Welcome to Acta Agronomica Sinica,

Acta Agronomica Sinica ›› 2022, Vol. 48 ›› Issue (1): 48-62.doi: 10.3724/SP.J.1006.2022.11006

;

• CROP GENETICS & BREEDING · GERMPLASM RESOURCES · MOLECULAR GENETICS • Previous Articles     Next Articles

Transcriptome profiling of glossy1 mutant with glossy glume in common wheat (Triticum aestivum L.)

LI Ling-Hong(), ZHANG Zhe, CHEN Yong-Ming, YOU Ming-Shan, NI Zhong-Fu, XING Jie-Wen*()   

  1. College of Agronomy, China Agricultural University, Beijing 100193, China
  • Received:2021-01-12 Accepted:2021-04-14 Online:2022-01-12 Published:2021-05-21
  • Contact: XING Jie-Wen E-mail:lilinghong00en@163.com;Jiewen.Xing@cau.edu.cn
  • Supported by:
    National Natural Science Foundation of China(31991214);National Key Research and Development Program of China(2017YFD0101004)

Abstract:

In order to clarify the molecular mechanism of the significant change in glume wax content, transcriptome profiling was performed on glossy glume mutant glossy1 and its wild-type Jimai 22. The results showed that a total of 12,230 differentially expressed genes were screened in the glossy1 mutant, among which 5811 genes were up-regulated and 6419 were down-regulated. GO functional enrichment revealed that the differentially expressed genes were mainly enriched in the wax synthesis and transport pathway, specifically distributed in acyltransferase activity, lipid binding, hydrolase activity. The findings suggested that these pathways were closely related to the glume-wax-deficient trait in wheat. We also detected the relative expression levels of some genes involved in the wax metabolic pathway by RT-qPCR, and the results were consistent with the transcriptome data. This study not only provides data support for the further study of the molecular mechanism of wax metabolism and gene regulation network but also lays a theoretical foundation for the breeding of stress-resistant variety in wheat.

Key words: wheat, epicuticular wax, glossy1 mutant, transcriptome analysis, molecular mechanism

Fig. 1

Phenotypic comparison of Jimai 22 and glossy1 mutant A: The whole plant of Jimai 22 and glossy1. Bar: 10 cm; B: Enlarged view of spikes of Jimai 22 and glossy1. Bar: 1 cm."

Table 1

Primers for RT-qPCR used in this study"

基因编号
Gene ID
正向序列
Forward sequence (5'-3')
反向序列
Reverse sequence (5'-3')
TraesCS3A02G266700 GCAGGTAGCTTTGTATGGC TCGATGAAATCCTCCAAAAGGC
TraesCS5B02G268900 GTACCTGTACCTCTGCTGCT CGTCTCGTGTATCTCTTTGAGGAT
TraesCS2D02G015700 GGTGGCATTTGGACCAGGATTC CAACCGAATTGTGCGCATTG
TraesCS2A02G307600 CCATGGATTTCTCTGTTGCA CATGGATGTCGTCGAGAAAG
TraesCS4D02G148300 GTCAAGGTCGAGTACGCAGG GCCAAGGTAGCAAAAATACACCAA
TraesCS7A02G115600 TGGTTCTCCAAGTGCCTTCAC GCGTCAACGGCGCGAATA
TraesCS6D02G166600 AGATCGACACATTTCCGGTGG TCAATGGATAAAAAGTGAACAGCA
TraesCS5B02G388800 CACCTGGTGCTCTACTGTC CAGATGTAAGCCTCGGATCC
TraesCS1B02G049200 TCGCTGTGAACGACTTTCT TATTGCGCCACTCTTTCTTG

Table 2

Quality assessment of sample sequencing output data"

样品
Sample
原始数据
Total reads (M)
过滤后数据
Unique mapping reads (M)
数据比对效率
Unique mapping (%)
Jimai 22 Rep1 78.82 60.76 77.1
Jimai 22 Rep2 79.34 59.08 74.5
Jimai 22 Rep3 70.18 53.02 75.5
glossy1 Rep1 91.29 64.66 70.8
glossy1 Rep2 74.26 53.74 72.4
glossy1 Rep3 73.17 52.12 71.2

Fig. 2

Sample correlation and differentially expressed genes A: correlation analysis among the samples; B: volcano plot of DEGs; C: the distribution of DEGs on wheat chromosomes."

Fig. 3

RT-qPCR validation of random DEGs"

Fig. 4

GO functional annotation of DEGs A: GO functional annotation classification of DEGs; B: GO enrichment of up-regulated DEGs; C: GO enrichment of down-regulated DEGs."

Fig. 5

Diagram of the epicuticular wax biosynthesis pathway in wheat The colored fonts indicate transcriptional changes of the genes known or predicated to be central for epicuticular wax biosynthesis. Compared with the wild-type, the relative expression of the genes in red is up-regulated, the expression of the genes in orange is up-regulated and down-regulated, and the expression of the genes in blue is down-regulated."

