Welcome to Acta Agronomica Sinica，

Acta Agronomica Sinica ›› 2018, Vol. 44 ›› Issue (02): 185-196.doi: 10.3724/SP.J.1006.2018.00185

• Orginal Article • Previous Articles     Next Articles

An R2R3-MYB Transcription Factor GmMYB184 Regulates Soybean Isoflavone Synthesis

Ying ZHU1,**, Shan-Shan CHU2,**, Pei-Pei ZHANG1, Hao CHENG1, De-Yue YU1, Jiao WANG1,*   

  1. 1 Soybean Research Institute / National Key Laboratory of Crop Genetics and Germplasm Enhancement / Jiangsu Collaborative Innovation Center for Modern Crop Production / National Center for Soybean Improvement, Nanjing Agricultural University, Nanjing 210095, Jiangsu, China
    2 Collaborative Innovation Center of Henan Grain Crops / Department of Agronomy, Henan Agricultural University, Zhengzhou 450002, Henan, China
  • Received:2017-05-15 Accepted:2017-09-10 Online:2018-02-12 Published:2017-10-27
  • Contact: Ying ZHU,Shan-Shan CHU,Jiao WANG
  • Supported by:
    This study was supported by National Key R&D Program for Crop Breeding (2016YFD0100304, 2016YFD0100504), the National Natural Science Foundation of China (31301342, 31370034), and China Postdoctoral Science Foundation (2017M612400).

RichHTML319

25

PDF

965

Abstract:

Isoflavones comprise a group of secondary metabolites produced almost exclusively by plants in the legume family, including soybean [Glycine max (L.) Merr.]. They play vital roles in plant defense and have many beneficial effects on human health. Isoflavone content is controlled by multiple genes and complex metabolic networks. The modification of certain structural genes in the isoflavone pathway by genetic engineering has been unable to significantly improve isoflavone content. The identification and application of transcription factors specific to the isoflavone pathway may effectively resolve this problem. An R2R3-type transcription factor related to isoflavone content, GmMYB184, was cloned and its function was identified. Subcellular localization study confirmed the nuclear localization of GmMYB184. The expression profile of GmMYB184 was similar to that of IFS2 (isoflavone synthase 2), which was consistent with the isoflavone accumulation pattern. In addition, GmMYB184 and IFS2 mainly expressed in roots and mature seeds, and the expression level increased by seeds maturing. Glutathione (GSH) induction expression analysis showed that both GmMYB184 and IFS2 were induced by GSH, indicating they could be involved in similar biological processes. To examine whether GmMYB184 could regulate the expression of isoflavone biosynthesis-related genes, a dual luciferase reporter gene assay was performed, showing that GmMYB184 could increase the expression of IFS2 and CHS8 (chalcone synthase 8) to five and seven folds, respectively. Finally, to further verify the function of GmMYB184 during isoflavone biosynthesis, we constructed and then transformed overexpression vector and RNAi vector for GmMYB184 to soybean hairy roots respectively. RNAi silencing of GmMYB184 in hairy roots resulted in reduction of isoflavones. However, overexpression of GmMYB184 was not sufficient to increase isoflavone contents in hairy roots. Taken together, these results provide a theoretical foundation for the molecule mechanism explanation and genetic improvement of isoflavone content in soybean.

Key words: soybean, isoflavone content, GmMYB184, transcription factor, functional identification

Table 1

Primer sequences"

引物用途
Purpose of primer		 引物名称
Primer name		 引物序列
Primer sequence (5'-3')
荧光定量PCR引物序列 MYB184-QF TTTTGGAATAACCAAAAGTCC
RT-PCR primer sequences MYB184-QR CTGCATTCGGCATTCCGATT
IFS2-QF ATGAAGTATATAAGCCCTTC
IFS2-QR TTGGGATAAATGATGTGGCAACT
Tubulin-F GGAGTTCACAGAGGCAGAG
Tubulin-R CACTTACGCATCACATAGCA
启动子序列扩增引物 IFS2-F TTCCATCACTGTATGAAAGTC
Promoter amplification primers IFS2-R CGTGTTCTCGTCCTTGGTTTG
CHS8-F CGAGCTCTGAGCAAGTATACCAACCAT
CHS8-R CGGACTAGTCTTTCCTTCAAATTAAGTGAT

Fig. 1

Diagram for dual luciferase report system"

Fig. 2

Amplification result for GmMYB184 M: DNA marker DL2000; MYB184: cDNA of GmMYB184."

