: S. lycopersicum. The red line indicates collinearity between MADS-box genes of N. tabacum and N. attenuata. The blue line indicates collinearity between MADS-box genes of N. tabacum and S. lycopersicum."

Fig. 5

Collinearity of species within SUPERMAN genes in N. tabacum, N. attenuata, and S. lycopersicum Nitab: N. tabacum; Niatt: N. attenuata; Nsly: S. lycopersicum. The red line indicates collinearity between SUPERMAN genes of N. tabacum and N. attenuata. The blue line indicates collinearity between SUPERMAN genes of N. tabacum and S. lycopersicum."

Table 3

Cis-acting element of MADS-box genes in tobacco"

基因
Gene name
脱落酸响应元件
ABRE
生长素响应元件
AuxRR-core
茉莉酸甲酯响应元件
CGTCA-motif
乙烯响应元件
ERE
水杨酸响应元件
TCA-element
茉莉酸甲酯响应元件
TGACG-motif
NitMADS115 0 1 1 3 1 1
NitMADS72 2 0 4 0 2 4
NitMADS100 3 0 1 0 1 1
NitMADS22 3 0 2 1 0 2
NitMADS23 1 0 0 4 1 3
NitMADS105 2 0 3 1 1 3

Table 4

Cis-acting element of SUPERMAN genes in tobacco"

基因
Gene
脱落酸响应
元件
ABRE
茉莉酸甲酯响应
元件
CGTCA-motif
乙烯响应
元件
ERE
赤霉素响应
元件
TATC-box
水杨酸响应
元件
TCA-element
生长素响应
元件
TGA-element
茉莉酸甲酯响应
元件
TGACG-motif
NitSUP1 1 3 0 1 0 0 2
NitSUP2 1 0 0 0 1 3 0
NitSUP3 2 2 0 1 6 0 2
NitSUP4 2 3 3 0 3 1 3
NitSUP5 2 1 0 0 1 0 1

Fig. 6

Relative expression profile of B genes and SUPERMAN in tobacco at different flower development stages K326: maintainer K326; msK326: CMS K326. Error bar represents the SD (n = 3). All data are means ± SDs (n = 3). **: P < 0.01; *: P < 0.05."

