Welcome to Acta Agronomica Sinica,

Acta Agronomica Sinica ›› 2020, Vol. 46 ›› Issue (9): 1351-1358.doi: 10.3724/SP.J.1006.2020.03008

• CROP GENETICS & BREEDING · GERMPLASM RESOURCES · MOLECULAR GENETICS • Previous Articles     Next Articles

Functional analysis of ZmCIPK24-2 gene from maize in response to salt stress

LI Jian1,2(), WANG Yi-Ru2, ZHANG Ling-Xiao3, SUN Ming-Hao1,2, QIN Yang2, ZHENG Jun1,2,*()   

  1. 1 College of Agronomy, Jilin Agricultural University, Changchun 130118, Jilin, China
    2 Institute of Crop Sciences, Chinese Academy of Agricultural Sciences, Beijing 100081, China
    3 College of Plant Science and Technology, Beijing University of Agriculture, Beijing 102206, China
  • Received:2020-02-06 Accepted:2020-03-24 Online:2020-09-12 Published:2020-04-21
  • Contact: Jun ZHENG E-mail:13849815737@163.com;zhengjun02@caas.cn
  • Supported by:
    National Key Research and Development Program of China(2016YFD0101002);Agricultural Science and Technology Innovation Program of Chinese Academy of Agricultural Sciences

Abstract:

Soil salinity affects the normal growth and development of crops, resulting in reduced crop yields. In the process of long-term adaptation, plants have evolved targeted salt-resistant molecular mechanisms. The calcineurin B-like protein (CBL) and CBL-interaction protein kinase (CIPK) are involved in plant response to salt stress. In this study, we identified an AtSOS2 homologous gene ZmCIPK24-2. The results of real time-qPCR showed that ZmCIPK24-2 gene was ubiquitously expressed in maize, especially in pollen, and was induced by salt stress. It was found that ZmCIPK24-2 could partially complement the salt-sensitive phenotype of the atsos2 mutant. The survival rate and the root length of ZmCIPK24-2-overexpressed lines were significantly increased compared with atsos2 mutant under high salt concentration. Subcellular localization experiments showed that ZmCIPK24-2 was localized in cytoplasm, cell membrane, and nuclear membrane. Yeast two-hybrid experiments and LUC complementation imaging assays showed that ZmCIPK24-2 was interacted with ZmCBL1, ZmCBL4, ZmCBL8, and ZmCBL9, respectively. This study provides a new experimental evidence for the functional analysis of CBL-CIPK signaling pathway in maize.

Key words: CIPK, CBL, salt tolerance, maize

Table 1

Primers used in this study"

引物
Primer
正向序列
Forward sequence (5'-3')
反向序列
Reverse sequence (5'-3')
ZmCIPK24-2-F/R ATGGCGGGCGCGGGCGCGGG CTAGCAGGTGGTCGTCCTCA
ZmCIPK24-2-Q-F3/R3 AAGGTCCAGCGTCA GGCGTAGATTTGGCA
GAPDH-F/R AGGATATCAAGAAAGCTATTAAGGC GTAGCCCCACTCGTTGTCG
ZmCIPK24-2-RT-F/R TGCCACAACAAAGGAGTTTATCATA TGAGAGATCCAAACCTTGAGATAGT
AtACTIN-F/R GCCAATCCGGTGCTGGTAACA CATACCAGATCCAGTTCCTCCTCCC
ZmCIPK24-2-IF-F/R AGCAGGCTTTGACTTTATGGCGGGCGCGGGCGCGGG TGGGTCTAGAGACTTTCTGCAGGTGGTCGTCCTCA
CBL1-nluc-F/R CACGGGGGACGAGCTCGGTACCATGGGGTGCTTCCATTCCAC ACGCGTACGAGATCTGGTCGACCGTGACGAGATCGTCGA
CBL4-nluc-F/R CACGGGGGACGAGCTCGGTACCATGGGCTGCGCGACGTCCAA ACGCGTACGAGATCTGGTCGACGTCACTGGCTTCTGAAC
CBL8-nluc-F/R CACGGGGGACGAGCTCGGTACCATGGGGTGTGTGTCCTCCAA ACGCGTACGAGATCTGGTCGACCAACTCGTCGTCACTGG
CBL9-nluc-F/R CACGGGGGACGAGCTCGGTACCATGGGGTGCTTCCATTCCAC ACGCGTACGAGATCTGGTCGACCGTGACGAGATCGTCGA
CIPK24-2-cluc-F/R TACGCGTCCCGGGGCGGTACCATGGCGGGCGCGGGCGCGGG TCCTTGTAGTCCATTTGTTGGCAGGTGGTCGTCCTCA

