Welcome to Acta Agronomica Sinica，

Acta Agronomica Sinica ›› 2018, Vol. 44 ›› Issue (02): 185-196.doi: 10.3724/SP.J.1006.2018.00185

• Orginal Article • Previous Articles     Next Articles

An R2R3-MYB Transcription Factor GmMYB184 Regulates Soybean Isoflavone Synthesis

Ying ZHU1,**, Shan-Shan CHU2,**, Pei-Pei ZHANG1, Hao CHENG1, De-Yue YU1, Jiao WANG1,*   

  1. 1 Soybean Research Institute / National Key Laboratory of Crop Genetics and Germplasm Enhancement / Jiangsu Collaborative Innovation Center for Modern Crop Production / National Center for Soybean Improvement, Nanjing Agricultural University, Nanjing 210095, Jiangsu, China
    2 Collaborative Innovation Center of Henan Grain Crops / Department of Agronomy, Henan Agricultural University, Zhengzhou 450002, Henan, China
  • Received:2017-05-15 Accepted:2017-09-10 Online:2018-02-12 Published:2017-10-27
  • Contact: Ying ZHU,Shan-Shan CHU,Jiao WANG
  • Supported by:
    This study was supported by National Key R&D Program for Crop Breeding (2016YFD0100304, 2016YFD0100504), the National Natural Science Foundation of China (31301342, 31370034), and China Postdoctoral Science Foundation (2017M612400).

RichHTML319

18

PDF

759

Abstract:

Isoflavones comprise a group of secondary metabolites produced almost exclusively by plants in the legume family, including soybean [Glycine max (L.) Merr.]. They play vital roles in plant defense and have many beneficial effects on human health. Isoflavone content is controlled by multiple genes and complex metabolic networks. The modification of certain structural genes in the isoflavone pathway by genetic engineering has been unable to significantly improve isoflavone content. The identification and application of transcription factors specific to the isoflavone pathway may effectively resolve this problem. An R2R3-type transcription factor related to isoflavone content, GmMYB184, was cloned and its function was identified. Subcellular localization study confirmed the nuclear localization of GmMYB184. The expression profile of GmMYB184 was similar to that of IFS2 (isoflavone synthase 2), which was consistent with the isoflavone accumulation pattern. In addition, GmMYB184 and IFS2 mainly expressed in roots and mature seeds, and the expression level increased by seeds maturing. Glutathione (GSH) induction expression analysis showed that both GmMYB184 and IFS2 were induced by GSH, indicating they could be involved in similar biological processes. To examine whether GmMYB184 could regulate the expression of isoflavone biosynthesis-related genes, a dual luciferase reporter gene assay was performed, showing that GmMYB184 could increase the expression of IFS2 and CHS8 (chalcone synthase 8) to five and seven folds, respectively. Finally, to further verify the function of GmMYB184 during isoflavone biosynthesis, we constructed and then transformed overexpression vector and RNAi vector for GmMYB184 to soybean hairy roots respectively. RNAi silencing of GmMYB184 in hairy roots resulted in reduction of isoflavones. However, overexpression of GmMYB184 was not sufficient to increase isoflavone contents in hairy roots. Taken together, these results provide a theoretical foundation for the molecule mechanism explanation and genetic improvement of isoflavone content in soybean.

Key words: soybean, isoflavone content, GmMYB184, transcription factor, functional identification

Table 1

Primer sequences"

引物用途
Purpose of primer		 引物名称
Primer name		 引物序列
Primer sequence (5'-3')
荧光定量PCR引物序列 MYB184-QF TTTTGGAATAACCAAAAGTCC
RT-PCR primer sequences MYB184-QR CTGCATTCGGCATTCCGATT
IFS2-QF ATGAAGTATATAAGCCCTTC
IFS2-QR TTGGGATAAATGATGTGGCAACT
Tubulin-F GGAGTTCACAGAGGCAGAG
Tubulin-R CACTTACGCATCACATAGCA
启动子序列扩增引物 IFS2-F TTCCATCACTGTATGAAAGTC
Promoter amplification primers IFS2-R CGTGTTCTCGTCCTTGGTTTG
CHS8-F CGAGCTCTGAGCAAGTATACCAACCAT
CHS8-R CGGACTAGTCTTTCCTTCAAATTAAGTGAT

Fig. 1

Diagram for dual luciferase report system"

Fig. 2

Amplification result for GmMYB184 M: DNA marker DL2000; MYB184: cDNA of GmMYB184."

