Welcome to Acta Agronomica Sinica，

Acta Agronomica Sinica ›› 2022, Vol. 48 ›› Issue (4): 812-824.doi: 10.3724/SP.J.1006.2022.14076

• CROP GENETICS & BREEDING · GERMPLASM RESOURCES · MOLECULAR GENETICS • Previous Articles     Next Articles

Function analysis of GmELF3s in regulating soybean flowering time and circadian rhythm

XU Xin(), QIN Chao(), ZHAO Tao, LIU Bin, LI Hong-Yu*(), LIU Jun*()   

  1. Institute of Crop Sciences, Chinese Academy of Agricultural Sciences, Beijing 100081, China
  • Received:2021-04-25 Accepted:2021-07-12 Online:2022-04-12 Published:2021-08-11
  • Contact: LI Hong-Yu,LIU Jun E-mail:935816885@qq.com;82101181010@caas.cn;lihongyu@caas.cn;liujun02@caas.cn
  • About author:First author contact:**Contributed equally to this work
  • Supported by:
    Agricultural Science and Technology Innovation Program of Chinese Academy of Agricultural Sciences(2060302-2-20);Soybean Grain Storage Technology Program(CAAS-ZDRW202003)

RichHTML396

42

PDF

1103

Abstract:

Soybean is a typical short-day crop. Photoperiod sensitivity seriously affects flowering time, yield, and planting range of soybean, but the mechanism underlying photoperiod and circadian rhythm regulation is still unclear. In Arabidopsis thaliana, ELF3, together with ELF4 and LUX, forms the ELF4-ELF3-LUX complex (Evening Complex, EC), which plays an important role in circadian rhythm and flowering time regulation. In this study, soybean mutants of Gmelf3a/j, Gmelf3b-1, and Gmelf3b-2 were obtained by CRISPR/Cas9 gene editing system. We found that GmELF3b-1 regulated the flowering time in soybean under long-day conditions by observing flowering phenotypes in these mutants. The phenotypes of heterozygous double mutants revealed that there was functional redundancy among GmELF3a/J, GmELF3b-1, and GmELF3b-2 in regulating flowering time of soybean. Through detecting the expression of circadian related genes in soybean by using qRT-PCR, it was found that the relative expression patterns of GmCAB, GmPRR9a, and GmPRR7a were changed in soybean. In summary, these results suggested that GmELF3a/J, GmELF3b-1, and GmELF3b-2 may regulate the circadian rhythm and flowering time through GmPRR9a and GmPRR7a in soybean.

Key words: photoperiod, circadian clock, flowering time, Evening Complex, ELF3

Table 1

Primers for the construction of CRISPR/Cas9-ELF3 vectors"

引物名称
Primer name		 引物序列
Primer sequence (5'-3')
GmELF3a-1.1-F1 AATGTGCCACCACATGGATTGTGTATCGGACTGCCCATCC GTTTTAGAGCTAGAAATAGCAA
GmELF3a-1.8-F1 AATGTGCCACCACATGGATTGGTGGCTGCTGACAGTGGGA GTTTTAGAGCTAGAAATAGCAA
GmELF3b1-2.5-F1 AATGTGCCACCACATGGATTGAATATCACGATACTCGGAC GTTTTAGAGCTAGAAATAGCAA
GmELF3b2-3.1-F1 AATGTGCCACCACATGGATTGCGTCGCGGATTTCCGGTTA GTTTTAGAGCTAGAAATAGCAA
GmELF3b2-3.9-F1 AATGTGCCACCACATGGATTGACTGGAGGCCCAATACAGA GTTTTAGAGCTAGAAATAGCAA
gRNA-Xba I-R GCTCGGCAACGCGTTCTAGAAAAAAAAGCACCGACTCGGT
U6-Xba I-F GGAAGCTTAGGCCTTCTAGAAAAATAAATGGTAAAATGTC
U6-R CAATCCATGTGGTGGCACAT

Fig. 1

CRISPR/Cas9 vector diagram and phylogenetic analysis of GmELF3s A: CRISPR/Cas9 vector diagram; B: phylogenetic analysis of soybean GmELF3s with ELF3 in Arabidopsis, snap bean (Phaseolus vulgaris), azuki bean (Vigna angularis), mung bean (Vigna radiate), wheat (Triticum aestivum L.), maize (Zea mays L.), and rice (Oryza sativa L.)."