Table 3

Differentially expressed genes related to epicuticular wax biosynthesis pathway in glumes of wheat"

基因编号
Gene ID
倍数变化
log2 (Fold Change)
较正后P
Padj
显著性Significant 相关功能
Related functions
基因符号
Gene symbol
TraesCS5A02G242600 3.609865613 0.004916338 Up Alpha/beta-hydrolases superfamily protein DMH
TraesCS5B02G235400 1.489558363 7.57276E-14 Up Alpha/beta-hydrolases superfamily protein DMH
TraesCS5B02G239300 1.941903403 1.76388E-07 Up Alpha/beta-hydrolases superfamily protein DMH
TraesCS5D02G247700 1.416956174 4.56687E-23 Up Alpha/beta-hydrolases superfamily protein DMH
TraesCS5D02G249600 1.266778647 1.82079E-05 Up Alpha/beta-hydrolases superfamily protein DMH
TraesCS2A02G025700 1.613510275 7.96739E-37 Up Chalcone synthase CHS
TraesCS2A02G035300 6.307119168 4.38659E-26 Up Chalcone synthase CHS
TraesCS2A02G527700 1.584580826 7.22601E-67 Up Chalcone synthase CHS
TraesCS2B02G038700 1.511159327 2.49811E-44 Up Chalcone synthase CHS
TraesCS2B02G048400 6.771018546 4.02053E-13 Up Chalcone synthase CHS
TraesCS2B02G558400 1.565811929 6.38829E-60 Up Chalcone synthase CHS
TraesCS2D02G027700 7.885041654 2.73423E-09 Up Chalcone synthase CHS
TraesCS2D02G027900 1.089916323 2.10199E-17 Up Chalcone synthase CHS
TraesCS2D02G530600 1.359178980 5.17325E-33 Up Chalcone synthase CHS
TraesCS2A02G006400 1.163488023 4.09358E-15 Up Cytochrome P450 family protein, expressed DMC
TraesCS2B02G002000 1.292392885 2.02883E-05 Up Cytochrome P450 family protein, expressed DMC
TraesCS2D02G015600 5.598114975 6.08904E-16 Up Cytochrome P450 family protein, expressed DMC
TraesCS3B02G006600 2.974023949 3.86406E-80 Up Cytochrome P450 family protein, expressed DMC
TraesCS3D02G077400 3.854291668 3.1974E-209 Up Cytochrome P450 family protein, expressed DMC
TraesCS4A02G063900 1.997077843 1.68199E-10 Up Cytochrome P450 family protein, expressed DMC
TraesCS4A02G064000 1.370399465 4.5991E-19 Up Cytochrome P450 family protein, expressed DMC
TraesCS4B02G172200 2.400073652 9.20159E-06 Up Cytochrome P450 family protein, expressed DMC
TraesCS4B02G241100 1.849837854 2.89613E-18 Up Cytochrome P450 family protein, expressed DMC
TraesCS4B02G342000 1.906423178 9.65609E-98 Up Cytochrome P450 family protein, expressed DMC
TraesCS4D02G240800 2.345669375 1.52442E-13 Up Cytochrome P450 family protein, expressed DMC
TraesCS6A02G143700 2.852491021 1.56916E-05 Up Cytochrome P450 family protein, expressed DMC
TraesCS6A02G144600 2.291592568 3.17585E-37 Up Cytochrome P450 family protein, expressed DMC
TraesCS6A02G323900 5.510836360 1.0995E-08 Up Cytochrome P450 family protein, expressed DMC
TraesCS6D02G133500 5.032820286 7.9837E-09 Up Cytochrome P450 family protein, expressed DMC
TraesCS6D02G303700 2.939258272 6.1412E-12 Up Cytochrome P450 family protein, expressed DMC
TraesCS7A02G077500 1.399996805 0.004103167 Up Cytochrome P450 family protein, expressed DMC
基因编号
Gene ID
倍数变化
log2 (Fold Change)
较正后P
Padj
显著性Significant 相关功能
Related functions
基因符号
Gene symbol
TraesCS7D02G028900 5.180466519 2.44704E-11 Up Cytochrome P450 family protein, expressed DMC
TraesCS7D02G073100 1.905576368 7.80242E-05 Up Cytochrome P450 family protein, expressed DMC
TraesCS1A02G075000 1.598873518 4.60281E-26 Up Long-chain acyl-CoA synthetase LACS
TraesCS1B02G093600 1.508738506 3.6507E-31 Up Long-chain acyl-CoA synthetase LACS
TraesCS1D02G077600 1.081329758 3.35804E-18 Up Long-chain acyl-CoA synthetase LACS
TraesCS4B02G110600 -1.547038060 5.29477E-09 Down Long-chain acyl-CoA synthetase LACS
TraesCS5A02G411500 -6.237682795 7.2037E-25 Down Long-chain acyl-CoA synthetase LACS
TraesCS5B02G415100 -8.272718606 9.87304E-27 Down Long-chain acyl-CoA synthetase LACS