Fig. 3

Sequence alignment for stress responsive R2R3-MYB transcription factors Multiple alignment of putative stress responsive R2R3-MYB transcript factors in various plant species: Arabidopsis thaliana (AtMYB2, AtMYB62, AtMYB78, AtMYB108, AtMYB112, AtMYB116), Lotus japonicas (LjMYB62, LjMYB116), Medicago truncatula (Medtr1g086530, Medtr1g086510, Medtr2g033170), and Glycine max (GmMYB184, GmMYB84)."

Fig. 4

Phylogenetic analysis for stress responsive R2R3-MYB transcription factors"

Fig. 5

Relative expression levels of GmMYB184 and IFS2, and isoflavone contents in different tissues at different developing stages of soybean seed A: relative expression levels of GmMYB184 in different tissues of soybean; B: relative expression levels of IFS2 in different tissues of soybean; C: isoflavone contents in different tissues of soybean; D: relative expression levels of GmMYB184 in different developing stages of soybean seed; E: relative expression levels of IFS2 in different developing stages of soybean seed; F: isoflavone contents in different developing stages of soybean seed."

Fig. 6

GSH induced expression pattern of GmMYB184 and IFS2"

Fig. 7

Subcellular localization analysis of GmMYB184 A: expression of 35S::GFP in Arabidopsis protoplasts; B: expression of GmMYB184::GFP in Arabidopsis protoplasts."

Fig. 8

GmMYB184 induce the promoter activity of IFS2 and CHS8 A: GmMYB184 induces the promoter activity of IFS2; B: GmMYB184 induces the promoter activity of CHS8."

Fig. 9

Relative expression levels of RNAi and over expression of GmMYB184 in hairy roots A: relative expression levels of RNAi of GmMYB184 in hairy roots; B: relative expression levels of over expression of GmMYB184 in hairy roots. ** and *** represent the relative expression levels of GmMYB184 between the transgenic lines and control lines were significantly different at the 0.01 and 0.001 probability levels, respectively."

Fig. 10

Relative isoflavone contents of RNAi and over expression of GmMYB184 in hairy roots A: relative isoflavone contents of RNAi of GmMYB184 in hairy roots; B: relative isoflavone contents of over expression of GmMYB184 in hairy roots. ** represents the relative expression levels of GmMYB184 between the transgenic lines and control lines were significantly different at the 0.01 probability level."