Fig. 2

Schematic diagram of the targeted sequences in GmELF3a (A), GmELF3b-1 (B), and GmELF3b-2 (C) The blue sequences are the protospacer adjacent motif (PAM) sequences, and the red sequences are the target genome sequences."

Fig. 3

Statistical analysis of flowering time and plant height of Gmelf3s mutants under short-day condition A: phenotype of Gmelf3a-1.1-1, Gmelf3a-1.8-1, Gmelf3a-1.8-2, Gmelf3b1-2.5-1, and Gmelf3b2-3.9-1 mutants under short-day conditions; B: statistical analysis of flowering time of Gmelf3a-1.1-1, Gmelf3a-1.8-1, Gmelf3a-1.8-2, Gmelf3b1-2.5-1, and Gmelf3b2-3.9-1 mutants under short-day conditions; C: statistical analysis of plant height of Gmelf3a-1.1-1, Gmelf3a-1.8-1, Gmelf3a-1.8-2, Gmelf3b1-2.5-1, and Gmelf3b2-3.9-1 mutants under short-day conditions. **: P < 0.01."

Fig. 4

Flowering phenotype of Gmelf3s mutants (A) and flowering time statistics (B) under long-day conditions * and ** represent significant difference at the 0.05 and 0.01 probability levels, respectively."

Fig. 5

Mutation sequences and flowering time of double mutant under short-day condition A-B: the mutation sequence of Gmefl3a, Gmefl3b-1, and Gmefl3b-3 in heterozygous double mutants; (A) the first two sequences are GmELF3a and mutated Gmelf3a, the last two sequences are GmELF3b-1 and mutated Gmefl3b-1; (B) the first two sequences are GmELF3a and mutated Gmelf3a, the last two sequences are GmELF3b-2 and mutated Gmefl3b-2. C-F: statistical analysis the flowering time of heterozygous double mutant; (C) flowering phenotype of Gmefl3a/b1-1-1 double mutant; (D) statistical analysis of flowering times in Gmefl3a/b1-1-1 double mutant; (E) flowering phenotype of Gmefl3a/b2-2-1 double mutant; (F) statistical analysis of flowering times in Gmefl3a/b2-2-1 double mutant. * and ** represents significant difference at the 0.05 and 0.01 probability levels, respectively."

Fig. 6

Circadian rhythm analysis of GmELF3a, GmELF3b-1, and GmELF3b-2 A, B: the relative expression pattern of GmELF3a under long-day and short-day conditions, respectively; C, D: the relative expression pattern of GmELF3b-1 under long-day and short-day conditions, respectively; E, F: the relative expression pattern of GmELF3b-2 under long-day and short-day conditions, respectively."

Fig. S1

Circadian rhythm analysis of GmELF3a, GmELF3b-1, and GmELF3b-2 in Tianlong 1 and Gmelf3s mutants"

Fig. S2

Regulation of circadian clock gene rhythm by GmELF3s on GmTOC1a, GmPRR5, GmELF4, GmLUX1, GmCCA3, and GmREV8a"

Fig. 7

Regulation of GmELF3s on the circadian clock genes of GmCAB, GmPRR9a, and GmPRR7a A: the relative expression levels of GmCAB in Gmelf3a, Gmelf3b-1, and Gmelf3b-2 mutant; B: the relative expression of GmPRR9a in Gmelf3a, Gmelf3b-1, and Gmelf3b-2 mutant; C: the relative expression levels of GmPRR7a in Gmelf3a, Gmelf3b-1, and Gmelf3b-2 mutant."