[1] Crosatti C, Quansah L, Maré C, Giusti L, Roncaglia E, Atienza S G, Cattivelli L, Fait A. Cytoplasmic genome substitution in wheat affects the nuclear-cytoplasmic cross-talk leading to transcript and metabolite alterations. BMC Genomics, 2013, 10: 868.
[2] Kang L, Li P, Wang A, Ge X, Li Z. A novel cytoplasmic male sterility in Brassica napus (inap CMS) with carpelloid stamens via protoplast fusion with Chinese Woad. Front Plant Sci, 2017, 8: 529.
doi: 10.3389/fpls.2017.00529 pmid: 28428799
[3] Yang H, Xue Y, Li B, Lin Y, Li H, Guo Z, Li W, Fu Z, Ding D, Tang J. The chimeric gene atp6c confers cytoplasmic male sterility in maize by impairing the assembly of the mitochondrial ATP synthase complex. Mol Plant, 2022, 15: 872-886.
doi: 10.1016/j.molp.2022.03.002
[4] Xiao S, Zang J, Pei Y, Liu J, Liu J, Song W, Shi Z, Su A, Zhao J, Chen H. Activation of mitochondrial orf355gene expression by a nuclear-encoded DREB transcription factor causes cytoplasmic male sterility in maize. Mol Plant, 2020, 13: 1270-1283.
doi: 10.1016/j.molp.2020.07.002
[5] Takatsuka A, Kazama T, Arimura S I, Toriyama K. TALEN- mediated depletion of the mitochondrial gene orf312 proves that it is a Tadukan-type cytoplasmic male sterility-causative gene in rice. Plant J, 2022, 110: 994-1004.
doi: 10.1111/tpj.v110.4
[6] Kuwabara K, Arimura S I, Shirasawa K, Ariizumi T. Orf137 triggers cytoplasmic male sterility in tomato. Plant Physiol, 2022, 189: 465-468.
doi: 10.1093/plphys/kiac082
[7] Yamagishi H, Jikuya M, Okushiro K, Hashimoto A, Fukunaga A, Takenaka M, Terachi T. A single nucleotide substitution in the coding region of Ogura male sterile gene, orf138, determines effectiveness of a fertility restorer gene, Rfo, in radish. Mol Genet Genomics, 2021, 296: 705-717.
doi: 10.1007/s00438-021-01777-y pmid: 33772345
[8] Wen J F, Zhao K, Lyu J H, Huo J L, Wang Z R, Wan H J, Zhu H S, Zhang Z Q, Shao G F, Wang J, Zhang S, Yang T Y, Zhang J R, Zou X X, Deng M H. Orf165 is associated with cytoplasmic male sterility in pepper. Genet Mol Biol, 2021, 44: e20210030.
doi: 10.1590/1678-4685-gmb-2021-0030
[9] Zhu Y, Saraike T, Yamamoto Y, Hagita H, Takumi S, Murai K. Orf260cra, a novel mitochondrial gene, is associated with the homeotic transformation of stamens into pistil-like structures (pistillody) in alloplasmic wheat. Plant Cell Physiol, 2008, 49: 1723-1733.
doi: 10.1093/pcp/pcn143 pmid: 18794174
[10] Wang R, Cai X, Hu S, Li Y, Fan Y, Tan S, Liu Q, Zhou W. Comparative analysis of the mitochondrial genomes of Nicotiana tabacum: hints toward the key factors closely related to the cytoplasmic male sterility mechanism. Front Genet, 2020, 11: 257.
doi: 10.3389/fgene.2020.00257
[11] Chase C D. Cytoplasmic male sterility: a window to the world of plant mitochondrial-nuclear interactions. Trends Genet, 2007, 23: 81-90.
doi: 10.1016/j.tig.2006.12.004 pmid: 17188396
[12] Chen L, Liu Y G. Male sterility and fertility restoration in crops. Annu Rev Plant Biol, 2014, 65: 579-606.
doi: 10.1146/annurev-arplant-050213-040119 pmid: 24313845
[13] Zubko M K. Mitochondrial tuning fork in nuclear homeotic functions. Trends Plant Sci, 2004, 9: 61-64.
pmid: 15106588
[14] Teixeira R T, Farbos I, Glimelius K. Expression levels of meristem identity and homeotic genes are modified by nuclear- mitochondrial interactions in alloplasmic male-sterile lines of Brassica napus. Plant J, 2005, 42: 731-742.
