Welcome to Acta Agronomica Sinica,

Acta Agronomica Sinica ›› 2022, Vol. 48 ›› Issue (7): 1625-1634.doi: 10.3724/SP.J.1006.2022.11043

• CROP GENETICS & BREEDING · GERMPLASM RESOURCES · MOLECULAR GENETICS • Previous Articles     Next Articles

Regulation of long non-coding RNA (LncRNA) in barley roots in response to Piriformospora indica colonization

GUO Nan-Nan(), LIU Tian-Ce, SHI Shuo, HU Xin-Ting, NIU Ya-Dan, LI Liang()   

  1. College of Chemical Engineering and Technology, Hebei University of Technology, Tianjin 300130, China
  • Received:2021-04-13 Accepted:2021-10-19 Online:2022-07-12 Published:2021-11-02
  • Contact: LI Liang E-mail:15033355861@163.com;liangli@hebut.edu.cn
  • Supported by:
    National Natural Science Foundation of China(31801948);Key Research & Development Projects in Hebei Province(19226505D);Natural Science Foundation of Hebei Province(C2021202005)

Abstract:

The molecular mechanism of biomass enhancement by Piriformospora indica in colonization plants needs to be further explored. LncRNA is a kind of long-chain non-coding RNA, which plays an important role in the regulation of plant growth and development. However, it remains unclear whether barley LncRNAs are responsive to Piriformospora indica colonization. It was found that barley roots exhibited fast development and large roots branched after P. indica colonization. Genome-wide high throughput RNA-seq and bioinformatical analysis showed that 752 and 932 differentially expressed LncRNAs were detected in responsive to P. indica at 3-day and 7-day after colonization, respectively. And 70 differentially expressed LncRNAs were found at 7-day compared to 3-day. Among these, 375 were up-regulated and 377 were down-regulated after 3 days’ colonization, and 459 were up-regulated and 473 were down-regulated after 7 days’ colonization, 39 were up-regulated and 31 were down-regulated in 7-day to 3-day comparison group. The qPCR results verified the validity of LncRNAs data in RNA-seq. GO and KEGG analysis indicated that a few LncRNAs might be involved in the molecular functions, cellular components, and biological processes upon P. indica colonization. This study provides a new theoretical basis and experimental basis for further understanding of the interaction between LncRNAs and coding sequences and regulatory functional networks, and provides new ideas and directions for crop shape improvement based on LncRNAs.

Key words: LncRNA, barley, Piriformospora indica, RNA-seq, transcription factor, cell cycle

Fig. 1

Barley root physio morphology, root length, and root number at 3 days and 7 days after P. indica colonization P. indica colonization A: root length and root number were compared between treatment and Mock at 3 days. Bar: 1.0 cm; B: branched roots were compared between treatment and Mock at 3 days. Bar: 1.0 cm; C: chart showing the statistical results of the root length of barley at 3 days and 7 days; D: chart showing the statistical results of the root number of barley at 3 days and 7 days. The experiments and statistical analysis were performed in three biological replicates."

Fig. 2

High-throughput sequencing flowchart of LncRNA identification"

Fig. 3

Hierarchical clustering heat map of differentially expressed LncRNA The abscissa is the sample, the ordinate is the differentially expressed LncRNA. On the left side, the genes are clustered according to the degree of similarity of expression, and the upper part of the sample is clustered according to the degree of similarity of the expression profile. The relative expression level is gradually up-regulated from blue to red, and the number is the relative expression after standardization."

Fig. 4

Differentially expressed LncRNA volcano map A: volcano map of differentially expressed LncRNA in 3 days vs Mock comparison group; B: volcano map of differentially expressed LncRNA in 7 days vs Mock comparison group; C: volcano map of differentially expressed LncRNA in 7 days vs 3 days comparison group. The abscissa indicates the multiple change of gene expression between different samples or comparison combinations (log2 (Fold Change)). The larger the absolute value of abscissa indicates the greater the multiple of expression change between the two comparison combinations; the ordinate indicates the significant level of expression difference. The up-regulated genes are represented by red dots, the down-regulated genes are represented by green dots, and the blue dots are genes that have not changed significantly (Padj < 0.05)."