[1] Bernard R L. Two major genes for time of flowering and maturity in soybeans. Crop Sci, 1971, 11:242-244.
doi: 10.2135/cropsci1971.0011183X001100020022x
[2] Buzzell R I. Inheritance of a soybean flowering response to fluorescent-daylength conditions. Can J Genet Cytol, 1971, 13:703-707.
doi: 10.1139/g71-100
[3] Watanabe S, Harada K, Abe J. Genetic and molecular bases of photoperiod responses of flowering in soybean. Breed Sci, 2012, 61:531-543.
doi: 10.1270/jsbbs.61.531
[4] Hartwig E E, Kiihl R A S. Identification and utilization of a delayed flowering character in soybeans for short-day conditions. Field Crops Res, 1979, 2:145-151.
doi: 10.1016/0378-4290(79)90017-0
[5] Sinclair T R, Hinson K. Soybean flowering in response to the long-juvenile trait. Crop Sci, 1992, 32:1242-1248.
doi: 10.2135/cropsci1992.0011183X003200050036x
[6] Carpentieri-Pípolo V, Almeida L A, Kiihl R A S. Inheritance of a long juvenile period under short-day conditions in soybean. Genet Mol Biol, 2002, 25:463-469.
doi: 10.1590/S1415-47572002000400016
[7] Lu S J, Zhao X H, Hu Y L, Liu S L, Nan H Y, Li X M, Fang C, Cao D, Shi X Y, Kong L P, Su T, Zhang F G, Li S C, Wang Z, Yuan X H, Cober E R, Weller J L, Liu B H, Hou X L, Tian Z X, Kong F J. Natural variation at the soybean J locus improves adaptation to the tropics and enhances yield. Nat Genet, 2017, 49:773-779.
doi: 10.1038/ng.3819
[8] Yue Y L, Liu N X, Jiang B J, Li M, Wang H J, Jiang Z, Pan H T, Xia Q J, Ma Q B, Han T F, Nian H. A single nucleotide deletion in J encoding GmELF3 confers long juvenility and is associated with adaption of tropic soybean. Mol Plant, 2017, 10:656-658.
doi: 10.1016/j.molp.2016.12.004
[9] Cheng Q, Gan Z R, Wang Y P, Lu S J, Hou Z H, Li H Y, Xiang H T, Liu B H, Kong F J, Dong L D. The soybean gene J contributes to salt stress tolerance by up-regulating salt-responsive genes. Front Plant Sci, 2020, 11:272.
doi: 10.3389/fpls.2020.00272 pmid: 32256507
[10] Fang C, Liu J, Zhang T, Su T, Li S C, Cheng Q, Kong L P, Li X M, Bu T T, Li H Y, Dong L D, Lu S J, Kong F J, Liu B H. A recent retrotransposon insertion of J caused E6 locus facilitating soybean adaptation into low latitude. J Integr Plant Biol, 2021, 63:995-1003.
doi: 10.1111/jipb.v63.6
[11] Inoue K, Araki T, Endo M. Circadian clock during plant development. J Plant Res, 2018, 131:59-66.
doi: 10.1007/s10265-017-0991-8
[12] Johansson M, Staiger D. Time to flower: interplay between photoperiod and the circadian clock. J Exp Bot, 2015, 66:719-730.
doi: 10.1093/jxb/eru441 pmid: 25371508
[13] Hicks K A, Albertson T M, Wagner D R. EARLY FLOWERING3 encodes a novel protein that regulates circadian clock function and flowering in Arabidopsis. Plant Cell, 2001, 13:1281-1292.
pmid: 11402160
[14] Liu X L, Covington M F, Fankhauser C, Chory J, Wagner D R. ELF3 encodes a circadian clock-regulated nuclear protein that functions in an Arabidopsis PHYB signal transduction pathway. Plant Cell, 2001, 13:1293-1304.
pmid: 11402161