[1] Yu O, McGonigle B. Metabolic engineering of isoflavone biosynthesis.Adv Agron 2005, 86: 147-190
[2] Cederroth C R, Nef S.Soy, phytoestrogens and metabolism: a review.Mol Cell Endocrinol 2009, 304: 30-42
[3] Rochfort S, Panozzo J.Phytochemicals for health, the role of pulses. J Agric Food Chem 2007, 55: 7981-7994
[4] Dixon R A.Natural products and plant disease resistance.Nature 2001, 411: 843-847
[5] Graham T L, Graham M Y.Signaling in soybean phenylpropanoid responses (dissection of primary, secondary, and conditioning effects of light, wounding, and elicitor treatments). Plant Physiol, 1996, 110: 1123-1133
[6] Hammerschmidt R.PHYTOALEXINS: what have we learned after 60 years? Annu Rev Phytopathol, 1999, 37: 285-306
[7] Gutierrez-Gonzalez J J, Wu X, Gillman J D, Lee J D, Zhong R, Yu O, Shannon G, Ellersieck M, Nguyen H T, Sleper D A. Intricate environment-modulated genetic networks control isoflavone accumulation in soybean seeds.BMC Plant Biol, 2010, 10: 105
[8] Dixon R A, Steele C L.Flavonoids and isoflavonoids: a gold mine for metabolic engineering.Trends Plant Sci, 1999, 4: 394-400
[9] Zernova O V, Lygin A V, Widholm J M, Lozovaya V V.Modification of isoflavones in soybean seeds via expression of multiple phenolic biosynthetic genes.Plant Physiol Biochem, 2009, 47: 769-777
[10] 易金鑫, 徐照龙, 王峻峰, 张大勇, 何晓兰, 朱虹润, 马鸿翔. GmCHS8和GmIFS2基因共同决定大豆中异黄酮的积累. 作物学报, 2011, 37: 571-578
Yi J X, Xu Z L, Wang J F, Zhang D Y, He X L, Zhu H R, Ma H X.TheGmCHS8 and GmIFS2 genes together determine the accumulation of isoflavones in soybeans. Acta Agron Sin, 2011, 37: 571-578 (in Chinese with English abstract)
[11] Butelli E, Titta L, Giorgio M, Mock H P, Matros A, Peterek S, Schijlen E G, Hall R D, Bovy A G, Luo J, Martin, C.Enrichment of tomato fruit with health-promoting anthocyanins by expression of select transcription factors. Nat Biotechnol, 2008, 26: 1301-1308
[12] Cutanda-Perez M C, Ageorges A, Gomez C, Vialet S, Terrier N, Romieu C, Torregrosa L. Ectopic expression ofVlmybA1 in grapevine activates a narrow set of genes involved in anthocyanin synthesis and transport. Plant Mol Biol, 2009, 69: 633-648
[13] Hichri I, Barrieu F, Bogs J, Kappel C, Delrot S, Lauvergeat V.Recent advances in the transcriptional regulation of the flavonoid biosynthetic pathway.J Exp Bot, 2011, 62: 2465-2483
[14] Zhou M L, Hou H L, Zhu X M, Shao J R, Wu Y M, Tang Y X.Soybean transcription factor GmMYBZ2 represses catharanthine biosynthesis in hairy roots of Catharanthus roseus. Appl Microbiol Biotechnol, 2011, 91: 1095-1105
[15] Chen Y H, Yang X Y, He K, Liu M H, Li J G, Gao Z F, Lin Z Q, Zhang Y F, Wang X X, Qiu X M, Shen Y P, Zhang L, Deng X H, Luo J C, Deng X W, Chen Z L, Gu H Y, Qu L J.The MYB transcription factor superfamily ofArabidopsis: expression analysis and phylogenetic comparison with the rice MYB family. Plant Mol Biol, 2006, 60: 107-124
[16] Jin H, Martin C.Multifunctionality and diversity within the plant MYB-gene family.Plant Mol Biol, 1999, 41: 577-585
[17] Stracke R, Werber M, Weisshaar B.The R2R3-MYB gene family in Arabidopsis thaliana. Curr Opin Plant Biol, 2001, 4: 447-456