Table 1

Primers for differential expression identification of LncRNA"

基因编号
Gene code
上游引物序列
Forward sequence (5'-3')
下游引物序列
Reverse sequence (5'-3')
XLOC-070335 TGGCGTCCATATTACGAGGT TTCGGGGAAATATGCTTTTG
XLOC-318641 CATTAGGGAATCCGACGAGA AGTCACGGTTACGCACACAG
XLOC-067560 CCAGTGCAATGATCGCTAGA GGCCTGCTGTCCTTGTTATC
XLOC-119623 TCCGTTTGGTGATTGTGTGT TGCACACGTACAGGGATGAT
XLOC-322519 AGGTAGGTCTCCGTGGGTCT CGAAACCCTCGTTTTGTGTT
XLOC-206343 TCCCCTCTCGTAGATGGACA GACTAAGGAGGGCAGCAAAA
HvUBIQUITIN ACCCTCGCCGACTACAACAT CAGTAGTGGCGGTCGAAGTG

Fig. 5

Identification of differential expression of LncRNA by qRT-PCR A: LncRNA_XLOC_070335, XLOC_318641, and XLOC_067560 were up-regulated; B: LncRNA_XLOC_119623, XLOC_322519, and XLOC_206343 were down-regulated. The experiments of qRT-PCR and the data analysis were performed in three biological replicates. *: P < 0.05."

Fig. 6

GO enrichment histogram A: GO enrichment in 3 days vs Mock group; B: GO enrichment in 7 days vs Mock group; C: GO enrichment in 7 days vs 3 days group. The abscissa denotes the name of GO entry, which is divided into three categories by box (BP biological process, CC cell component, MF molecular function), distinguished by different frames, and the ordinate is the number of genes enriched by GO entry."

Fig. 7

Differentially expressed LncRNA enriched in KEEG pathway in three comparison groups The ordinate represents different pathways, and the abscissa represents the proportion of differentially expressed genes in the corresponding pathway to all genes in the pathway. The circle size represents the number of genes enriched in the corresponding pathway, and the larger the circle, the more genes are enriched in the pathway. Color represents enrichment significance, and the closer it is to be black, the more significant it is."

Fig. 8

Plant hormone signal transduction"