TraesCS5D02G420300 -4.365756350 6.03687E-49 Down Long-chain acyl-CoA synthetase LACS
TraesCS1A02G037600 4.524213496 0.000135779 Up 3-ketoacyl-CoA synthase KCS
TraesCS1A02G439000 2.761509645 8.73425E-44 Up 3-ketoacyl-CoA synthase KCS
TraesCS1B02G048000 5.015626497 1.73996E-16 Up 3-ketoacyl-CoA synthase KCS
TraesCS2B02G535600 7.206279001 4.09242E-07 Up 3-ketoacyl-CoA synthase KCS
TraesCS2D02G508000 9.528613227 1.83387E-13 Up 3-ketoacyl-CoA synthase KCS
TraesCS3A02G451100 7.616757835 1.08927E-20 Up 3-ketoacyl-CoA synthase KCS
TraesCS3B02G488500 3.834067625 4.51419E-14 Up 3-ketoacyl-CoA synthase KCS
TraesCS6B02G372900 5.593138031 4.32531E-35 Up 3-ketoacyl-CoA synthase KCS
TraesCS6B02G373000 7.970320318 8.09061E-09 Up 3-ketoacyl-CoA synthase KCS
TraesCS7A02G107500 5.289345448 1.53292E-60 Up 3-ketoacyl-CoA synthase KCS
TraesCS7A02G107700 8.339117159 1.14218E-13 Up 3-ketoacyl-CoA synthase KCS
TraesCS7A02G107900 9.811714092 8.42497E-08 Up 3-ketoacyl-CoA synthase KCS
TraesCS7B02G006200 4.994710636 6.6821E-22 Up 3-ketoacyl-CoA synthase KCS
TraesCS7B02G006300 4.485093757 1.69207E-10 Up 3-ketoacyl-CoA synthase KCS
TraesCS7D02G101900 5.535140760 3.55365E-11 Up 3-ketoacyl-CoA synthase KCS
TraesCS7D02G102000 7.929020665 3.15637E-12 Up 3-ketoacyl-CoA synthase KCS
TraesCS7D02G102400 9.833159298 2.62447E-14 Up 3-ketoacyl-CoA synthase KCS
TraesCS7D02G102800 10.749264580 2.74634E-17 Up 3-ketoacyl-CoA synthase KCS
TraesCS7D02G102900 9.529683487 2.23304E-13 Up 3-ketoacyl-CoA synthase KCS
TraesCS6A02G341400 3.752588180 2.60291E-11 Up 3-ketoacyl-CoA synthase KCS
TraesCS6D02G321600 4.880242341 4.20044E-41 Up 3-ketoacyl-CoA synthase KCS
TraesCS4B02G297500 1.659827173 5.04909E-51 Up 3-ketoacyl-CoA synthase KCS
TraesCS7B02G113100 7.980262073 1.75491E-12 Up 3-ketoacyl-CoA synthase KCS
TraesCS7D02G208800 3.543147412 0.000554796 Up 3-ketoacyl-CoA synthase KCS
TraesCS1A02G152100 -6.084977093 9.69328E-17 Down 3-ketoacyl-CoA synthase KCS
TraesCS1B02G169500 -4.902294827 2.98074E-85 Down 3-ketoacyl-CoA synthase KCS
TraesCS1D02G042300 -7.976587931 1.47581E-08 Down 3-ketoacyl-CoA synthase KCS
TraesCS1D02G148900 -6.025460554 1.40723E-75 Down 3-ketoacyl-CoA synthase KCS
TraesCS2A02G014600 -7.746846027 1.3141E-28 Down 3-ketoacyl-CoA synthase KCS
TraesCS4B02G278800 -3.095441182 2.82277E-09 Down 3-ketoacyl-CoA synthase KCS
TraesCS4D02G148300 -1.690121218 1.27211E-59 Down 3-ketoacyl-CoA synthase KCS
TraesCS4D02G277300 -3.287359973 2.5682E-11 Down 3-ketoacyl-CoA synthase KCS
TraesCS5A02G195500 -5.666101362 6.58809E-08 Down 3-ketoacyl-CoA synthase KCS
TraesCS5A02G309100 -7.313293630 1.2516E-06 Down 3-ketoacyl-CoA synthase KCS
TraesCS5B02G187900 -4.098686330 4.59612E-13 Down 3-ketoacyl-CoA synthase KCS
基因编号
Gene ID
倍数变化
log2 (Fold Change)
较正后P
Padj
显著性Significant 相关功能
Related functions
基因符号
Gene symbol
TraesCS5B02G309800 -2.962880296 1.28678E-20 Down 3-ketoacyl-CoA synthase KCS
TraesCS5D02G195500 -5.436858301 0.000895032 Down 3-ketoacyl-CoA synthase KCS
TraesCS5D02G316100 -4.727408251 0.001148457 Down 3-ketoacyl-CoA synthase KCS
TraesCS6A02G026800 -8.922633648 1.48463E-11 Down 3-ketoacyl-CoA synthase KCS
TraesCS6A02G073300 -1.822213794 9.36568E-30 Down 3-ketoacyl-CoA synthase KCS
TraesCS6A02G383700 -2.873970208 6.2082E-56 Down 3-ketoacyl-CoA synthase KCS
TraesCS6B02G098300 -1.303177962 1.87771E-15 Down 3-ketoacyl-CoA synthase KCS
TraesCS6B02G422900 -2.100063721 5.41215E-19 Down 3-ketoacyl-CoA synthase KCS
TraesCS6B02G473900 -7.535973546 2.41404E-07 Down 3-ketoacyl-CoA synthase KCS
TraesCS6D02G071600 -1.627444447 1.73782E-23 Down 3-ketoacyl-CoA synthase KCS