[18] Du H, Yang S S, Liang Z, Feng B R, Liu L, Huang Y B, Tang Y X.Genome-wide analysis of the MYB transcription factor superfamily in soybean.BMC Plant Biol, 2012, 12: 106
[19] Chu S, Wang J, Zhu Y, Liu S, Zhou X, Zhang H, Wang C E, Yang W, Tian Z, Cheng H, Yu D Y.An R2R3-type MYB transcription factor, GmMYB29, regulates isoflavone biosynthesis in soybean.PLoS Genet, 2017, 13: e1006770
[20] Liu X, Yuan L, Xu L, Xu Z, Huang Y, He X, Ma H, Yi J, Zhang D.Over-expression ofGmMYB39 leads to an inhibition of the isoflavonoid biosynthesis in soybean(Glycine max L.). Plant Biotechnol Rep, 2013, 7: 445-455
[21] Yan J, Wang B, Zhong Y, Yao L, Cheng L, Wu T.The soybean R2R3 MYB transcription factorGmMYB100 negatively regulates plant flavonoid biosynthesis. Plant Mol Biol, 2015, 89: 35-48
[22] Robbins M P, Hartnoll J, Morris P.Phenylpropanoid defence responses in transgenicLotus corniculatus 1. Glutathione elicitation of isoflavan phytoalexins in transformed root cultures. Plant Cell Rep, 1991, 10: 59-62
[23] Shelton D, Stranne M, Mikkelsen L, Pakseresht N, Welham T, Hiraka H, Tabata S, Sato S, Paquette S, Wang T L, Martin C, Bailey P.Transcription factors of Lotus: regulation of isoflavonoid biosynthesis requires coordinated changes in transcription factor activity.Plant Physiol, 2012, 159: 531-547
[24] Dubos C, Stracke R, Grotewold E, Weisshaar B, Martin C, Lepiniec L.MYB transcription factors in Arabidopsis.Trends Plant Sci, 2010, 15: 573-581
[25] Higgins D G, Thompson J D, Gibson T J.Using CLUSTAL for multiple sequence alignments.Method Enzymol, 1996, 266: 383-402
[26] Tamura K, Stecher G, Peterson D, Filipski A, Kumar S.MEGA6: Molecular Evolutionary Genetics Analysis version 6.0.Mol Biol Evol, 2013, 30: 2725-2729
[27] Livak K J, Schmittgen T D.Analysis of relative gene expression data using real-time quantitative PCR and the 2(-delta delta C(T)) method.Methods, 2001, 25: 402-408
[28] Sun J M, Sun B L, Han F X, Yan S R, Yang H, Kikuchi A.Rapid HPLC method for determination of 12 isoflavone components in soybean seeds.Agric Sci China, 2011, 10: 70-77
[29] Chung E S, Kim K M, Lee J H.Molecular cloning and characterization of a soybeanGmMBY184 induced by abiotic stresses. J Plant Biotechnol, 2012, 39: 175-181
[30] Ishida T, Kurata T, Okada K, Wada T.A genetic regulatory network in the development of trichomes and root hairs.Annu Review Plant Biol, 2008, 59: 365-386
[31] Nadeau J A.Stomatal development: new signals and fate determinants.Curr Opin Plant Biol, 2009, 12: 29-35
[32] Wang X, Niu Q W, Teng C, Li C, Mu J, Chua N H, Zuo J.Overexpression ofPGA37/MYB118 and MYB115 promotes vegetative-to-embryonic transition in Arabidopsis. Cell Res, 2009, 19: 224-235
[33] Muller D, Schmitz G, Theres K.Blind homologous R2R3 Myb genes control the pattern of lateral meristem initiation in Arabidopsis. Plant Cell, 2006, 18: 586-597
[34] Mu R L, Cao Y R, Liu Y F, Lei G, Zou H F, Liao Y, Wang H W, Zhang W K, Ma B, Du J Z, Yuan M, Zhang J S, Chen S Y.An R2R3-type transcription factor geneAtMYB59 regulates root growth and cell cycle progression in Arabidopsis. Cell Res, 2009, 19: 1291-1304