pmid: 15918886
[15] Bereterbide A, Hernould M, Farbos I, Glimelius K, Mouras A. Restoration of stamen development and production of functional pollen in an alloplasmic CMS tobacco line by ectopic expression of the Arabidopsis thaliana SUPERMAN gene. Plant J, 2002, 29: 607-615.
pmid: 11874573
[16] Prunet N, Yang W, Das P, Meyerowitz E M, Jack T P. SUPERMAN prevents class B gene expression and promotes stem cell termination in the fourth whorl of Arabidopsis thaliana flowers. Proc Natl Acad Sci USA, 2017, 114: 7166-7171.
doi: 10.1073/pnas.1705977114
[17] Xu Y, Prunet N, Gan E S, Wang Y, Stewart D, Wellmer F, Huang J, Yamaguchi N, Tatsumi Y, Kojima M, Kiba T, Sakakibara H, Jack T P, Meyerowitz E M. SUPERMAN regulates floral whorl boundaries through control of auxin biosynthesis. EMBO J, 2018, 37: e97499.
doi: 10.15252/embj.201797499
[18] Nandi A K, Kushalappa K, Prasad K, Vijayraghavan U. A conserved function for Arabidopsis SUPERMAN in regulating floral-whorl cell proliferation in rice, a monocotyledonous plant. Curr Biol, 2000, 10: 215-218.
pmid: 10704413
[19] Lu S, Wang J, Chitsaz F, Derbyshire M K, Geer R C, Gonzales N R, Gwadz M, Hurwitz D I, Marchler G H, Song J S, Thanki N, Yamashita R A, Yang M, Zhang D, Zheng C, Lanczycki C J, Marchler-Bauer A. CDD/SPARCLE: the conserved domain database in 2020. Nucleic Acids Res, 2020, 48: D265-D268.
[20] Chao J T, Li Z Y, Sun Y H, Aluko O O, Wu X R, Wang Q, Liu G S. MG2C: a user-friendly online tool for drawing genetic maps. Mol Hortic, 2021, 1: 16.
doi: 10.1186/s43897-021-00020-x
[21] Chen C, Chen H, Zhang Y, Thomas H R, Frank M H, He Y, Xia R. TBtools: an integrative toolkit developed for interactive analyses of big biological data. Mol Plant, 2020, 13: 1194-1202.
doi: S1674-2052(20)30187-8 pmid: 32585190
[22] Lescot M, Dehais P, Thijs G, Marchal K, Moreau Y, Van de Peer Y, Rouze P, Rombauts S. PlantCARE, a database of plant cis- acting regulatory elements and a portal to tools for in silico analysis of promoter sequences. Nucleic Acids Res, 2002, 30: 325-327.
[23] Meyerowitz E M. Genetic control of cell division patterns in developing plants. Cell, 1997, 88: 299-308.
pmid: 9039256
[24] Zhang K, Zhang H, Pan Y, Niu Y, Guo L, Ma Y, Tian S, Wei J, Wang C, Yang X, Fu Y, Qu P, Liu L, Zhang Y, Sun H, Bai Z, Dong J, Li C, Liu X. Cell- and noncell-autonomous AUXIN RESPONSE FACTOR3 controls meristem proliferation and phyllotactic patterns. Plant Physiol, 2022, 190: 2335-2349.
doi: 10.1093/plphys/kiac370 pmid: 35972411
[25] Uemura A, Yamaguchi N, Xu Y, Wee W, Ichihashi Y, Suzuki T, Shibata A, Shirasu K. Regulation of floral meristem activity through the interaction of AGAMOUS, SUPERMAN, and CLAVATA3 in Arabidopsis. Plant Reprod, 2018, 31: 89-105.
doi: 10.1007/s00497-017-0315-0 pmid: 29218596
[1] Zhang Xi, Wang Guang-En, Li Shao-Qi, Liu Yi, Li Jun-Lan, Qian Yu-Yuan. Transcriptome sequencing-based analysis on the formation mechanism of fiber micronaire differences between two sister lines derived from Gossypium hirsutum-G. barbadense hybrid [J]. Acta Agronomica Sinica, 2026, 52(5): 1442-1458.
[2] Shi Shao-Jie, Liu Kai, Chen Zi-Yi, Wang Hui-Ying, Li San-He, Zhou Lei, You Ai-Qing. Cloning and functional analysis of the dwarf and multi-tiller gene DMT1 in rice [J]. Acta Agronomica Sinica, 2026, 52(4): 1022-1034.