Fig. 3

Sequence alignment for stress responsive R2R3-MYB transcription factors Multiple alignment of putative stress responsive R2R3-MYB transcript factors in various plant species: Arabidopsis thaliana (AtMYB2, AtMYB62, AtMYB78, AtMYB108, AtMYB112, AtMYB116), Lotus japonicas (LjMYB62, LjMYB116), Medicago truncatula (Medtr1g086530, Medtr1g086510, Medtr2g033170), and Glycine max (GmMYB184, GmMYB84)."

Fig. 4

Phylogenetic analysis for stress responsive R2R3-MYB transcription factors"

Fig. 5

Relative expression levels of GmMYB184 and IFS2, and isoflavone contents in different tissues at different developing stages of soybean seed A: relative expression levels of GmMYB184 in different tissues of soybean; B: relative expression levels of IFS2 in different tissues of soybean; C: isoflavone contents in different tissues of soybean; D: relative expression levels of GmMYB184 in different developing stages of soybean seed; E: relative expression levels of IFS2 in different developing stages of soybean seed; F: isoflavone contents in different developing stages of soybean seed."

Fig. 6

GSH induced expression pattern of GmMYB184 and IFS2"

Fig. 7

Subcellular localization analysis of GmMYB184 A: expression of 35S::GFP in Arabidopsis protoplasts; B: expression of GmMYB184::GFP in Arabidopsis protoplasts."

Fig. 8

GmMYB184 induce the promoter activity of IFS2 and CHS8 A: GmMYB184 induces the promoter activity of IFS2; B: GmMYB184 induces the promoter activity of CHS8."

Fig. 9

Relative expression levels of RNAi and over expression of GmMYB184 in hairy roots A: relative expression levels of RNAi of GmMYB184 in hairy roots; B: relative expression levels of over expression of GmMYB184 in hairy roots. ** and *** represent the relative expression levels of GmMYB184 between the transgenic lines and control lines were significantly different at the 0.01 and 0.001 probability levels, respectively."

Fig. 10

Relative isoflavone contents of RNAi and over expression of GmMYB184 in hairy roots A: relative isoflavone contents of RNAi of GmMYB184 in hairy roots; B: relative isoflavone contents of over expression of GmMYB184 in hairy roots. ** represents the relative expression levels of GmMYB184 between the transgenic lines and control lines were significantly different at the 0.01 probability level."