TraesCS6D02G368700 -2.358722083 3.74963E-07 Down 3-ketoacyl-CoA synthase KCS
TraesCS1B02G161300 -1.148306727 2.23176E-11 Down 3-ketoacyl-CoA thiolase KCS
TraesCS1A02G143900 -1.156181479 3.09259E-11 Down 3-ketoacyl-CoA thiolase KCS
TraesCS1D02G142700 -1.228580722 2.21244E-06 Down 3-ketoacyl-CoA thiolase KCS
TraesCS7A02G206000 -4.967018962 7.6424E-07 Down 3-ketoacyl-CoA synthase KCS
TraesCS7A02G205700 -7.953543826 1.53209E-09 Down 3-ketoacyl-CoA synthase KCS
TraesCS7A02G206100 -2.278867816 0.000206848 Down 3-ketoacyl-CoA synthase KCS
TraesCS7B02G113200 -1.616125020 2.02048E-05 Down 3-ketoacyl-CoA synthase KCS
TraesCS6A02G177700 -1.448386589 8.60285E-12 Down 3-ketoacyl-CoA synthase KCS
TraesCS6B02G207000 -3.286252891 5.30387E-50 Down 3-ketoacyl-CoA synthase KCS
TraesCS6D02G166600 -3.676221923 4.17639E-51 Down 3-ketoacyl-CoA synthase KCS
TraesCS7B02G254900 -2.737547187 2.18094E-50 Down 3-ketoacyl-CoA synthase KCS
TraesCS7D02G350500 -3.225952257 2.07987E-30 Down 3-ketoacyl-CoA synthase KCS
TraesCS3A02G075100 1.045765218 0.000137211 Up Very-long-chain (3R)-3-hydroxyacyl-CoA dehydratase HCD
TraesCS6B02G373100 5.540807846 4.63743E-22 Up Very-long-chain (3R)-3-hydroxyacyl-CoA dehydratase HCD
TraesCS3A02G075500 5.736203743 1.8631E-27 Up Very-long-chain (3R)-3-hydroxyacyl-CoA dehydratase HCD
TraesCS3B02G089500 2.731387544 5.93826E-19 Up Very-long-chain (3R)-3-hydroxyacyl-CoA dehydratase HCD
TraesCS3B02G089600 7.196206868 1.98797E-14 Up Very-long-chain (3R)-3-hydroxyacyl-CoA dehydratase HCD
TraesCS3D02G075500 4.043778223 5.93877E-32 Up Very-long-chain (3R)-3-hydroxyacyl-CoA dehydratase HCD
TraesCS3D02G075600 5.722400469 2.04529E-18 Up Very-long-chain (3R)-3-hydroxyacyl-CoA dehydratase HCD
TraesCS7A02G278500 3.420890096 1.94122E-07 Up Fatty acyl-CoA reductase FAR
TraesCS1B02G402600 5.787124891 1.30424E-19 Up Fatty acyl-CoA reductase FAR
TraesCS3A02G014800 8.602623235 9.60398E-11 Up Fatty acyl-CoA reductase FAR
TraesCS3A02G014900 1.310317928 6.37186E-30 Up Fatty acyl-CoA reductase FAR
TraesCSU02G101300 2.435404624 5.30694E-06 Up Fatty acyl-CoA reductase FAR
TraesCS4A02G304400 -3.611496691 2.7181E-05 Down Fatty acyl-CoA reductase FAR
TraesCS4A02G388600 -2.765997264 1.62967E-25 Down Fatty acyl-CoA reductase FAR
TraesCS4B02G006800 -6.076862572 2.05241E-17 Down Fatty acyl-CoA reductase FAR
TraesCS4B02G010100 -4.820087287 9.98576E-05 Down Fatty acyl-CoA reductase FAR
基因编号
Gene ID
倍数变化
log2 (Fold Change)
较正后P
Padj
显著性Significant 相关功能
Related functions
基因符号
Gene symbol
TraesCS4B02G363100 -2.308515610 2.38184E-26 Down Fatty acyl-CoA reductase FAR
TraesCS4D02G008300 -5.163732416 8.12712E-09 Down Fatty acyl-CoA reductase FAR
TraesCS4D02G356300 -1.221776468 1.36062E-11 Down Fatty acyl-CoA reductase FAR
TraesCS5B02G238300 -3.634781009 1.80954E-13 Down Fatty acyl-CoA reductase FAR
TraesCS7D02G084700 -5.018268165 9.70129E-05 Down Fatty acyl-CoA reductase FAR
TraesCS5A02G186200 -1.274284532 6.65E-25 Down Fatty acid desaturase, putative CYTB5
TraesCS6D02G139700 -1.316973984 7.37E-17 Down Fatty acid hydroxylase superfamily CER3
TraesCS7B02G408900 -1.098001027 0.001550775 Down Fatty acid hydroxylase superfamily CER1
TraesCS7D02G488800 -2.219867140 1.01E-11 Down Fatty acid hydroxylase superfamily CER1
TraesCS1A02G150800 2.649798059 1.72E-13 Up Fatty acid hydroxylase superfamily CER1
TraesCS1B02G168400 5.922991840 3.49E-11 Up Fatty acid hydroxylase superfamily CER1
TraesCS5B02G219400 1.245192869 7.48E-11 Up Fatty acid hydroxylase superfamily CER1
TraesCS6B02G423900 6.897415994 9.62E-40 Up Fatty acid hydroxylase superfamily CER1