[1] Kitagawa M, Kitagawa K, Kotake Y, Niida H, Ohhata T. Cell cycle regulation by long non-coding RNAs. Cell Mol Life Sci, 2013, 70: 4785-4794.
doi: 10.1007/s00018-013-1423-0
[2] Wilusz J E, Sunwoo H, Spector D L. Long noncoding RNAs: functional surprises from the RNA world. Genes Dev, 2009, 23: 1494-1504.
doi: 10.1101/gad.1800909
[3] Rinn J L, Chang H Y. Genome regulation by long noncoding RNAs. Annu Rev Biochem, 2012, 81: 145-166.
doi: 10.1146/annurev-biochem-051410-092902
[4] Kang C, Liu Z. Global identification and analysis of long non-coding RNAs in diploid strawberry Fragaria vesca during flower and fruit development. BMC Genomics, 2015, 16: 815.
doi: 10.1186/s12864-015-2014-2
[5] Li C, Qiao Z, Qi W, Wang Q, Yuan Y, Yang X, Tang Y, Mei B, Lyu Y, Zhao H, Xiao H, Song R. Genome-wide characterization of cis-acting DNA targets reveals the transcriptional regulatory framework of opaque2 in maize. Plant Cell, 2015, 27: 532-545.
doi: 10.1105/tpc.114.134858
[6] Chekanova J A. Long non-coding RNAs and their functions in plants. Curr Opin Plant Biol, 2015, 27: 207-216.
doi: 10.1016/j.pbi.2015.08.003 pmid: 26342908
[7] Salmena L, Poliseno L, Tay Y, Kats L, Pandolfi P P. A ceRNA hypothesis: the Rosetta Stone of a hidden RNA language? Cell, 2011, 146: 353-358.
doi: 10.1016/j.cell.2011.07.014
[8] Rubio-Somoza I, Weigel D, Franco-Zorilla J M, Garcia J A, Paz-Ares J. ceRNAs: miRNA target mimic mimics. Cell, 2011, 147: 1431-1432.
doi: 10.1016/j.cell.2011.12.003 pmid: 22196719
[9] Fan C, Hao Z, Yan J, Li G. Genome-wide identification and functional analysis of lincRNAs acting as miRNA targets or decoys in maize. BMC Genomics, 2015, 16: 793.
doi: 10.1186/s12864-015-2024-0
[10] Shuai P, Liang D, Tang S, Zhang Z, Ye C Y, Su Y, Xia X, Yin W.Genome-wide identification and functional prediction of novel and drought-responsive lincRNAs in Populus trichocarpa. J Exp Bot, 2014, 65: 4975-4983.
doi: 10.1093/jxb/eru256 pmid: 24948679
[11] Wang T Z, Liu M, Zhao M G, Chen R, Zhang W H. Identification and characterization of long non-coding RNAs involved in osmotic and salt stress in Medicago truncatula using genome-wide high-throughput sequencing. BMC Plant Biol, 2015, 15: 131.
doi: 10.1186/s12870-015-0530-5
[12] Lu X, Chen X, Mu M, Wang J, Wang X, Wang D, Yin Z, Fan W, Wang S, Guo L, Ye W. Genome-wide analysis of long noncoding RNAs and their responses to drought stress in cotton (Gossypium hirsutum L.). PLoS One, 2016, 11: e0156723.
doi: 10.1371/journal.pone.0156723
[13] Lyu Y, Liang Z, Ge M, Qi W, Zhang T, Lin F, Peng Z, Zhao H. Genome-wide identification and functional prediction of nitrogen-responsive intergenic and intronic long non-coding RNAs in maize (Zea mays L.). BMC Genomics, 2016, 17: 350.
doi: 10.1186/s12864-016-2650-1
[14] Xin M, Wang Y, Yao Y, Song N, Hu Z, Qin D, Xie C, Peng H, Ni Z, Sun Q. Identification and characterization of wheat long non-protein coding RNAs responsive to powdery mildew infection and heat stress by using microarray analysis and SBS sequencing. BMC Plant Biol, 2011, 11: 61.
doi: 10.1186/1471-2229-11-61
[15] Shumayla, Sharma S, Taneja M, Tyagi S, Singh K, Upadhyay S K. Survey of High Throughput RNA-Seq Data reveals potential roles for LncRNAs during development and stress response in bread wheat. Front Plant Sci, 2017, 8: 1019.
doi: 10.3389/fpls.2017.01019 pmid: 28649263
[16] Heo J B, Sung S. Vernalization-mediated epigenetic silencing by a long intronic noncoding RNA. Science, 2011, 331: 76-79.
doi: 10.1126/science.1197349
[17] Swiezewski S, Liu F, Magusin A, Dean C. Cold-induced silencing by long antisense transcripts of an Arabidopsis Polycomb target. Nature, 2009, 462: 799-802.