Fig. 1

Sequence analysis of ZmCIPK24-2 protein"

Fig. 2

Analysis of the expression pattern of ZmCIPK24-2 A: relative expression of ZmCIPK24-2 after NaCl treatment for indicated time; B: relative expression levels of ZmCIPK24-2 in different tissues of maize. V1: the first leaf is fully expanded; V7: the seventh leaf is fully expanded; R2: the kernel is completed. Bars with different lowercase are significantly different at the 0.05 probability level."

Fig. 3

Molecular analysis of two complementary transgenic lines COM1 and COM2 A: detection of ZmCIPK24-2 transgenic lines; B: transcriptional level of ZmCIPK24-2."

Fig. 4

Salt tolerance of atsos2 can be improved by ZmCIPK24-2 A, B: survival rate of WT, atsos2, COM1 and COM2 plants under salt stress; C, D: root length of WT, atsos2, COM1, and COM2 under salt stress. Mean values and SE were shown from multiple independent experiment, survival rate: n > 70, root length: n > 5. Bars with different lowercase are significantly different at the 0.05 probability level."

Fig. 5

Subcellular localization of ZmCIPK24-2 protein Yellow indicates the yellow fluorescence of YFP protein under confocal laser scanning microscope; Scale bars = 20 μm."

Fig. 6

Interaction between ZmCIPK24-2 and ZmCBLs A: interaction between ZmCIPK24-2 and ZmCBLs by yeast two-hybrid experiment; B: interaction between ZmCIPK24-2 and ZmCBLs by Firefly LCI assay."