[15] Doyle M R, Davi S J, Bastow R M, McWatters H G, Kozma- Bognar L, Nagy F, Milla A J, Amasin R M. The ELF4 gene controls circadian rhythms and flowering time in Arabidopsis thaliana. Nature, 2002, 419:74-77.
doi: 10.1038/nature00954
[16] Nusinow D A, Helfer A, Hamilton E E, King J J, Imaizumi T, Schultz T F, Farre E M, Kay S A. The ELF4-ELF3-LUX complex links the circadian clock to diurnal control of hypocotyl growth. Nature, 2011, 475:398-402.
doi: 10.1038/nature10182
[17] Liew L C, Singh M B, Bhalla P L. A novel role of the soybean clock gene LUX ARRHYTHMO in male reproductive development. Sci Rep, 2017, 7:10605.
doi: 10.1038/s41598-017-00205-9
[18] Fang X L, Han Y P, Liu M S, Jiang J C, Li X, Lian Q C, Xie X R, Huang Y, Ma Q B, Nian H, Qi J, Yan C Y, Wang Y X. Modulation of evening complex activity enables north-to-south adaptation of soybean. Sci China Life Sci, 2021, 64:179-195.
doi: 10.1007/s11427-020-1832-2
[19] Brambilla V, Fornara F. Molecular control of flowering in response to day length in rice. J Integr Plant Biol, 2013, 55:410-418.
doi: 10.1111/jipb.12033
[20] Hazen S P, Schultz T F, Pruneda-Paz J L, Borevitz J O, Ecker J R, Kay S A. LUX ARRHYTHMO encodes a Myb domain protein essential for circadian rhythms. Proc Natl Acad Sci USA, 2005, 102:10387-10392.
[21] Saito H, Ogiso-Tanaka E, Okumoto Y, Yoshitake Y, Izumi H, Yokoo T, Matsubara K, Hori K, Yano M, Inoue H, Tanisaka T. Ef7 encodes an ELF3-like protein and promotes rice flowering by negatively regulating the floral repressor gene Ghd7 under both short- and long-day conditions. Plant Cell Physiol, 2012, 53:717-728.
doi: 10.1093/pcp/pcs029
[22] Alvarez M A, Tranquilli G, Lewis S, Kippes N, Dubcovsky J. Genetic and physical mapping of the earliness per se locus Eps-A (m) 1 in Triticum monococcum identifies EARLY FLOWERING 3 (ELF3) as a candidate gene. Funct Integr Genomics, 2016, 16:365-382.
doi: 10.1007/s10142-016-0490-3
[23] Faure S, Turner A S, Gruszka D, Christodoulou V, Davis S J, Korff M V, Laurie D A. Mutation at the circadian clock gene EARLY MATURITY 8 adapts domesticated barley (Hordeum vulgare) to short growing seasons. Proc Natl Acad Sci USA, 2012, 109:8328-8333.
doi: 10.1073/pnas.1120496109
[24] Weller J L, Liew L C, Hecht V F G, Rajandran V, Laurie R E, Ridge S, Wenden B, Vander Schoor J K, Jaminon O, Blassiau C, Dalmais M, Rameau C, Bendahmane A, Macknight R C, Lejeune-Henaut I. A conserved molecular basis for photoperiod adaptation in two temperate legumes. Proc Natl Acad Sci USA, 2012, 109:21158-21163.
[25] Zakhrabekova S, Gough S P, Braumann I, Muller A H, Lundqvist J, Ahmann K, Dockter C, Matyszczak I, Kurowska M, Druka A, Waugh R, Graner A, Stein N, Steuernagel B, Lundqvist U, Hansson M. Induced mutations in circadian clock regulator Mat-a facilitated short-season adaptation and range extension in cultivated barley. Proc Natl Acad Sci USA, 2012, 109:4326-4331.
doi: 10.1073/pnas.1113009109