doi: 10.1038/nature08618
[18] Ding J, Lu Q, Ouyang Y, Mao H, Zhang P, Yao J, Xu C, Li X, Xiao J, Zhang Q. A long noncoding RNA regulates photoperiod-sensitive male sterility, an essential component of hybrid rice. Proc Natl Acad Sci USA, 2012, 109: 2654-2659.
doi: 10.1073/pnas.1121374109
[19] Qin T, Zhao H, Cui P, Albesher N, Xiong L. A nucleus-localized long non-coding RNA enhances drought and salt stress tolerance. Plant Physiol, 2017, 175: 1321-1336.
doi: 10.1104/pp.17.00574
[20] Zou Y, Tang H, Li T, Sun M, Qu X, Zhou J, Yang C, Mu Y, Jiang Q, Liu Y, Chen G, Chen G, Zheng Y, Wei Y, Lan X, Ma J. Identification and characterization of mRNAs and LncRNAs of a barley shrunken endosperm mutant using RNA-seq. Genetica, 2020, 148: 55-68.
doi: 10.1007/s10709-020-00087-2
[21] Karlik E, Gözükırmızı N. Evaluation of barley LncRNAs expression analysis in salinity stress. Russ J Genet, 2018, 54: 198-204.
doi: 10.1134/S1022795418020096
[22] Unver T, Tombuloglu H. Barley long non-coding RNAs (LncRNA) responsive to excess boron. Genomics, 2020, 112: 1947-1955.
doi: 10.1016/j.ygeno.2019.11.007
[23] Michael A H, Bryan P, Amanda S B, Sarah A K, Wei Y, Steven R S, Nicholas C C. Small-interfering RNAs from natural antisense transcripts derived from a cellulose synthase gene modulate cell wall biosynthesis in barley. Proc Natl Acad Sci USA, 2008, 105: 20534-20539.
doi: 10.1073/pnas.0809408105
[24] Qiu C W, Zhao J, Chen Q, Wu F. Genome-wide characterization of drought stress responsive long non-coding RNAs in Tibetan wild barley. Environ Exp Bot, 2019, 164: 124-134.
doi: 10.1016/j.envexpbot.2019.05.002
[25] Karlik E, Gozukirmizi N. Expression analysis of LncRNA AK370814 involved in the barley vitamin B6 salvage pathway under salinity. Mol Biol Rep, 2018, 45: 1597-1609.
doi: 10.1007/s11033-018-4289-2 pmid: 30298351
[26] Weiss M, Selosse M A, Rexer K H, Urban A, Oberwinkler F. Sebacinales: a hitherto overlooked cosm of heterobasidiomycetes with a broad mycorrhizal potential. Mycol Res, 2004, 108: 1003-1010.
doi: 10.1017/S0953756204000772
[27] Ghaffari M R, Mirzaei M, Ghabooli M, Khatabi B, Wu Y, Zabet-Moghaddam M, Mohammadi-Nejad G, Haynes P A, Hajirezaei M R, Sepehri M, Salekdeh G H. Root endophytic fungus Piriformospora indica improves drought stress adaptation in barley by metabolic and proteomic reprogramming. Environ Exp Bot, 2019, 157: 197-210.
doi: 10.1016/j.envexpbot.2018.10.002
[28] Sherameti I, Venus Y, Drzewiecki C, Tripathi S, Dan V M, Nitz I, Varma A, Grundler F M, Oelmuller R. PYK10, a b-glucosidase located in the endoplasmatic reticulum, is crucial for the beneficial interaction between Arabidopsis thaliana and the endophytic fungus Piriformospora indica. Plant J, 2008, 54: 428-439.
doi: 10.1111/j.1365-313X.2008.03424.x
[29] Zhang W, Wang J, Xu L, Wang A, Huang L, Du H, Qiu L, Oelmuller R. Drought stress responses in maize are diminished by Piriformospora indica. Plant Signal Behav, 2018, 13: e1414121.
doi: 10.1080/15592324.2017.1414121
[30] Abdelaziz M E, Abdelsattar M, Abdeldaym E A, Atia M A M, Mahmoud A W M, Saad M M, Hirt H. Piriformospora indica alters Na+/K+ homeostasis, antioxidant enzymes and LeNHX1 expression of greenhouse tomato grown under salt stress. Sci Hortic (Amsterdam), 2019, 256: 108532.
doi: 10.1016/j.scienta.2019.05.059
[31] Varma A, Verma S, Sudha X, Sahay N, Butehorn B, Franken P. Piriformospora indica, a cultivable plant-growth-promoting root endophyte. Appl Environ Microbiol, 1999, 65: 2741-2744.
doi: 10.1128/AEM.65.6.2741-2744.1999
[32] Yang L, Cao J L, Zou Y N, Wu Q S, Kuča K. Piriformospora indica: a root endophytic fungus and its roles in plants. Not Bot Hortic Agrobo, 2020, 48: 1-13.