TraesCS1A02G150900 2.077005421 6.41E-88 Up Fatty acid hydroxylase superfamily protein CER1
TraesCS1B02G168500 1.380075657 4.03E-35 Up Fatty acid hydroxylase superfamily protein CER1
TraesCS2A02G385200 10.776613420 2.20E-17 Up Fatty acid hydroxylase superfamily protein CER1
TraesCS2B02G402100 4.721003825 1.76E-62 Up Fatty acid hydroxylase superfamily protein CER1
TraesCS2D02G381800 3.119567058 1.53E-10 Up Fatty acid hydroxylase superfamily protein CER1
TraesCS2D02G381900 5.874114064 1.52E-35 Up Fatty acid hydroxylase superfamily protein CER1
TraesCS6A02G384600 1.155171256 1.59E-12 Up Fatty acid hydroxylase superfamily protein CER1
TraesCS3B02G006700 1.848872969 4.59478E-40 Up O-acyltransferase WSD1 WSD1
TraesCS3B02G011800 1.737425505 3.93049E-21 Up O-acyltransferase WSD1 WSD1
TraesCS3B02G300200 9.254299292 2.30951E-12 Up O-acyltransferase WSD1 WSD1
TraesCS3B02G300300 3.640886633 0.029361692 Up O-acyltransferase WSD1 WSD1
TraesCS3D02G266900 4.272125701 0.048631502 Up O-acyltransferase WSD1 WSD1
TraesCS3D02G267000 2.477167555 0.000327098 Up O-acyltransferase WSD1 WSD1
TraesCS3D02G304900 1.025977042 7.61464E-14 Up O-acyltransferase WSD1 WSD1
TraesCS5B02G495000 2.790932718 0.000480538 Up O-acyltransferase WSD1 WSD1
TraesCS7D02G029000 4.123068357 6.84189E-66 Up O-acyltransferase WSD1 WSD1
TraesCS1D02G393500 -1.829048691 7.41419E-13 Down O-acyltransferase WSD1 WSD1
TraesCS2B02G007200 -1.479385821 0.013599363 Down O-acyltransferase WSD1 WSD1
TraesCS2D02G002200 -7.694959785 5.11215E-08 Down O-acyltransferase WSD1 WSD1
TraesCS5B02G322300 -2.303757568 3.71433E-15 Down O-acyltransferase WSD1 WSD1
TraesCS5D02G328700 -1.173482919 8.04625E-05 Down O-acyltransferase WSD1 WSD1
TraesCS5D02G329000 -2.199271294 9.26924E-12 Down O-acyltransferase WSD1 WSD1
TraesCS1A02G048700 -3.999360825 1.89244E-33 Down Lipid transfer protein LTP
TraesCS1B02G063800 -6.071084486 0.002379028 Down Lipid transfer protein LTP
TraesCS1D02G050000 -8.269069378 7.89995E-14 Down Lipid transfer protein LTP
TraesCS2A02G161600 -2.581595157 6.92853E-37 Down Lipid transfer protein LTP
TraesCS2A02G477600 -7.167418470 7.6607E-09 Down Lipid transfer protein LTP
TraesCS2A02G477700 -5.736333772 2.1409E-53 Down Lipid transfer protein LTP
TraesCS2A02G517200 -1.169382785 6.85066E-07 Down Lipid transfer protein LTP
TraesCS2B02G187600 -3.842135003 1.98758E-40 Down Lipid transfer protein LTP
TraesCS2B02G500900 -5.312215479 3.82549E-36 Down Lipid transfer protein LTP
基因编号
Gene ID
倍数变化
log2 (Fold Change)
较正后P
Padj
显著性Significant 相关功能
Related functions
基因符号
Gene symbol
TraesCS2B02G501000 -6.596344692 3.8964E-83 Down Lipid transfer protein LTP
TraesCS2D02G168700 -2.555532069 2.92226E-29 Down Lipid transfer protein LTP
TraesCS2D02G476800 -8.559782582 1.4862E-10 Down Lipid transfer protein LTP
TraesCS2D02G476900 -5.295332687 4.06775E-49 Down Lipid transfer protein LTP
TraesCS3A02G344700 -3.745939817 6.17742E-35 Down Lipid transfer protein LTP
TraesCS3B02G376700 -3.206527450 2.41672E-15 Down Lipid transfer protein LTP
TraesCS3D02G338300 -4.085066521 1.12935E-26 Down Lipid transfer protein LTP
TraesCS4A02G021300 -2.323662309 0.001057144 Down Lipid transfer protein LTP
TraesCS4A02G038400 -1.387839823 1.10958E-06 Down Lipid transfer protein LTP
TraesCS4A02G194400 -4.604075831 4.77977E-10 Down Lipid transfer protein LTP
TraesCS4B02G120900 -5.379202934 0.023309308 Down Lipid transfer protein LTP
TraesCS4B02G267300 -1.949879041 0.000426936 Down Lipid transfer protein LTP
TraesCS4B02G282200 -2.161421287 1.24332E-14 Down Lipid transfer protein LTP
TraesCS4B02G393300 -1.559354249 0.009560151 Down Lipid transfer protein LTP