[35] Abe H, Yamaguchi-Shinozaki K, Urao T, Iwasaki T, Hosokawa D, Shinozaki K.Role of Arabidopsis MYC and MYB homologs in drought- and abscisic acid-regulated gene expression.Plant Cell, 1997, 9: 1859-1868
[36] Mengiste T, Chen X, Salmeron J, Dietrich R.TheBOTRYTIS SUSCEPTIBLE1 gene encodes an R2R3MYB transcription factor protein that is required for biotic and abiotic stress responses in Arabidopsis. Plant Cell, 2003, 15: 2551-2565
[37] Borevitz J O, Xia Y, Blount J, Dixon R A, Lamb C.Activation tagging identifies a conserved MYB regulator of phenylpropanoid biosynthesis.Plant Cell, 2000, 12: 2383-2394
[38] Sablowski R W, Moyano E, Culianez-Macia F A, Schuch W, Martin C, Bevan M. A flower-specific Myb protein activates transcription of phenylpropanoid biosynthetic genes.EMBO J, 1994, 13: 128-137
[39] Solano R, Nieto C, Avila J, Canas L, Diaz I, Paz-Ares J.Dual DNA binding specificity of a petal epidermis-specific MYB transcription factor (MYB.Ph3) fromPetunia hybrida. EMBO J, 1995, 14: 1773-1784
[40] Yu O, Shi J, Hession A O, Maxwell C A, McGonigle B, Odell J T. Metabolic engineering to increase isoflavone biosynthesis in soybean seed.Phytochemistry, 2003, 63: 753-763
[41] Grotewold E, Chamberlin M, Snook M, Siame B, Butler L, Swenson J, Maddock S, St Clair G, Bowen B.Engineering secondary metabolism in maize cells by ectopic expression of transcription factors.Plant Cell, 1998, 10: 721-740
[42] Holl J, Vannozzi A, Czemmel S, D'Onofrio C, Walker A R, Rausch T, Lucchin M, Boss P K, Dry I B, Bogs J. The R2R3-MYB transcription factors MYB14 and MYB15 regulate stilbene biosynthesis inVitis vinifera. Plant Cell, 2013, 25: 4135-4149
[43] Dhaubhadel S, Gijzen M, Moy P, Farhangkhoee M.Transcriptome analysis reveals a critical role ofCHS7 and CHS8 genes for isoflavonoid synthesis in soybean seeds. Plant Physiol, 2007, 143: 326-338
[1] CHEN Ling-Ling, LI Zhan, LIU Ting-Xuan, GU Yong-Zhe, SONG Jian, WANG Jun, QIU Li-Juan. Genome wide association analysis of petiole angle based on 783 soybean resources (Glycine max L.) [J]. Acta Agronomica Sinica, 2022, 48(6): 1333-1345.
[2] YANG Huan, ZHOU Ying, CHEN Ping, DU Qing, ZHENG Ben-Chuan, PU Tian, WEN Jing, YANG Wen-Yu, YONG Tai-Wen. Effects of nutrient uptake and utilization on yield of maize-legume strip intercropping system [J]. Acta Agronomica Sinica, 2022, 48(6): 1476-1487.
[3] YU Chun-Miao, ZHANG Yong, WANG Hao-Rang, YANG Xing-Yong, DONG Quan-Zhong, XUE Hong, ZHANG Ming-Ming, LI Wei-Wei, WANG Lei, HU Kai-Feng, GU Yong-Zhe, QIU Li-Juan. Construction of a high density genetic map between cultivated and semi-wild soybeans and identification of QTLs for plant height [J]. Acta Agronomica Sinica, 2022, 48(5): 1091-1102.
[4] LI A-Li, FENG Ya-Nan, LI Ping, ZHANG Dong-Sheng, ZONG Yu-Zheng, LIN Wen, HAO Xing-Yu. Transcriptome analysis of leaves responses to elevated CO2 concentration, drought and interaction conditions in soybean [Glycine max (Linn.) Merr.] [J]. Acta Agronomica Sinica, 2022, 48(5): 1103-1118.