[33] Bagde U S, Prasad R, Varma A. Impact of culture filtrate of Piriformospora indica on biomass and biosynthesis of active ingredient aristolochic acid in Aristolochia elegans Mart. Int J Agric Biol, 2013, 6: 29-37.
[34] Kumar V, Sarma M V, Saharan, Kumar L, Sahai V, Bisaria V S, Sharma A K. Effect of formulated root endophytic fungus Piriformospora indica and plant growth promoting rhizobacteria fluorescent pseudomonads R62 and R81 on Vigna mungo. World J Microbiol Biotechnol, 2012, 28: 595-603.
doi: 10.1007/s11274-011-0852-x
[35] Sharma G, Agrawal V. Marked enhancement in the artemisinin content and biomass productivity in Artemisia annua L. shoots co-cultivated with Piriformospora indica. World J Microbiol Biotechnol, 2013, 29: 1133-1138.
doi: 10.1007/s11274-013-1263-y
[36] Vadassery J, Ranf S, Drzewiecki C, Mithofer A, Mazars C, Scheel D, Lee J, Oelmuller R. A cell wall extract from the endophytic fungus Piriformospora indica promotes growth of Arabidopsis seedlings and induces intracellular calcium elevation in roots. Plant J, 2009, 59: 193-206.
doi: 10.1111/j.1365-313X.2009.03867.x
[37] Yadav V, Kumar M, Deep D K, Kumar H, Sharma R, Tripathi T, Tuteja N, Saxena A K, Johri A K. Withdrawal: a phosphate transporter from the root endophytic fungus Piriformospora indica plays a role in phosphate transport to the host plant. J Biol Chem, 2010, 285: 26532-26544.
doi: 10.1074/jbc.M110.111021
[38] Lee Y C, Johnson J M, Chien C T, Sun C, Cai D, Lou B, Oelmüller R, Yeh K W. Growth promotion of Chinese cabbage and Arabidopsis by Piriformospora indica is not stimulated by Mycelium-synthesized auxin. Mol Plant Microbe Interact, 2011, 24: 421-443.
doi: 10.1094/MPMI-05-10-0110
[39] Sun C, Johnson J M, Cai D, Sherameti I, Oelmuller R, Lou B. Piriformospora indica confers drought tolerance in Chinese cabbage leaves by stimulating antioxidant enzymes, the expression of drought-related genes and the plastid-localized CAS protein. J Plant Physiol, 2010, 167: 1009-1017.
doi: 10.1016/j.jplph.2010.02.013
[40] Baltruschat H, Fodor J, Harrach B D, Niemczyk E, Barna B, Gullner G, Janeczko A, Kogel K H, Schafer P, Schwarczinger I, Zuccaro A, Skoczowski A. Salt tolerance of barley induced by the root endophyte Piriformospora indica is associated with a strong increase in antioxidants. New Phytol, 2008, 180: 501-510.
doi: 10.1111/j.1469-8137.2008.02583.x pmid: 18681935
[41] Schafer P, Pfiffi S, Voll L M, Zajic D, Chandler P M, Waller F, Scholz U, Pons-Kuhnemann J, Sonnewald S, Sonnewald U, Kogel K H.Manipulation of plant innate immunity and gibberellin as factor of compatibility in the mutualistic association of barley roots with Piriformospora indica. Plant J, 2009, 59: 461-474.
doi: 10.1111/j.1365-313X.2009.03887.x
[42] Zuccaro A, Lahrmann U, Guldener U, Langen G, Pfiffi S, Biedenkopf D, Wong P, Samans B, Grimm C, Basiewicz M, Murat C, Martin F, Kogel K H.Endophytic life strategies decoded by genome and transcriptome analyses of the mutualistic root symbiont Piriformospora indica. PLoS Pathog, 2011, 7: e1002290.
doi: 10.1371/journal.ppat.1002290
[1] Chen Guo-Huan, Zhang Rui, Li Yan-Di, Zhao Jia-Qi, Ren Yong-Tao, Zhang Tian-Ci, Guo Hua-Chun, Li Jun, Yang Fang. Effects of foliar application of exogenous selenium on anthocyanin biosynthesis in tubers of light purple-fleshed potatoes [J]. Acta Agronomica Sinica, 2026, 52(6): 1876-1890.
[2] Wang Wen-Yuan, Yan Xue-Jia, Liu Yu-Lin, Sun Xiao-Tong, Li Ya-Nan, Tang Xin-Hua, Shi Ying. Screening of low-light-tolerant potato varieties and cloning and functional analysis of the transcription factor gene StPIF3 [J]. Acta Agronomica Sinica, 2026, 52(6): 1631-1645.