[26] Bu T T, Lu S J, Wang K, Dong L D, Li S L, Xie Q G, Xu X D, Cheng Q, Chen L Y, Fang C, Li H Y, Liu B H, Weller J L, Kong F J. A critical role of the soybean evening complex in the control of photoperiod sensitivity and adaptation. Proc Natl Acad Sci USA, 2021, 118:e2010241118.
[27] Pokhilko A, Fernandez A P, Edwards K D, Southern M M, Halliday K J, Millar A J. The clock gene circuit in Arabidopsis includes a repressilator with additional feedback loops. Mol Syst Biol, 2012, 8:574.
doi: 10.1038/msb.2012.6
[28] Hsu P Y, Harmer S L. Wheels within wheels: the plant circadian system. Trends Plant Sci, 2014, 19:240-249.
doi: 10.1016/j.tplants.2013.11.007
[29] Dixon L E, Knox K, Kozma-Bognar L, Southern M M, Pokhilko A, Millar A J. Temporal repression of core circadian genes is mediated through EARLY FLOWERING 3 in Arabidopsis. Curr Biol, 2011, 21:120-125.
doi: 10.1016/j.cub.2010.12.013
[30] Helfer A, Nusinow D A, Chow B Y, Gehrke A R, Bulyk M L, Kay S A. LUX ARRHYTHMO encodes a nighttime repressor of circadian gene expression in the Arabidopsis core clock. Curr Biol, 2011, 21:126-133.
doi: 10.1016/j.cub.2010.12.021 pmid: 21236673
[31] Chow B Y, Helfer A, Nusinow D A, Kay S A. ELF3 recruitment to the PRR9 promoter requires other evening complex members in the Arabidopsis circadian clock. Plant Signal Behav, 2012, 7:170-173.
doi: 10.4161/psb.18766
[32] Herrero E, Kolmos E, Bujdoso N, Yuan Y, Wang M, Berns M C, Uhlworm H, Coupland G, Saini R, Jaskolski M, Webb A, Goncalves J, Davis S J. EARLY FLOWERING4 recruitment of EARLY FLOWERING3 in the nucleus sustains the Arabidopsis circadian clock. Plant Cell, 2012, 24:428-443.
doi: 10.1105/tpc.111.093807
[33] Kamioka M, Takao S, Suzuki T, Taki K, Higashiyama T, Kinoshita T, Nakamichi N. Direct repression of evening genes by CIRCADIAN CLOCK-ASSOCIATED1 in the Arabidopsis circadian clock. Plant Cell, 2016, 28:696-711.
doi: 10.1105/tpc.15.00737
[1] Lu Yi-Chu, Li Zhen-Ying, Mai Chun-Hai, Zhao Xiao-Rui, Wang Li-Xiang. Positively regulating role of the key evening complex gene AhLUX1 in peanut nodulation [J]. Acta Agronomica Sinica, 2026, 52(6): 1658-1668.
[2] Ma Yi-Na, Wu Xiao-Ming-Yu, Li Ou-Qi, Wang Yuan, Chen Li, Zhang Ying-Chuan, Zhao Lun, Wen Jing, Fu Ting-Dong, Shen Jin-Xiong. Functional analysis of the Bna-miR1040-EIF3A module in regulating flowering time in rapeseed (Brassica napus) [J]. Acta Agronomica Sinica, 2026, 52(2): 349-362.
[3] WANG Qiong, ZOU Dan-Xia, CHEN Xing-Yun, ZHANG Wei, ZHANG Hong-Mei, LIU Xiao-Qing, JIA Qian-Ru, WEI Li-Bin, CUI Xiao-Yan, CHEN Xin, WANG Xue-Jun, CHEN Hua-Tao. Genome-wide association analysis and candidate genes prediction of flowering time and maturity date traits in soybean (Glycine max L.) [J]. Acta Agronomica Sinica, 2025, 51(6): 1558-1568.
[4] LI Wen-Jia, LIAO Yong-Jun, HUANG Lu, LU Qing, LI Shao-Xiong, CHEN Xiao-Ping, JIN Jing-Wei, WANG Run-Feng. Genome-wide associate analysis of flowering traits and identification of candidate genes in peanut [J]. Acta Agronomica Sinica, 2025, 51(5): 1400-1408.