[1] Yu O, McGonigle B. Metabolic engineering of isoflavone biosynthesis.Adv Agron 2005, 86: 147-190
[2] Cederroth C R, Nef S.Soy, phytoestrogens and metabolism: a review.Mol Cell Endocrinol 2009, 304: 30-42
[3] Rochfort S, Panozzo J.Phytochemicals for health, the role of pulses. J Agric Food Chem 2007, 55: 7981-7994
[4] Dixon R A.Natural products and plant disease resistance.Nature 2001, 411: 843-847
[5] Graham T L, Graham M Y.Signaling in soybean phenylpropanoid responses (dissection of primary, secondary, and conditioning effects of light, wounding, and elicitor treatments). Plant Physiol, 1996, 110: 1123-1133
[6] Hammerschmidt R.PHYTOALEXINS: what have we learned after 60 years? Annu Rev Phytopathol, 1999, 37: 285-306
[7] Gutierrez-Gonzalez J J, Wu X, Gillman J D, Lee J D, Zhong R, Yu O, Shannon G, Ellersieck M, Nguyen H T, Sleper D A. Intricate environment-modulated genetic networks control isoflavone accumulation in soybean seeds.BMC Plant Biol, 2010, 10: 105
[8] Dixon R A, Steele C L.Flavonoids and isoflavonoids: a gold mine for metabolic engineering.Trends Plant Sci, 1999, 4: 394-400
[9] Zernova O V, Lygin A V, Widholm J M, Lozovaya V V.Modification of isoflavones in soybean seeds via expression of multiple phenolic biosynthetic genes.Plant Physiol Biochem, 2009, 47: 769-777
[10] 易金鑫, 徐照龙, 王峻峰, 张大勇, 何晓兰, 朱虹润, 马鸿翔. GmCHS8和GmIFS2基因共同决定大豆中异黄酮的积累. 作物学报, 2011, 37: 571-578
Yi J X, Xu Z L, Wang J F, Zhang D Y, He X L, Zhu H R, Ma H X.TheGmCHS8 and GmIFS2 genes together determine the accumulation of isoflavones in soybeans. Acta Agron Sin, 2011, 37: 571-578 (in Chinese with English abstract)
[11] Butelli E, Titta L, Giorgio M, Mock H P, Matros A, Peterek S, Schijlen E G, Hall R D, Bovy A G, Luo J, Martin, C.Enrichment of tomato fruit with health-promoting anthocyanins by expression of select transcription factors. Nat Biotechnol, 2008, 26: 1301-1308
[12] Cutanda-Perez M C, Ageorges A, Gomez C, Vialet S, Terrier N, Romieu C, Torregrosa L. Ectopic expression ofVlmybA1 in grapevine activates a narrow set of genes involved in anthocyanin synthesis and transport. Plant Mol Biol, 2009, 69: 633-648
[13] Hichri I, Barrieu F, Bogs J, Kappel C, Delrot S, Lauvergeat V.Recent advances in the transcriptional regulation of the flavonoid biosynthetic pathway.J Exp Bot, 2011, 62: 2465-2483
[14] Zhou M L, Hou H L, Zhu X M, Shao J R, Wu Y M, Tang Y X.Soybean transcription factor GmMYBZ2 represses catharanthine biosynthesis in hairy roots of Catharanthus roseus. Appl Microbiol Biotechnol, 2011, 91: 1095-1105
[15] Chen Y H, Yang X Y, He K, Liu M H, Li J G, Gao Z F, Lin Z Q, Zhang Y F, Wang X X, Qiu X M, Shen Y P, Zhang L, Deng X H, Luo J C, Deng X W, Chen Z L, Gu H Y, Qu L J.The MYB transcription factor superfamily ofArabidopsis: expression analysis and phylogenetic comparison with the rice MYB family. Plant Mol Biol, 2006, 60: 107-124
[16] Jin H, Martin C.Multifunctionality and diversity within the plant MYB-gene family.Plant Mol Biol, 1999, 41: 577-585