[3] Zou Yi-Mei, Xu Min, Wang Hai-Yang, Yao Hui, Wang Jia-Feng, Liu Hao, Ren Dai-Sheng. Analysis of transcription factor regulatory networks in two-line male sterile rice seedling roots in response to salt stress [J]. Acta Agronomica Sinica, 2026, 52(6): 1728-1742.
[4] Cai Zhao-Qin, He Guan-Yong, He Wen, Ruan Li-Xia, Liang Zhen-Hua, Li Yong-Zhen, Li Heng-Rui, Chen Hui-Xian. Dynamic transcriptome analysis and key gene discovery during cassava branching development [J]. Acta Agronomica Sinica, 2026, 52(5): 1430-1441.
[5] Gu Chun-Miao, Wang Run-Feng, Huang Lu, Liu Hao, Lu Qing, Li Hai-Fen, Li Shao-Xiong, He Shuang-Cheng, Hong Yan-Bin, Chen Xiao-Ping, Tan Bin, Yu Qian-Xia. Genome-wide analysis of the WOX gene family and identification of candidate genes for adventitious shoot regeneration in peanut [J]. Acta Agronomica Sinica, 2026, 52(5): 1326-1340.
[6] Yang Ying, Hao Yu-Wan, Zhang Xue-Ning, Fang Jia-Lu, Ma Yue-Hua, Yang Wei-Long, Sun Wen-Qing, Wang Xin-Chao, Wang Yu-Chun, Huang Jian-Yan. Molecular mechanism of CsERF9-mediated regulation of anthracnose resistance in tea plant [J]. Acta Agronomica Sinica, 2026, 52(4): 1103-1115.
[7] Wang Yi-Han, Li Fu-Chang, Liu Yi, Zhu Guo-Peng. Cloning of the IbOPR2 gene promoter and identification of regulatory factors in sweetpotato [J]. Acta Agronomica Sinica, 2026, 52(4): 1268-1276.
[8] Li Ying, Shi Xiao-Xu, Liu Hai-Cui, Shi Lyu, Xue Ya-Guang, Wei Ya-Feng. Establishment of a near-infrared reflectance spectroscopy model for predicting β-glucan content in naked barley grain [J]. Acta Agronomica Sinica, 2026, 52(3): 735-745.
[9] Niu Li, Wang Yong-Sheng, Wang Chang-Jie, Zhang Hong, Meng Ya-Xiong, Li Bao-Chun, Yang Ke, Ma Xiao-Le, Yao Li-Rong, Si Er-Jing, Wang Hua-Jun, Wang Jun-Cheng. Identification and analysis of the NAC gene family in barley (Hordeum vulgare L.) and functional validation of HvNAC38 in salt tolerance [J]. Acta Agronomica Sinica, 2026, 52(3): 688-707.
[10] Yu Kai-Hang, Zhou Hong-Bin, Luo Liang-Zha, Wang Mei-Li, Jiang Rui-Mei, Dong-Chen Wen-Hua, Li Shi-Jin, Mao Xiao-Qiang, Chen Sheng-Wei. Cloning and expression analysis of the HvLRR-RLK-510 gene encoding a leucine-rich repeat receptor-like kinase in barley [J]. Acta Agronomica Sinica, 2026, 52(2): 421-432.
[11] GAO Yuan, WANG Yu-Qi, JIANG Jia-Ning, ZHAO Jian-Xiong, WANG Xue-He-Yuan, WANG Hao-Yu, ZHANG Rui-Jia, XU Jing-Yu, HE Lin. Identification and functional analysis of low temperature responsive genes ZmNTL1 and ZmNTL5 in maize [J]. Acta Agronomica Sinica, 2025, 51(9): 2318-2329.
[12] MA Juan-E, YAO You-Hua, YAO Xiao-Hua, WU Kun-Lun, CUI Yong-Mei. Cloning and functional analysis of HvERF039 gene in Qingke (Hordeum vulgare L. var. nudum Hook. f) [J]. Acta Agronomica Sinica, 2025, 51(9): 2341-2357.
[13] HE Peng-Xu, YAO Li-Rong, CHEN Yuan-Ling, YAN Yan, ZHANG Hong, WANG Jun-Cheng, LI Bao-Chun, YANG Ke, SI Er-Jing, MENG Ya-Xiong, MA Xiao-Le, WANG Hua-Jun. Differences and correlations in physiological and molecular mechanisms of barley germination under drought stress [J]. Acta Agronomica Sinica, 2025, 51(9): 2412-2432.
[14] XU Yi-Wei, ZHANG Ying-Ying, LI Rui, YAN Yong-Liang, LIU Yun-Jun, KONG Zhao-Sheng, ZHENG Jun, WANG Yi-Ru. csp2 gene of Deinococcus gobiensis improves drought tolerance in maize [J]. Acta Agronomica Sinica, 2025, 51(8): 1981-1990.
[15] YANG Hai-Yang, WU Lin-Xuan, LI Bo-Wen, SHI Han-Feng, YUAN Xi-Long, LIU Jin-Zhao, CAI Hai-Rong, CHEN Shi-Yi, GUO Tao, WANG Hui. OsWRI3, identified based on QTL mapping, regulates seed shattering in rice [J]. Acta Agronomica Sinica, 2025, 51(7): 1712-1724.
Viewed
Full text


Abstract

Cited

  Shared   
  Discussed   
No Suggested Reading articles found!