[5] YANG Fang-Ping, GUO Ying, TIAN Yuan-Yuan, XU Yu-Feng, WANG Lan-Lan, BAI Bin, ZHAN Zong-Bing, ZHANG Xue-Ting, XU Yin-Ping, LIU Jin-Dong. Effect of vernalization and photoperiod genes and evaluation of cold tolerance for wheat landraces from Gansu province, China [J]. Acta Agronomica Sinica, 2025, 51(2): 370-382.
[6] LI Jia-Xin, HUANG Ying-Ying, WU Lu-Mei, ZHAO Lun, YI Bin, MA Chao-Zhi, TU Jin-Xing, SHEN Jin-Xiong, FU Ting-Dong, WEN Jing. Phylogenetic and functional analysis of the BnaSLY1 genes in Brassica napus L. [J]. Acta Agronomica Sinica, 2025, 51(1): 44-57.
[7] LIU Wei, WANG Yu-Bin, LI Wei, ZHANG Li-Feng, XU Ran, WANG Cai-Jie, ZHANG Yan-Wei. Overexpression of soybean isopropyl malate dehydrogenase gene GmIPMDH promotes flowering and growth [J]. Acta Agronomica Sinica, 2024, 50(3): 613-622.
[8] HU Yan-Juan, XUE Dan, GENG Di, ZHU Mo, WANG Tian-Qiong, WANG Xiao-Xue. Mutation effects of OsCDF1 gene and its genomic variations in rice [J]. Acta Agronomica Sinica, 2023, 49(9): 2362-2372.
[9] QIAN Fu, ZHANG Zhan-Qin, CHEN Shu-Bin, DING Yong-Fu, SANG Zhi-Qin, LI Wei-Hua. Mining maize flowering traits related candidate genes based on GWAS and WGCNA data [J]. Acta Agronomica Sinica, 2023, 49(12): 3261-3276.
[10] LI Sheng-Ting, XU Yuan-Fang, CHANG Wei, LIU Ya-Jun, GU Yuan, ZHU Hong, LI Jia-Na, LU Kun. Bna.C02SWEET15 positively regulates the flowering time of rapeseed through photoperiodic pathway [J]. Acta Agronomica Sinica, 2022, 48(8): 1938-1947.
[11] JIA Xiao-Ping,YUAN Xi-Lei,LI Jian-Feng,WANG Yong-Fang,ZHANG Xiao-Mei,ZHANG Bo,QUAN Jian-Zhang,DONG Zhi-Ping. Photo-thermal interaction model under different photoperiod-temperature conditions and expression analysis of SiCCT gene in foxtail millet (Setaria italica L.) [J]. Acta Agronomica Sinica, 2020, 46(7): 1052-1062.
[12] Fang-Quan WANG,Fang-Jun FAN,Shi-Jian XIA,Shou-Yu ZONG,Tian-Qing ZHENG,Jun WANG,Wen-Qi LI,Yang XU,Zhi-Hui CHEN,Yan-Jie JIANG,Ya-Jun TAO,Wei-Gong ZHONG,Jie YANG. Interactive effects of the photoperiod-/thermo-sensitive genic male sterile genes tms5 and pms3 in rice [J]. Acta Agronomica Sinica, 2020, 46(3): 317-329.
[13] ZHANG Shuang-Shuang,WANG Li-Wei,YAO Nan,GUO Guang-Yan,XIA Yu-Feng,BI Cai-Li. Expression of OsUBA and its function in promoting seed germination and flowering [J]. Acta Agronomica Sinica, 2019, 45(9): 1327-1337.
[14] JIA Xiao-Ping,QUAN Jian-Zhang,WANG Yong-Fang,DONG Zhi-Ping,YUAN Xi-Lei,ZHANG Bo,LI Jian-Feng. Effects of different photoperiod conditions on agronomic traits of foxtail millet [J]. Acta Agronomica Sinica, 2019, 45(7): 1119-1127.
[15] Yun-Fu LI,Jing-Xian WANG,Yan-Fang DU,Hua-Wen ZOU,Zu-Xin ZHANG. Identification of indeterminate domain protein family genes associated with flowering time in maize [J]. Acta Agronomica Sinica, 2019, 45(4): 499-507.
Viewed
Full text


Abstract

Cited
  Shared   
  Discussed   
No Suggested Reading articles found!
Add: No. 80 Xueyuan South Rd, Beijing 100081, P. R. China E-mail: zwxb301@caas.cn
Supported by Beijing Magtech Co.Ltd