[17] Stracke R, Werber M, Weisshaar B.The R2R3-MYB gene family in Arabidopsis thaliana. Curr Opin Plant Biol, 2001, 4: 447-456
[18] Du H, Yang S S, Liang Z, Feng B R, Liu L, Huang Y B, Tang Y X.Genome-wide analysis of the MYB transcription factor superfamily in soybean.BMC Plant Biol, 2012, 12: 106
[19] Chu S, Wang J, Zhu Y, Liu S, Zhou X, Zhang H, Wang C E, Yang W, Tian Z, Cheng H, Yu D Y.An R2R3-type MYB transcription factor, GmMYB29, regulates isoflavone biosynthesis in soybean.PLoS Genet, 2017, 13: e1006770
[20] Liu X, Yuan L, Xu L, Xu Z, Huang Y, He X, Ma H, Yi J, Zhang D.Over-expression ofGmMYB39 leads to an inhibition of the isoflavonoid biosynthesis in soybean(Glycine max L.). Plant Biotechnol Rep, 2013, 7: 445-455
[21] Yan J, Wang B, Zhong Y, Yao L, Cheng L, Wu T.The soybean R2R3 MYB transcription factorGmMYB100 negatively regulates plant flavonoid biosynthesis. Plant Mol Biol, 2015, 89: 35-48
[22] Robbins M P, Hartnoll J, Morris P.Phenylpropanoid defence responses in transgenicLotus corniculatus 1. Glutathione elicitation of isoflavan phytoalexins in transformed root cultures. Plant Cell Rep, 1991, 10: 59-62
[23] Shelton D, Stranne M, Mikkelsen L, Pakseresht N, Welham T, Hiraka H, Tabata S, Sato S, Paquette S, Wang T L, Martin C, Bailey P.Transcription factors of Lotus: regulation of isoflavonoid biosynthesis requires coordinated changes in transcription factor activity.Plant Physiol, 2012, 159: 531-547
[24] Dubos C, Stracke R, Grotewold E, Weisshaar B, Martin C, Lepiniec L.MYB transcription factors in Arabidopsis.Trends Plant Sci, 2010, 15: 573-581
[25] Higgins D G, Thompson J D, Gibson T J.Using CLUSTAL for multiple sequence alignments.Method Enzymol, 1996, 266: 383-402
[26] Tamura K, Stecher G, Peterson D, Filipski A, Kumar S.MEGA6: Molecular Evolutionary Genetics Analysis version 6.0.Mol Biol Evol, 2013, 30: 2725-2729
[27] Livak K J, Schmittgen T D.Analysis of relative gene expression data using real-time quantitative PCR and the 2(-delta delta C(T)) method.Methods, 2001, 25: 402-408
[28] Sun J M, Sun B L, Han F X, Yan S R, Yang H, Kikuchi A.Rapid HPLC method for determination of 12 isoflavone components in soybean seeds.Agric Sci China, 2011, 10: 70-77
[29] Chung E S, Kim K M, Lee J H.Molecular cloning and characterization of a soybeanGmMBY184 induced by abiotic stresses. J Plant Biotechnol, 2012, 39: 175-181
[30] Ishida T, Kurata T, Okada K, Wada T.A genetic regulatory network in the development of trichomes and root hairs.Annu Review Plant Biol, 2008, 59: 365-386
[31] Nadeau J A.Stomatal development: new signals and fate determinants.Curr Opin Plant Biol, 2009, 12: 29-35
[32] Wang X, Niu Q W, Teng C, Li C, Mu J, Chua N H, Zuo J.Overexpression ofPGA37/MYB118 and MYB115 promotes vegetative-to-embryonic transition in Arabidopsis. Cell Res, 2009, 19: 224-235
[33] Muller D, Schmitz G, Theres K.Blind homologous R2R3 Myb genes control the pattern of lateral meristem initiation in Arabidopsis. Plant Cell, 2006, 18: 586-597