TraesCS4D02G118900 -1.858288856 5.75927E-06 Down Lipid transfer protein LTP
TraesCS4D02G280900 -3.221299196 1.40689E-12 Down Lipid transfer protein LTP
TraesCS5A02G147400 -1.935611612 1.32023E-05 Down Lipid transfer protein LTP
TraesCS5A02G432900 -7.367425942 4.23266E-07 Down Lipid transfer protein LTP
TraesCS5A02G433100 -9.371150500 3.72285E-13 Down Lipid transfer protein LTP
TraesCS5A02G452600 -1.858547112 1.89141E-24 Down Lipid transfer protein LTP
TraesCS5A02G452700 -1.131362528 1.69075E-08 Down Lipid transfer protein LTP
TraesCS5B02G435600 -8.259476523 9.50207E-10 Down Lipid transfer protein LTP
TraesCS5B02G461500 -1.302576502 1.86092E-24 Down Lipid transfer protein LTP
TraesCS5B02G461600 -1.431433115 2.61807E-16 Down Lipid transfer protein LTP
TraesCS5B02G475500 -7.960226035 1.45875E-08 Down Lipid transfer protein LTP
TraesCS5B02G531200 -3.706582677 0.017098014 Down Lipid transfer protein LTP
TraesCS5D02G441000 -8.915256266 1.41401E-11 Down Lipid transfer protein LTP
TraesCS5D02G441100 -7.181789193 1.53221E-06 Down Lipid transfer protein LTP
TraesCS5D02G441300 -6.928025584 6.41884E-06 Down Lipid transfer protein LTP
TraesCS6A02G317403 -1.022388097 0.013458466 Down Lipid transfer protein LTP
TraesCS6B02G287900 -1.686686247 0.0001889 Down Lipid transfer protein LTP
TraesCS7B02G012800 -1.209198548 0.002039311 Down Lipid transfer protein LTP
TraesCS2A02G374100 2.016327129 4.05513E-42 Up ABC transporter G family member ABCG
TraesCS1A02G049600 1.929415020 2.82028E-53 Up ABC transporter G family member ABCG
TraesCS1D02G052000 1.336780895 1.55566E-26 Up ABC transporter G family member ABCG
TraesCS3A02G253700 3.222114018 5.61055E-06 Up ABC transporter G family member ABCG
TraesCS1B02G157900 1.402488596 0.003173131 Up ABC transporter G family-like ABCG
TraesCS4A02G032900 2.837976707 6.35819E-54 Up ABC transporter G family member ABCG
TraesCS4B02G272400 1.868495946 1.28131E-13 Up ABC transporter G family member ABCG
TraesCS4D02G271500 1.837221709 1.80192E-19 Up ABC transporter G family member ABCG
基因编号
Gene ID
倍数变化
log2 (Fold Change)
较正后P
Padj
显著性Significant 相关功能
Related functions
基因符号
Gene symbol
TraesCS5A02G249900 2.876220238 1.68877E-10 Up ABC transporter G family member ABCG
TraesCS5D02G257400 2.625663766 4.32492E-08 Up ABC transporter G family member ABCG
TraesCS5D02G551400 1.095936574 0.030956235 Up ABC transporter G family member ABCG
TraesCSU02G020100 1.559140871 7.14923E-26 Up ABC transporter G family member ABCG
TraesCS1A02G240500 -6.851488645 5.92353E-09 Down ABC transporter G family member ABCG
TraesCS1B02G252600 -3.029383117 6.83811E-18 Down ABC transporter G family member ABCG
TraesCS1D02G240600 -5.721995913 4.73081E-38 Down ABC transporter G family member ABCG
TraesCS2A02G574700 -5.053224917 1.66164E-56 Down ABC transporter G family member ABCG
TraesCS2B02G612200 -3.829770683 2.05699E-05 Down ABC transporter G family member ABCG
TraesCS2D02G585300 -4.601891609 1.09327E-54 Down ABC transporter G family member ABCG
TraesCS7A02G342000 -2.665683554 5.24071E-17 Down ABC transporter G family member ABCG
TraesCS7B02G240900 -3.320006268 1.62018E-18 Down ABC transporter G family member ABCG
TraesCS7D02G337600 -3.617121892 6.74189E-31 Down ABC transporter G family member ABCG
TraesCS4A02G103400 -10.068762360 1.88398E-15 Down ABC transporter G family member ABCG
TraesCS4B02G200600 -10.266524570 3.7264E-16 Down ABC transporter G family member ABCG
TraesCS4D02G201700 -10.695952710 1.12404E-17 Down ABC transporter G family member ABCG
TraesCS5D02G093600 -1.992772146 0.000108446 Down ABC transporter G family member ABCG