[3] Yang Yue, Zhang Xin-Xin, He Zeng-Hui, Li Rui-Dong, Pan Yu-Jie, Li Jia-Kang, Du Wei, Xu Da-Yong, Du Jin-Song. Non-destructive prediction and visualization of major chemical components in tobacco leaves using hyperspectral imaging [J]. Acta Agronomica Sinica, 2026, 52(3): 922-935.
[4] Zhan Ge-Rui, Yu Wen, Li Feng, Wu Ming-Zhu, Xu Xin, Luo Zhao-Peng, Wu Sheng-Xin, Yang Jun, Zhang Zhi-Qiang, Wang Zhong. Functional study of NtWRKY6 in response to ABA expression and regulation of polyphenol synthesis [J]. Acta Agronomica Sinica, 2026, 52(2): 446-458.
[5] Kong Na, Liu Tao, Liu Wen-Ting, Chen Gang, Wen Li-Chao, Deng Zhi-Chao, Guo Mei, Li Wei, Guo Yong-Feng. Cloning of the NtCEP7 gene in tobacco and functional analysis of its encoded peptide in seedling-stage drought resistance [J]. Acta Agronomica Sinica, 2026, 52(1): 249-261.
[6] JI Bai-Lu, SUN Yi-Wen, LIU Wan-Feng, QIAN Ya-Xin, JIANG Cai-Hong, GENG Rui-Mei, LIU Dan, CHENG Li-Rui, YANG Ai-Guo, HUANG Li-Yu, LI Xiao-Xu, PU Wen-Xuan, GAO Jun-Ping, ZHANG Qiang, WEN Liu-Ying. Functional verification of the key gene NtLPAT involved in lipid biosynthesis in tobacco [J]. Acta Agronomica Sinica, 2025, 51(9): 2527-2537.
[7] LEI Song-Han, FAN Jun-Yang, CHE Yan-Yi, DAI Yong-Dong, ZHENG Yu-Meng, TIAN Wei-Jiang, SANG Xian-Chun, WANG Xiao-Wen. Identification of an adaxially-curled-leaf mutant acl3 and function analysis of the regulated gene in rice (Oryza sativa L.) [J]. Acta Agronomica Sinica, 2025, 51(6): 1467-1479.
[8] ZHANG Qin, DAI Cheng, MA Chao-Zhi. Auxin response reporter gene transformation of Brassica napus and dynamic signal analysis of GUS in different tissues [J]. Acta Agronomica Sinica, 2025, 51(3): 667-675.
[9] LIU Bo, CHI Ming, CAO Meng-Qi, TANG Da, YANG Heng-Zhao, ZHANG Wei-Hua, XUE Cong. Impact of potato StuPPO9 gene overexpression on drought resistance in Nicotiana benthamiana [J]. Acta Agronomica Sinica, 2024, 50(9): 2237-2247.
[10] TAN Dan, CHEN Jia-Ting, GAO Yu, ZHANG Xiao-Jun, LI Xin, YAN Gui-Yun, LI Rui, CHEN Fang, CHANG Li-Fang, ZHANG Shu-Wei, GUO Hui-Juan, CHANG Zhi-Jian, QIAO Lin-Yi. Discovery of auxin pathway genes involving spike type and association analysis between TaARF23-A and spikelet number in wheat [J]. Acta Agronomica Sinica, 2024, 50(2): 506-513.
[11] FU Jia-Qi, LI Shi-Kuan, TAN Meng-Hui, LUO Fang, ZHANG Chuan-Ling, LIU Ling-Yue, LU Qian, GU Yong-Zhe. Soybean GmRSM1 promotes apical hook disappearance by regulating PIN gene expression [J]. Acta Agronomica Sinica, 2024, 50(11): 2731-2741.
[12] LIU Ying-Chao, FANG Dun-Huang, XU Hai-Ming, TONG Zhi-Jun, XIAO Bing-Guang. QTL mapping of alkaloids in tobacco [J]. Acta Agronomica Sinica, 2024, 50(1): 42-54.
[13] WEN Li-Chao, XIONG Tao, DENG Zhi-Chao, LIU Tao, GUO Cun, LI Wei, GUO Yong-Feng. Expression and functional characterization of NtNAC080 transcription factor gene from Nicotiana tabacumin under abiotic stress [J]. Acta Agronomica Sinica, 2023, 49(8): 2171-2182.
[14] HE Yong-Ming, ZHANG Fang. Study of regulating effect of auxin on floret opening in rice [J]. Acta Agronomica Sinica, 2023, 49(6): 1690-1698.
[15] LI Bang, LIU Chun-Juan, GUO Jun-Jie, WU Yu-Xin, DENG Zhi-Cheng, ZHANG Min, CUI Tong, LIU Chang, ZHOU Yu-Fei. Effects of exogenous tryptophan on root elongation of sorghum seedlings under low nitrogen stress [J]. Acta Agronomica Sinica, 2023, 49(5): 1372-1385.
Viewed
Full text


Abstract

Cited

  Shared   
  Discussed   
No Suggested Reading articles found!