[34] Mu R L, Cao Y R, Liu Y F, Lei G, Zou H F, Liao Y, Wang H W, Zhang W K, Ma B, Du J Z, Yuan M, Zhang J S, Chen S Y.An R2R3-type transcription factor geneAtMYB59 regulates root growth and cell cycle progression in Arabidopsis. Cell Res, 2009, 19: 1291-1304
[35] Abe H, Yamaguchi-Shinozaki K, Urao T, Iwasaki T, Hosokawa D, Shinozaki K.Role of Arabidopsis MYC and MYB homologs in drought- and abscisic acid-regulated gene expression.Plant Cell, 1997, 9: 1859-1868
[36] Mengiste T, Chen X, Salmeron J, Dietrich R.TheBOTRYTIS SUSCEPTIBLE1 gene encodes an R2R3MYB transcription factor protein that is required for biotic and abiotic stress responses in Arabidopsis. Plant Cell, 2003, 15: 2551-2565
[37] Borevitz J O, Xia Y, Blount J, Dixon R A, Lamb C.Activation tagging identifies a conserved MYB regulator of phenylpropanoid biosynthesis.Plant Cell, 2000, 12: 2383-2394
[38] Sablowski R W, Moyano E, Culianez-Macia F A, Schuch W, Martin C, Bevan M. A flower-specific Myb protein activates transcription of phenylpropanoid biosynthetic genes.EMBO J, 1994, 13: 128-137
[39] Solano R, Nieto C, Avila J, Canas L, Diaz I, Paz-Ares J.Dual DNA binding specificity of a petal epidermis-specific MYB transcription factor (MYB.Ph3) fromPetunia hybrida. EMBO J, 1995, 14: 1773-1784
[40] Yu O, Shi J, Hession A O, Maxwell C A, McGonigle B, Odell J T. Metabolic engineering to increase isoflavone biosynthesis in soybean seed.Phytochemistry, 2003, 63: 753-763
[41] Grotewold E, Chamberlin M, Snook M, Siame B, Butler L, Swenson J, Maddock S, St Clair G, Bowen B.Engineering secondary metabolism in maize cells by ectopic expression of transcription factors.Plant Cell, 1998, 10: 721-740
[42] Holl J, Vannozzi A, Czemmel S, D'Onofrio C, Walker A R, Rausch T, Lucchin M, Boss P K, Dry I B, Bogs J. The R2R3-MYB transcription factors MYB14 and MYB15 regulate stilbene biosynthesis inVitis vinifera. Plant Cell, 2013, 25: 4135-4149
[43] Dhaubhadel S, Gijzen M, Moy P, Farhangkhoee M.Transcriptome analysis reveals a critical role ofCHS7 and CHS8 genes for isoflavonoid synthesis in soybean seeds. Plant Physiol, 2007, 143: 326-338
[1] Chen Guo-Huan, Zhang Rui, Li Yan-Di, Zhao Jia-Qi, Ren Yong-Tao, Zhang Tian-Ci, Guo Hua-Chun, Li Jun, Yang Fang. Effects of foliar application of exogenous selenium on anthocyanin biosynthesis in tubers of light purple-fleshed potatoes [J]. Acta Agronomica Sinica, 2026, 52(6): 1876-1890.
[2] Tang Kuan-Qiang, Li Gong-Yun, Song Mei-Yi, Zhao Xue, Chang Chun-Ling. Genome-wide association analysis and prediction model construction for soybean plant height [J]. Acta Agronomica Sinica, 2026, 52(6): 1743-1756.
[3] Wang Wen-Yuan, Yan Xue-Jia, Liu Yu-Lin, Sun Xiao-Tong, Li Ya-Nan, Tang Xin-Hua, Shi Ying. Screening of low-light-tolerant potato varieties and cloning and functional analysis of the transcription factor gene StPIF3 [J]. Acta Agronomica Sinica, 2026, 52(6): 1631-1645.
[4] Zou Yi-Mei, Xu Min, Wang Hai-Yang, Yao Hui, Wang Jia-Feng, Liu Hao, Ren Dai-Sheng. Analysis of transcription factor regulatory networks in two-line male sterile rice seedling roots in response to salt stress [J]. Acta Agronomica Sinica, 2026, 52(6): 1728-1742.