Fig. 6

Transcriptional changes of wax genes in glossy1 against Jimai 22"

[1] Sturaro M, Motto M, Hemantaranjan A. Plant cuticular waxes: biosynthesis and functions. Adv Plant Physiol, 2006, 9:229-251.
[2] Yeats T H, Rose J K C. The formation and function of plant cuticles. Plant Physiol, 2013, 163:5-20.
[3] Dehesh K, Tai H, Edwards P, Byrne J, Jaworski J G. Overexpression of 3-ketoacyl-acyl-carrier protein synthase IIIs in plants reduces the rate of lipid synthesis. Plant Physiol, 2001, 125:1103-1114.
[4] Leibundgut M, Jenni S, Frick C, Ban N. Structural basis for substrate delivery by acyl carrier protein in the yeast fatty acid synthase. Science, 2007, 316:288-290.
[5] LiBeisson Y, Shorrosh B, Beisson F, Andersson M X, Arondel V, Bates P D, Baud S, Bird D, DeBono A, Durrett T P. Acyl-lipid metabolism. Arabidopsis Book, 2010, 8:e0133.
[6] Bernard A, Domergue F, Pascal S, Jetter R, Renne C, Faure J D, Haslam R P, Napier J A, Lessire R, Joubès J. Reconstitution of plant alkane biosynthesis in yeast demonstrates that Arabidopsis ECERIFERUM1 and ECERIFERUM3 are core components of a very-long-chain alkane synthesis complex. Plant Cell, 2012, 24:3106-3118.
[7] Owen R, Huanquan Z, Hepworth S R, Patricia L, Reinhard J, Ljerka K. CER4 encodes an alcohol-forming fatty acyl-coenzyme A reductase involved in cuticular wax production in Arabidopsis. Plant Physiol, 2006, 142:866-877.
[8] Wang M, Wang Y, Wu H, Xu J, Li T, Hegebarth D, Jetter R, Chen L, Wang Z. Three TaFAR genes function in the biosynthesis of primary alcohols and the response to abiotic stresses in Triticum aestivum. Sci Rep, 2016, 6:25008.
[9] Tulloch A P. Composition of leaf surface waxes of Triticum species: variation with age and tissue. Phytochemistry, 1973, 12:2225-2232.
[10] Wettstein-Knowles P V, Søgaard B. The cer-cqu region in barley: gene cluster or multifunctional gene. Carlsberg Res Commun, 1980, 45:125-141.
[11] Zhang Z, Wang W, Li W. Genetic interactions underlying the biosynthesis and inhibition of beta-diketones in wheat and their impact on glaucousness and cuticle permeability. PLoS One, 2013, 8:e54129.
[12] Hen-Avivi S, Savin O, Racovita R C, Lee W S, Adamski N M, Malitsky S, Almekias-Siegl E, Levy M, Vautrin S, Berges H, Friedlander G, Kartvelishvily E, Ben-Zvi G, Alkan N, Uauy C, Kanyuka K, Jetter R, Distelfeld A, Aharoni A. A metabolic gene cluster in the wheat W1 and the barley Cer-cquloci determines beta-diketone biosynthesis and glaucousness. Plant Cell, 2016, 28:1440-1460.
[13] Pighin J A, Huanquan Z, Balakshin L J, Goodman I P, Western T L, Reinhard J, Ljerka K, A Lacey S. Plant cuticular lipid export requires an ABC transporter. Science, 2004, 306:702-704.
[14] Debono A, Yeats T H, Rose J K C, Bird D, Jetter R, Kunst L, Samuels L. ArabidopsisLTPG is a glycosylphosphatidylinositol-anchored lipid transfer protein required for export of lipids to the plant surface. Plant Cell, 2009, 21:1230-1238.
[15] Li L, Chai L, Xu H, Zhai H, Wang T, Zhang M, You M, Peng H, Yao Y, Hu Z, Xin M, Guo W, Sun Q, Chen X, Ni Z. Phenotypic characterization of the glossy1 mutant and fine mapping of GLOSSY1 in common wheat(Triticum aestivum L.). Theor Appl Genet, 2021, 134:835-847.
[16] Marioni J C, Mason C E, Mane S M, Stephens M, Gilad Y. RNA-seq: an assessment of technical reproducibility and comparison with gene expression arrays. Genome Res, 2008, 18:1509-1517.
[17] Love M I, Huber W, Anders S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol, 2014, 15:550.
[18] Livak K J, Schmittgen T D. Analysis of relative gene expression data using real-time quantitative PCR and the 2-ΔΔCT method. Methods, 2001, 25:402-408.
[19] Young M D, Wakefield M J, Smyth G K, Oshlack A. Gene ontology analysis for RNA-seq: accounting for selection bias. Genome Biol, 2010, 11:R14.
[20] Chen Y, Song W, Xie X, Wang Z, Guan P, Peng H, Jiao Y, Ni Z, Sun Q, Guo W. A collinearity-incorporating homology inference strategy for connecting emerging assemblies in triticeae tribe as a pilot practice in the plant pangenomic era. Mol Plant, 2020, 13:1694-1708.
[21] Huang D, Feurtado J A, Smith M A, Flatman L K, Koh C, Cutler A J. Long noncoding miRNA gene represses wheat beta- diketone waxes. Proc Natl Acad Sci USA, 2017, 114:E3149-E3158.
[22] Liu Y, Wang H, Jiang Z, Wang W, Xu R, Wang Q, Zhang Z, Li A, Liang Y, Ou S, Liu X, Cao S, Tong H, Wang Y, Zhou F, Liao H, Hu B, Chu C. Genomic basis of geographical adaptation to soil nitrogen in rice. Nature, 2021, 590:600-605.
[23] Li L, Qi Z, Chai L, Chen Z, Wang T, Zhang M, You M, Peng H, Yao Y, Hu Z, Xin M, Guo W, Sun Q, Ni Z. The semidominant mutation w5 impairs epicuticular wax deposition in common wheat(Triticum aestivum L.). Theor Appl Genet, 2020, 133:1213-1225.
[24] Adamski N M, Bush M S, Simmonds J, Turner A S, Mugford S G, Jones A, Findlay K, Pedentchouk N, von Wettstein-Knowles P, Uauy C. The inhibitor of wax 1 locus(Iw1) prevents formation of beta- and OH-beta-diketones in wheat cuticular waxes and maps to a sub-cM interval on chromosome arm 2BS. Plant J, 2013, 74:989-1002.
[25] Bianchi G, Figini M L. Epicuticular waxes of glaucous and nonglaucous durum wheat lines. J Agric Food Chem, 1986, 34:429-433.
