Welcome to Acta Agronomica Sinica，

Acta Agronomica Sinica ›› 2022, Vol. 48 ›› Issue (6): 1558-1565.doi: 10.3724/SP.J.1006.2022.14093

• RESEARCH NOTES • Previous Articles    

Cloning and expression analysis of voltage dependent anion channel (AhVDAC) gene in the geotropism response of the peanut gynophores

LI Hai-Fen(), WEI Hao, WEN Shi-Jie, LU Qing, LIU Hao, LI Shao-Xiong, HONG Yan-Bin, CHEN Xiao-Ping, LIANG Xuan-Qiang*()   

  1. Crops Research Institute, Guangdong Academy of Agricultural Science / Guangdong Provincial Key Laboratory of Crop Genetic Improvement, Guangzhou 510640, Guangdong, China
  • Received:2021-05-18 Accepted:2021-09-10 Online:2022-06-12 Published:2021-10-12
  • Contact: LIANG Xuan-Qiang E-mail:lihaifen@gdaas.cn;liangxuanqiang@gdaas.cn
  • Supported by:
    Key-Area Research and Development Program of Guangdong Province(2020B020219003);China Agriculture Research System of the Ministry of Finance and Ministry of Agriculture and Rural Affairs, and the Agricultural Competitive Industry Discipline Team Building Project of Guangdong Academy of Agricultural Science(202104TD)

RichHTML399

8

PDF

463

Abstract:

Peanut is a plant that blooms above ground and bears fruit underground. In our earlier studies, the voltage dependent anion channel (AhVDAC) gene was detected to be involved in gravitropism of peanut gynophores. In this study, the full-length cDNA of peanut AhVDAC gene was cloned, and the prokaryotic expression, subcellular localization, and the relative expression level of AhVDAC gene in gravitropism were analyzed. The results showed that the open reading frame of AhVDAC gene was 831 bp encoding a protein containing 276 amino acids, with a molecular weight of 29.7 kD and pI 6.38. Subcellular localization showed that AhVDAC gene was mainly located in cytoplasm. The prokaryotic expression vector pPROEXHTa-AhVDAC was constructed, and the 37 kD AhVDAC protein was induced, isolated, and purified. The relative expression level of AhVDAC in gynophores at different developmental days was analyzed by RT-PCR, and the results showed that the relative expression level of AhVDAC gene was the highest at the 2nd day, and then decreased gradually and maintained at a lower level. The application of exogenous CaCl2 and LaCl3 to peanut gynophores in vitro revealed that CaCl2 treatment could significantly promote the relative expression of AhVDAC gene and the geotropic bending of gynophores, whereas LaCl3 treatment could decelerate the relative expression of AhVDAC gene and geotropic bending of gynophores. In conclusion, we speculated that Ca2+ accumulation may promote the expression of AhVDAC and Ca2+was asymmetrically distributed through the transport of AhVDAC on biological membrane, so that the growth direction of peanut gynophore was changed and geotropic bending occurs.

Key words: peanut, gynophore, the voltage dependent anion channel gene (AhVDAC), clone, gene expression

Table 1

Primers used for this study"

引物用途
Primer function		 引物名称
Primer name		 引物序列
Primer sequence (5°-3°)
基因克隆
Gene cloning		 AhVDAC-F ATGGTGAATGGTCCAGGTCTCTACT
AhVDAC-R CTAAGGCTTCAAGGCCACGG
亚细胞定位
Subcellular localization		 VDAC-M3 CGGGATCCATGGTGAATGGTCCAGGTCTC
VDAC-M4 AACTGCAGAGGCTTCAAGGCCACGG
原核表达载体构建
Construction of prokaryotic expression vector		 VDAC-M1 AACTGCAGTGGTGAATGGTCCAGGTCTCTACT
VDAC-M2 CCCAAGCTTCTA AGGCTTCAAGGCCACGG
荧光定量
Fluorescence quantitative PCR		 AhVDAC-qF GTAAGCCCGTTGACAAACACTG
AhVDAC-qR CACCAATGTTAGGGGGTCAAG
内参引物
Reference gene primer		 18S rRNA-F CAGCTCGCGTTGACTACG
18S rRNA-R CGAACACTTCACCGGACCAT

Fig. 1

cDNA sequence of AhVDAC gene and amino acids sequence (A), secondary structure (B), and three-dimensional structure (C) prediction of VDAC protein"

Fig. 2

Phylogenetic tree analysis of AhVDAC and VDAC from other plants The small red star in the figure represents the VDAC protein in the model plant Arabidopsis thaliana, and the small red dot represents the VDAC protein in peanut that is 100% similar to the gene cloned in this study."

Fig. 3

Subcelluar localization of the AhVDAC in nion epidermal cells A: blank control; B: the localization of pCAMBIA1301-CaMV35S-GFP; C: the localization of pCAMBIA1301-CaMV35S-AhVDAC-GFP."

Fig. 4

Identification of the pPROEX HTa-AhVDAC in BL21(DE3)pLysS by recombination plasmid PCR and Bacilli PCR and restriction digestion from recombination plasmid A: identification of recombination plasmid PCR; B: identification of Bacilli PCR; C: the restriction digestion by Pst I and Hind III. M: DNA marker DL2000; M1: DNA marker Hind IIIλ; M2: DNA marker DL2000."

Fig. 5

SDS-PAGE analysis of AhVDAC and protein purification 1: non-induced protein of BL21(DE3)pLysS with pPROEXHTa-AhVDAC; 2-7: induced protein of BL21(DE3)pLysS with pPROEX HTa-AhVDAC from 1 to 6 hours; M: protein molecular mass marker. B: purification the induced protein of BL21(DE3)pLysS with pPROEX HTa-AhVDAC at 6 h."