[1] Zhu J K. Abiotic stress signaling and responses in plants. Cell, 2016,167:313-324.
doi: 10.1016/j.cell.2016.08.029 pmid: 27716505
[2] Rana M, Mark T. Mechanisms of salinity tolerance. Annu Rev Plant Biol, 2008,59:651-681.
doi: 10.1146/annurev.arplant.59.032607.092911 pmid: 18444910
[3] Ren Z, Zheng Z M, Chinnusamy V, Zhu J H, Cui X P, Iida K, Zhu J K. RAS1, a quantitative trait locus for salt tolerance and ABA sensitivity in Arabidopsis. Proc Natl Acad Sci USA, 2010,107:5669-5674.
doi: 10.1073/pnas.0910798107 pmid: 20212128
[4] Zhu J K. Genetic analysis of plant salt tolerance using Arabidopsis. Plant Physiol, 2000,124:941-948.
doi: 10.1104/pp.124.3.941
[5] D’Angelo C, Weinl S, Batistic O, Pandey G K, Cheong Y H, Schültke S, Albrecht V, Ehlert B, Schulz B, Harter K, Luan S, Bock R, Kudla J. Alternative complex formation of the Ca2+-regulated protein kinase CIPK1 controls abscisic acid-dependent and independent stress responses in Arabidopsis. Plant J, 2006,48:857-872.
pmid: 17092313
[6] Hashimoto K, Eckert C, Anschutz U, Scholz M, Held K, Waadt R, Reyer A, Hippler M, Becker D, Kudla J. Phosphorylation of calcineurin B-like (CBL) calcium sensor proteins by their CBL- interacting protein kinases (CIPKs) is required for full activity of CBL-CIPK complexes toward their target proteins. J Bio Chem, 2012,287:7956-7968.
doi: 10.1074/jbc.M111.279331
[7] Kudla J, Becker D, Grill E, Hedrich R, Hippler M, Kummer U, Parniske M, Romeis T, Schumacher, K. Advances and current challenges in calcium signaling. New Phytol, 2018,218:414-431.
doi: 10.1111/nph.14966 pmid: 29332310
[8] Saijo Y, Hata S, Kyozuka J, Shimamoto K, Izui K. Over-expression of a single Ca2+-dependent protein kinase confers both cold and salt/drought tolerance on rice plants . Plant J, 2000,23:319-327.
doi: 10.1046/j.1365-313x.2000.00787.x pmid: 10929125
[9] Pandey G K, Cheong Y H, Kim K N, Grant J J, Li L G, Hung W, D’Angelo C, Weinl S, Kudla J, Luan S. The calcium sensor calcineurin B-like 9 modulates abscisic acid sensitivity and biosynthesis in Arabidopsis. Plant Cell, 2004,16:1912-1924.
doi: 10.1105/tpc.021311 pmid: 15208400
[10] Albrecht V, Weinl S, Blazevic D, D’Angelo C, Batistic O, Kolukisaoglu U, Bock R, Schulz B, Harter K, Kudla J. The calcium sensor CBL1 integrates plant responses to abiotic stresses. Plant J, 2003,36:457-470.
pmid: 14617077
[11] Ishitani M, Liu J, Halfter U, Kim C S, Shi W M, Zhu J K. SOS3 function in plant salt tolerance requires N-myristoylation and calcium binding. Plant Cell, 2000,12:1667-1677.
pmid: 11006339
[12] Gutiérrez-Beltrán E, Personat J M, de la Torre F, del Pozo O. A universal stress protein involved in oxidative stress is a phosphorylation target for protein kinase CIPK6. Plant Physiol, 2017,173:836-852.
doi: 10.1104/pp.16.00949 pmid: 27899535
[13] Yang Y, Wu Y, Ma L, Yang, Z J, Dong Q Y, Li Q P, Ni X P, Kudla J, Song C P, Guo Y. The Ca2+ sensor SCaBP3/CBL7 modulates plasma membrane H+-ATPase activity and promotes alkali tolerance in Arabidopsis. Plant Cell, 2019,31:1367-1384.
doi: 10.1105/tpc.18.00568 pmid: 30962395
[14] Xiong L, Schumaker K S, Zhu J K. Cell signaling during cold, drought, and salt stress. Plant Cell, 2002,14:S165-S183.
doi: 10.1105/tpc.000596 pmid: 12045276
[15] Ma L, Ye J, Yang Y, Lin H, Yue L, Luo J, Long Y, Fu H H, Liu X G, Zhang Y L, Wang Y, Chen L Y, Kudla J, Wang Y J, Han S C, Song C P, Guo Y. The SOS2-SCaBP8 complex generates and fine-tunes an AtANN4-dependent calcium signature under salt stress. Dev Cell, 2019,48:697-709.
doi: 10.1016/j.devcel.2019.02.010 pmid: 30861376
[16] 陈勋基. 玉米ZmCIPK12和ZmCIPK21基因的克隆及抗逆分子机理研究. 中国农业大学研究生院博士学位论文, 北京, 2014. pp 14-65