[5] Yao Shu, Guo Kai-Yue, Zhai Hui-Hui, Yao Jia-Hui, Deng Wen-Qi, Yan Ling, Huang Chi, Gao Yang, Yu Yan-Ran, Zhao Zhen-Bang, Li Ying-Hui, Wang Xiao-Bo, Li Jia-Jia. Comprehensive evaluation of low-iron tolerance and screening of elite germplasm at the soybean seedling stage [J]. Acta Agronomica Sinica, 2026, 52(5): 1373-1387.
[6] Cai Zhao-Qin, He Guan-Yong, He Wen, Ruan Li-Xia, Liang Zhen-Hua, Li Yong-Zhen, Li Heng-Rui, Chen Hui-Xian. Dynamic transcriptome analysis and key gene discovery during cassava branching development [J]. Acta Agronomica Sinica, 2026, 52(5): 1430-1441.
[7] Gu Chun-Miao, Wang Run-Feng, Huang Lu, Liu Hao, Lu Qing, Li Hai-Fen, Li Shao-Xiong, He Shuang-Cheng, Hong Yan-Bin, Chen Xiao-Ping, Tan Bin, Yu Qian-Xia. Genome-wide analysis of the WOX gene family and identification of candidate genes for adventitious shoot regeneration in peanut [J]. Acta Agronomica Sinica, 2026, 52(5): 1326-1340.
[8] Wang Yi-Han, Li Fu-Chang, Liu Yi, Zhu Guo-Peng. Cloning of the IbOPR2 gene promoter and identification of regulatory factors in sweetpotato [J]. Acta Agronomica Sinica, 2026, 52(4): 1268-1276.
[9] Yang Ying, Hao Yu-Wan, Zhang Xue-Ning, Fang Jia-Lu, Ma Yue-Hua, Yang Wei-Long, Sun Wen-Qing, Wang Xin-Chao, Wang Yu-Chun, Huang Jian-Yan. Molecular mechanism of CsERF9-mediated regulation of anthracnose resistance in tea plant [J]. Acta Agronomica Sinica, 2026, 52(4): 1103-1115.
[10] Zhang Qing, Yang Yu, Guo Qian, Yue Pei-Yao, Yin Cong-Cong, Niu Jing-Ping, Zhao Jin-Zhong, Du Wei-Jun, Yue Ai-Qin. Cloning and functional analysis of the soybean GmARA6a gene in response to salt stress [J]. Acta Agronomica Sinica, 2026, 52(2): 480-493.
[11] MA Juan-E, YAO You-Hua, YAO Xiao-Hua, WU Kun-Lun, CUI Yong-Mei. Cloning and functional analysis of HvERF039 gene in Qingke (Hordeum vulgare L. var. nudum Hook. f) [J]. Acta Agronomica Sinica, 2025, 51(9): 2341-2357.
[12] WANG Ke-Jing, LI Xiang-Hua. Endangerment assessment of the perennial species G. tabacina and G. tomentella of the genus Glycine Willd. in China [J]. Acta Agronomica Sinica, 2025, 51(8): 2009-2019.
[13] MENG Ran, LI Zhao-Jia, FENG Wei, CHEN Yue, LIU Lu-Ping, YANG Chun-Yan, LU Xue-Lin, WANG Xiu-Ping. Comprehensive evaluation of salt tolerance at different growth stages of soybean and screening of salt-tolerant germplasm [J]. Acta Agronomica Sinica, 2025, 51(8): 1991-2008.
[14] HE Hong-Li, ZHANG Yu-Han, YANG Jing, CHENG Yun-Qing, ZHAO Yang, LI Xing-Nuo, SI Hong-Liang, ZHANG Xing-Zheng, YANG Xiang-Dong. Creation and physiological analysis of an e1-as gene mutant in soybean [J]. Acta Agronomica Sinica, 2025, 51(8): 2228-2239.
[15] HU Meng, SHA Dan, ZHANG Sheng-Rui, GU Yong-Zhe, ZHANG Shi-Bi, LI Jing, SUN Jun-Ming, QIU Li-Juan, LI Bin. QTL mapping and candidate gene screening for branch number in soybean [J]. Acta Agronomica Sinica, 2025, 51(7): 1747-1756.
Viewed
Full text


Abstract

Cited
  Shared   
  Discussed   
No Suggested Reading articles found!
Add: No. 80 Xueyuan South Rd, Beijing 100081, P. R. China E-mail: zwxb301@caas.cn
Supported by Beijing Magtech Co.Ltd