[26] Chen G, Komatsuda T, Ma J F, Nawrath C, Pourkheirandish M, Tagiri A, Hu Y G, Sameri M, Li X, Zhao X, Liu Y, Li C, Ma X, Wang A, Nair S, Wang N, Miyao A, Sakuma S, Yamaji N, Zheng X, Nevo E. An ATP-binding cassette subfamily G full transporter is essential for the retention of leaf water in both wild barley and rice. Proc Natl Acad Sci USA, 2011, 108:12354-12359.
[27] Cameron K D, Teece M A, Smart L B. Increased accumulation of cuticular wax and expression of lipid transfer protein in response to periodic drying events in leaves of tree tobacco. Plant Physiol, 2006, 140:176-183.
[1] Zhai Sheng-Nan, Cao Xin-You, Li Hao-Sheng, Li Ji-Hu, Li Fa-Ji, Liu Jin-Dong, Xia Xian-Chun, Lyu Ying-Ying, Ma Rui-Feng, Wang Ying, Geng Hong-Wei, Liu Jian-Jun. Analysis of the genetic effects of allelic variation at the Pod-A1, Pod-D1, and Pod-2D loci on peroxidase activity in wheat grains [J]. Acta Agronomica Sinica, 2026, 52(6): 1593-1603.
[2] Xi Qian-Hui, Xu Zi-Yuan, Liu Meng-Meng, Wang Hong-Yi, Lang Kai-Lin, Jing Zhen-Hai, Chen Feng, Zhao Lei. Genome-wide association study and candidate gene prediction of grain copper content in wheat [J]. Acta Agronomica Sinica, 2026, 52(6): 1604-1617.
[3] Mao Jia-Qi, Huang Peng-Yu, Zhao Jia-Jia, Zheng Xing-Wei, Wu Bang-Bang, Hao Yu-Qiong, Qu Fei, Liu Cheng, Ma Peng-Tao, Zheng Jun. Evaluation of powdery mildew resistance in wheat cultivars and molecular detection of resistance genes in Shanxi province, China [J]. Acta Agronomica Sinica, 2026, 52(6): 1669-1681.
[4] Hu Chuan, Zhao Kai-Nan, Huang Xiu-Li, Wu Jin-Zhi, Ren Kai-Ming, Wang He-Zheng, Fu Guo-Zhan, Huang Ming, Li You-Jun. Effects of tillage methods and nitrogen rates on yield and quality of dryland wheat under one-off irrigation [J]. Acta Agronomica Sinica, 2026, 52(6): 1830-1846.
[5] Chen Xue-Yan, He Hua-Chuan, Li Zheng-Jia, Dong Xin-Pan, Li Ou-Qi, Liu Xiao-Yun, Li Dan-Ping, Chen Zhi-Wei, Liu Guo-Xia, Lyu Sheng-Yuan, Wu Yin-Ying, Zhao Zhen-Dong, Cao Xin-You, Wan He-Ping. Dynamic changes in root organic acid secretion and its transcriptional regulatory mechanisms in ‘Jimai 60’ seedlings under combined salinity-alkalinity stress in hydroponics [J]. Acta Agronomica Sinica, 2026, 52(6): 1859-1875.
[6] Gao Pei-Yang, Li Jin-Xuan, Dong Yu-Kui, Shi Yu, Zhang Zhen, Zhang Yong-Li. Response of wheat tillering and spike formation to nitrogen rate under supplementary irrigation based on soil moisture content [J]. Acta Agronomica Sinica, 2026, 52(6): 1847-1858.
[7] Zhang Xian-Feng, Guo Li-Jian, Li Kang-Chun, Kong Bin-Xue, Liu Yu-Fang, Che Zhuo, Yang De-Long. Identification of the ABHD6 gene family and development of functional markers for grain weight in wheat [J]. Acta Agronomica Sinica, 2026, 52(6): 1711-1727.
[8] Wang Zhuang-Zhuang, Wu Zi-Jun, Zhang Yong-Xin, Zhang Xin-Yuan, Yuan Li-Xue, Chen Ru-Xue, Liu Shi-Ju, Duan Jian-Zhao, Feng Wei, Wang Tong-Chao, Wang Yong-Hua. Optimized water-nitrogen synergy enhances winter wheat yield and nitrogen use efficiency in clay-loam fluvo-aquic soils of southeastern Henan, China [J]. Acta Agronomica Sinica, 2026, 52(5): 1501-1521.
[9] He Wan-Long, Geng Hong-Wei, Zhang Fei-Fei, Mikereayi·Ababaikere , Luo Zi-Yang, Li Peng-Cheng, Zhou Zhao-Yu, Cheng Yu-Kun. Development of a deep learning-based image recognition system for major wheat diseases [J]. Acta Agronomica Sinica, 2026, 52(5): 1401-1417.
[10] Han Ya-Xin, He Guan-Hua, Zhang Xiao-Qiong, Zhang Deng-Feng, Li Yong-Xiang, Liu Xu-Yang, Wang Tian-Yu, Li Yu, Zou Hua-Wen, Li Chun-Hui. Identification of maize lateral root density genes resources through integrated RNA-seq and BSA-seq analyses [J]. Acta Agronomica Sinica, 2026, 52(5): 1341-1352.
[11] Zhang Zhen, Feng Lian-Jie, Shi Yu, Yu Zhen-Wen, Zhang Yong-Li. Yield formation of wheat with different ear types under water-saving supplementary irrigation conditions [J]. Acta Agronomica Sinica, 2026, 52(5): 1522-1535.
[12] Hou Si-Yu, Wang Guo-Cui, Wei Jin-Gui, Xie Wei-Xin, Yin Wen, Fan Zhi-Long, Chai Qiang, Hu Fa-Long. Effects of green manure combined with chemical nitrogen fertilizer on dry matter accumulation and yield formation of wheat in arid irrigation areas of northwestern China [J]. Acta Agronomica Sinica, 2026, 52(4): 1208-1219.
[13] Shang Yun-Qiu, Zhao Zhu, Chen Huan, Ding Yong-Gang, Qiao Yu-Qiang, Li Wei, Zhang Xiang-Qian, Cao Cheng-Fu, Du Shi-Zhou. Effects of long-term tillage practices on grain-filling and yield formation in rain-fed wheat [J]. Acta Agronomica Sinica, 2026, 52(4): 1236-1250.
[14] Yang Ying, Hao Yu-Wan, Zhang Xue-Ning, Fang Jia-Lu, Ma Yue-Hua, Yang Wei-Long, Sun Wen-Qing, Wang Xin-Chao, Wang Yu-Chun, Huang Jian-Yan. Molecular mechanism of CsERF9-mediated regulation of anthracnose resistance in tea plant [J]. Acta Agronomica Sinica, 2026, 52(4): 1103-1115.
[15] Qiao Yu-Xin, Li Cheng-Yue, Kang Xiao-Yu, Zhang Xin-Qi, Jia Shao-Hui, Liu Qian, Cao Ya-Li, Shi Xin-Rui, Hao Xing-Yu, Li Ping. Study on the effects of long-term no-tillage straw mulching on wheat yield improvement in dryland areas based on the APSIM model [J]. Acta Agronomica Sinica, 2026, 52(4): 1181-1192.
Viewed
Full text


Abstract

Cited

  Shared   
  Discussed   
No Suggested Reading articles found!