[5] ZHU Zheng, WANG Tian-Xing-Zi, CHEN Yue, LIU Yu-Qing, YAN Gao-Wei, XU Shan, MA Jin-Jiao, DOU Shi-Juan, LI Li-Yun, LIU Guo-Zhen. Rice transcription factor WRKY68 plays a positive role in Xa21-mediated resistance to Xanthomonas oryzae pv. oryzae [J]. Acta Agronomica Sinica, 2022, 48(5): 1129-1140.
[6] PENG Xi-Hong, CHEN Ping, DU Qing, YANG Xue-Li, REN Jun-Bo, ZHENG Ben-Chuan, LUO Kai, XIE Chen, LEI Lu, YONG Tai-Wen, YANG Wen-Yu. Effects of reduced nitrogen application on soil aeration and root nodule growth of relay strip intercropping soybean [J]. Acta Agronomica Sinica, 2022, 48(5): 1199-1209.
[7] CHEN Yue, SUN Ming-Zhe, JIA Bo-Wei, LENG Yue, SUN Xiao-Li. Research progress regarding the function and mechanism of rice AP2/ERF transcription factor in stress response [J]. Acta Agronomica Sinica, 2022, 48(4): 781-790.
[8] WANG Hao-Rang, ZHANG Yong, YU Chun-Miao, DONG Quan-Zhong, LI Wei-Wei, HU Kai-Feng, ZHANG Ming-Ming, XUE Hong, YANG Meng-Ping, SONG Ji-Ling, WANG Lei, YANG Xing-Yong, QIU Li-Juan. Fine mapping of yellow-green leaf gene (ygl2) in soybean (Glycine max L.) [J]. Acta Agronomica Sinica, 2022, 48(4): 791-800.
[9] LI Rui-Dong, YIN Yang-Yang, SONG Wen-Wen, WU Ting-Ting, SUN Shi, HAN Tian-Fu, XU Cai-Long, WU Cun-Xiang, HU Shui-Xiu. Effects of close planting densities on assimilate accumulation and yield of soybean with different plant branching types [J]. Acta Agronomica Sinica, 2022, 48(4): 942-951.
[10] DU Hao, CHENG Yu-Han, LI Tai, HOU Zhi-Hong, LI Yong-Li, NAN Hai-Yang, DONG Li-Dong, LIU Bao-Hui, CHENG Qun. Improving seed number per pod of soybean by molecular breeding based on Ln locus [J]. Acta Agronomica Sinica, 2022, 48(3): 565-571.
[11] ZHOU Yue, ZHAO Zhi-Hua, ZHANG Hong-Ning, KONG You-Bin. Cloning and functional analysis of the promoter of purple acid phosphatase gene GmPAP14 in soybean [J]. Acta Agronomica Sinica, 2022, 48(3): 590-596.
[12] WANG Juan, ZHANG Yan-Wei, JIAO Zhu-Jin, LIU Pan-Pan, CHANG Wei. Identification of QTLs and candidate genes for 100-seed weight trait using PyBSASeq algorithm in soybean [J]. Acta Agronomica Sinica, 2022, 48(3): 635-643.
[13] ZHANG Guo-Wei, LI Kai, LI Si-Jia, WANG Xiao-Jing, YANG Chang-Qin, LIU Rui-Xian. Effects of sink-limiting treatments on leaf carbon metabolism in soybean [J]. Acta Agronomica Sinica, 2022, 48(2): 529-537.
[14] YU Tao-Bing, SHI Qi-Han, NIAN-Hai , LIAN Teng-Xiang. Effects of waterlogging on rhizosphere microorganisms communities of different soybean varieties [J]. Acta Agronomica Sinica, 2021, 47(9): 1690-1702.
[15] SONG Li-Jun, NIE Xiao-Yu, HE Lei-Lei, KUAI Jie, YANG Hua, GUO An-Guo, HUANG Jun-Sheng, FU Ting-Dong, WANG Bo, ZHOU Guang-Sheng. Screening and comprehensive evaluation of shade tolerance of forage soybean varieties [J]. Acta Agronomica Sinica, 2021, 47(9): 1741-1752.
Viewed
Full text


Abstract

Cited
  Shared   
  Discussed   
No Suggested Reading articles found!
Add: No. 80 Xueyuan South Rd, Beijing 100081, P. R. China E-mail: zwxb301@caas.cn
Supported by Beijing Magtech Co.Ltd