Chen X J. Cloning and Molecular Mechanism Analysis of Stress Tolerance Genes ZmCIPK12 and ZmCIPK21 from Maize. PhD Dissertation of China Agricultural University, Beijing, China, 2014. pp 14-65 (in Chinese with English abstract).
[17] Zhang F, Li L, Jiao Z, Chen Y, Liu H, Chen X, Zheng J. Characterization of the calcineurin B-Like (CBL) gene family in maize and functional analysis of ZmCBL9 under abscisic acid and abiotic stress treatments. Plant Sci, 2016,253:118-129.
doi: 10.1016/j.plantsci.2016.09.011 pmid: 27968980
[18] Liu J, Cheng X, Liu P, Sun J. miR156-targeted SBP-box transcription factors interact with DWARF53 to regulate TEOSINTE BRANCHED1 and BARREN STALK1 expression in bread wheat. Plant Physiol, 2017,174:1931-1948.
doi: 10.1104/pp.17.00445 pmid: 28526703
[19] Chen X, Gu Z, Xin D, Hao L, Liu C, Huang J, Zhang H. Identification and characterization of putative CIPK genes in maize. J Genet Genomics, 2011,38:77-87.
doi: 10.1016/j.jcg.2011.01.005 pmid: 21356527
[20] Halfter U, Ishitani M, Zhu J K. The Arabidopsis SOS2 protein kinase physically interacts with and is activated by the calcium-binding protein SOS3. Proc Natl Acad Sci USA, 2000,97:3735-3740.
pmid: 10725350
[21] Weinl S, Kudla J. The CBL-CIPK Ca2+-decoding signaling network: function and perspectives. New Phytol, 2009,184:517-528.
doi: 10.1111/j.1469-8137.2009.02938.x pmid: 19860013
[22] Zhang M, Liang X, Wang L, Cao Y B, Song W B, Shi J P, Lai J S, Jiang C F. A HAK family Na+ transporter confers natural variation of salt tolerance in maize. Nat Plants, 2019,5:1297-1308.
pmid: 31819228
[23] Luan S. The CBL-CIPK network in plant calcium signaling. Trends Plant Sci, 2009,14:37-42.
doi: 10.1016/j.tplants.2008.10.005 pmid: 19054707
[24] Ishitani M, Kim C S, Liu J, Halfter U, Zhu J K. The Arabidopsis thaliana SOS2 gene encodes a protein kinase that is required for salt tolerance. Proc Natl Acad Sci USA, 2000,7:3730-3734.
[25] Mao J, Manik S M, Shi S, Chao J, Jin Y, Wang Q, Liu H. Mechanisms and physiological roles of the CBL-CIPK networking system in Arabidopsis thaliana. Genes, 2016,7:62.
doi: 10.3390/genes7090062
[26] Quan R, Lin H, Mendoza I, Zhang Y, Cao W, Yang Y Q, Shang M, Chen S Y, Pardo J M, Guo Y. SCABP8/CBL10, a putative calcium sensor, interacts with the protein kinase SOS2 to protect Arabidopsis shoots from salt stress. Plant Cell, 2007,19:1415-1431.
doi: 10.1105/tpc.106.042291 pmid: 17449811
[27] Pandey G K, Grant J J, Cheong Y H, Kim B G, Li L G, Luan S. Calcineurin-B-like protein CBL9 interacts with target kinase CIPK3 in the regulation of ABA response in seed germination. Mol Plant, 2008,1:238-248.
doi: 10.1093/mp/ssn003 pmid: 19825536
[28] Guo Y, Halfter U, Ishitani M, Zhu J K. Molecular characterization of functional domains in the protein kinase SOS2 that is required for plant salt tolerance. Plant Cell, 2001,13:1383-1399.
doi: 10.1105/tpc.13.6.1383 pmid: 11402167
[29] Liu J, Zhu J K. A calcium sensor homolog required for plant salt tolerance. Science, 1998,280:1943-1945.
doi: 10.1126/science.280.5371.1943 pmid: 9632394
[1] Liang Jin-Yu, Yin Jia-De, Wang Hong-Li, Zhang Guo-Ping, Hou Hui-Zhi, Dong Bo, Ma Ming-Sheng. Estimation of leaf nitrogen content in dryland forage maize using UAV-based hyperspectral imaging and machine learning [J]. Acta Agronomica Sinica, 2026, 52(6): 1788-1801.
[2] Yang Yang, Chang Shi-Hui, Tian Hong-Li, Yi Hong-Mei, Wang Lu, Ren Jie, Fan Ya-Ming, Liu Ya-Wei, Wang Feng-Ge, Zhao Jiu-Ran. Genetic diversity analysis of nationally approved maize varieties in different ecological regions [J]. Acta Agronomica Sinica, 2026, 52(5): 1352-1364.
[3] Zhang Hong-Rong, Wang Fei-Er, Li Pan, Qiu Hai-Long, Zhu Jing, Zhao Lian-Hao, Nan Yun-You, He Wei, Fan Zhi-Long, Hu Fa-Long, Chai Qiang, Yin Wen. Photosynthetic characteristics of 20% reduced irrigation combined with 25% organic substitution for chemical fertilizer in increasing silage maize yield [J]. Acta Agronomica Sinica, 2026, 52(5): 1487-1500.
[4] Yang Xin-Yu, Cui Wen-Tao, Dilinigeer Alimu, Wang Kai-Xiang, Wu Peng-Hao, Ren Jiao-Jiao. Genome-wide association and genomic selection analysis of the number of leaves above the ear in maize [J]. Acta Agronomica Sinica, 2026, 52(5): 1573-1590.
[5] Han Ya-Xin, He Guan-Hua, Zhang Xiao-Qiong, Zhang Deng-Feng, Li Yong-Xiang, Liu Xu-Yang, Wang Tian-Yu, Li Yu, Zou Hua-Wen, Li Chun-Hui. Identification of maize lateral root density genes resources through integrated RNA-seq and BSA-seq analyses [J]. Acta Agronomica Sinica, 2026, 52(5): 1341-1352.
[6] Sun Shu-Feng, Xu Zhen-Nan, Huang Jia-Xin, Weng Jian-Feng, Li Xin-Hai. Genome-wide identification of the maize MAPK gene family and its response to Fusarium verticillioides infection [J]. Acta Agronomica Sinica, 2026, 52(5): 1291-1308.
[7] Zhang Ning-Ning, Teng Yu-Fei, Ren Na-Na, Wei Xing-Zhuo, Yan Shu-Hao, Fan Ke-Xin, Wang Yong-Hong, Chen Wen-Kang, Zhang Xing-Hua, Zhu Wan-Chao, Xu Shu-Tu, Xue Ji-Quan. Phenotypic evaluation and plasticity analysis of drought resistance in 201 maize inbred lines [J]. Acta Agronomica Sinica, 2026, 52(5): 1309-1325.
[8] Cai Hong-Wei, Yu Ai-Zhong, Jiang Ke-Qiang, Wang Peng-Fei, Wang Yu-Long, Huo Jian-Zhe, Pang Xiao-Neng, Yin Bo, Shang Yong-Pan. Key mechanisms underlying the enhancement of sweet maize yield through partial substitution of chemical fertilizers with organic manure in arid irrigation districts [J]. Acta Agronomica Sinica, 2026, 52(4): 1166-1180.
[9] Tian Hong-Li, Yang Yang, Fan Ya-Ming, Yi Hong-Mei, Guo Dan-Dan, Wang Feng-Ge, Zhao Jiu-Ran. A novel set of tri-allelic variant SNP loci suitable for maize variety identification [J]. Acta Agronomica Sinica, 2026, 52(4): 993-1005.
[10] Guo Xiang-Yang, Tu Liang, Wang Dong, Liu Peng-Fei, Wang An-Gui, Yi Qiang, Ren Hong, Li Gang, Zhu Yun-Fang, Wu Xun, Jiang Yu-Lin, Tian Feng, Chen Ze-Hui. Application and prospects of Suwan germplasm in maize breeding in China [J]. Acta Agronomica Sinica, 2026, 52(3): 655-664.
[11] Meng Cheng, Wang Zhe. Genome-wide identification and expression analysis of the ZmPFK gene family under biotic and abiotic stresses in maize [J]. Acta Agronomica Sinica, 2026, 52(3): 764-779.
[12] Li Xin-Hao, Xing Meng-Ke, Zhou Zi-Hui, Li Si-Ye, Ren Hao, Wang Hong-Zhang, Lai Hua-Jiang. Exogenous melatonin enhances heat tolerance of maize at the seedling stage by coordinating light and dark reactions [J]. Acta Agronomica Sinica, 2026, 52(3): 839-856.
[13] Niu Li, Wang Yong-Sheng, Wang Chang-Jie, Zhang Hong, Meng Ya-Xiong, Li Bao-Chun, Yang Ke, Ma Xiao-Le, Yao Li-Rong, Si Er-Jing, Wang Hua-Jun, Wang Jun-Cheng. Identification and analysis of the NAC gene family in barley (Hordeum vulgare L.) and functional validation of HvNAC38 in salt tolerance [J]. Acta Agronomica Sinica, 2026, 52(3): 688-707.
[14] Wang Ling, Hu Hao, Song Jia-Feng, Cheng Jie-Lan, Chen Ying, Zheng Ting-Ting, Lyu Zhao-Yan, Zhu Xiao-Biao, Hou Hua-Lan. Cloning and functional validation of UDP-glycosyltransferase gene StUGT52 in potato [J]. Acta Agronomica Sinica, 2026, 52(3): 665-676.
[15] Ma Liang, Ma Lu, Zhang Shu-Yu, Zhang Hui-Min, Wang Ren-Ming, Song Xu-Dong, Zhang Zhen-Liang, Mao Yu-Xiang, Lu Hu-Hua, Chen Guo-Qing, Hao De-Rong, Zhou Guang-Fei. Transcriptome analysis and identification of candidate genes associated with husk number in maize [J]. Acta Agronomica Sinica, 2026, 52(3): 790-801.
Viewed
Full text


Abstract

Cited

  Shared   
  Discussed   
No Suggested Reading articles found!