Fig. 6

Expression level of AhVDAC in different development stages of peanut gynophore Values with different lowercase letters show significant difference among different stages at the 0.05 probability level."

Fig. 7

Bending angle (A) and expression level (B) of AhVDAC in the peanut gynophores under the CaCl2 and LaCl3 treatments"

[1] Li H F, Zhu F H, Li H Y, Zhu W, Chen X P, Hong Y B, Liu H Y, Hong W, Liang X Q. Proteomic identification of gravitropic response genes in peanut gynophores. J Proteomics, 2013, 93: 303-313.
doi: 10.1016/j.jprot.2013.08.006
[2] Takahashi Y, Tateda C. The functions of voltage-dependent anion channels in plants. Apoptosis, 2013, 18: 917-924.
doi: 10.1007/s10495-013-0845-3
[3] Yan J P, He H, Tong S B, Zhang W R, Wang J M, Li X F, Yang Y. Voltage-dependent anion channel 2 of Arabidopsis thaliana (AtVDAC2) is involved in aba-mediated early seedling development. Int J Mol Sci, 2009, 10: 2476-2486.
doi: 10.3390/ijms10062476
[4] Tateda C, Watanabe K, Kusano T, Takahashi Y. Molecular and genetic characterization of the gene family encoding the voltage- dependent anion channel in Arabidopsis. J Exp Bot, 2011, 62: 4773-4785.
doi: 10.1093/jxb/err113 pmid: 21705391
[5] Wandrey M, Trevaskis B, Brewin N, Udvardi M K. Molecular and cell biology of a family of voltage-dependent anion channel porins in Lotus japonicus. Plant Physiol, 2004, 134: 182-193.
pmid: 14657408
[6] Smack D P, Colombini M. Voltage-dependent channels found in the membrane fraction of corn mitochondria. Plant Physiol, 1985, 79: 1094-1097.
doi: 10.1104/pp.79.4.1094 pmid: 16664537
[7] Al Bitar F, Roosens N, Smeyers M, Vauterin M, Van B J, Jacobs M, Homble F. Sequence analysis, transcriptional and posttranscriptional regulation of the rice vdac family. Biochim Biophys Acta, 2003, 1625: 43-51.
[8] Heins L, Mentzel H, Schmid A, Benz R, Schmitz U K. Biochemical, molecular, and functional characterization of porin isoforms from potato mitochondria. J Biol Chem, 1994, 269: 26402-26410.
pmid: 7929361
[9] Elkeles A, Breiman A, Zizi M. Functional differences among wheat voltage-dependent anion channel (VDAC) isoforms expressed in yeast. Indication for the presence of a novel VDAC-modulating protein? J Biol Chem, 1997, 272: 6252-6260.
doi: 10.1074/jbc.272.10.6252 pmid: 9045642
[10] Elkeles A, Devos K M, Graur D, Zizi M, Breiman A. Multiple cDNAs of wheat voltage-dependent anion channels (VDAC): isolation, differential expression, mapping and evolution. Plant Mol Biol, 1995, 29: 109-124.
pmid: 7579156
[11] Hodge T, Colombini M. Regulation of metabolite flux through voltage-gating of VDAC channels. J Membr Biol, 1997, 157: 271-279.
doi: 10.1007/s002329900235
[12] Shimizu S, Narita M, Tsujimoto Y. Bcl-2 family proteins regulate the release of apoptogenic cytochrome c by the mitochondrial channel VDAC. Nature, 1999, 399: 483-487.
doi: 10.1038/20959
[13] 田绍泽, 刘思禹, 王坤, 殷倩, 岳远征, 胡惠蓉. 植物线粒体电压依赖性阴离子通道蛋白VDAC综述. 分子植物育种, 2019, 17: 7401-7407.
Tian S Z, Liu S Y, Wang K, Yin Q, Yue Y Z, Hu H R. The review of voltage-dependent anion channels VDACs in plants. Mol Plant Breed, 2019, 17: 7401-7407 (in Chinese with English abstract).
[14] Szabadkai G, Bianchi K, Várnai P, Stefani D D, Wieckowski M R, Cavagna D, Nagy A I, Balla T, Rizzuto R. Chaperone-mediated coupling of endoplasmic reticulum and mitochondrial Ca2+ channels. J Cell Biol, 2006, 175: 901-911.
pmid: 17178908
[15] Shoshan-Barmatz V, Pinto V D, Zweckstetter M, Raviv Z, Keinan N, Arbel N. VDAC, a multi-functional mitochondrial protein regulating cell life and death. Mol Aspects Med, 2010, 31: 227-285.
doi: 10.1016/j.mam.2010.03.002 pmid: 20346371
[16] Hepler P. Tip growth in pollen tubes: calcium leads the way. Trends Plant Sci, 1997, 2: 79-80.
doi: 10.1016/S1360-1385(97)88385-9
[17] Malho R, Read N D, Trewavas A J, Pais M S. Calcium channel activity during pollen tube growth and reorientation. Plant Cell, 1995, 7: 1173-1184.
doi: 10.2307/3870093
[18] Young M J, Bay D C, Hausner G, Court D A. The evolutionary history of mitochondrial porins. BMC Evol Biol, 2007, 7: 31.
doi: 10.1186/1471-2148-7-31
[19] Gincel D, Vardi N, Shoshan-Barmatz V. Retinal voltage- dependent anion channel: characterization and cellular localization. Invest Ophthalmol Vis Sci, 2002, 43: 2097-2104.
[20] Shoshan-Barmatz V, Gincel D. The voltage-dependent anion channel: characterization, modulation, and role in mitochondrial function in cell life and death. Cell Biochem Biophys, 2003, 39: 279-292.
pmid: 14716081
[21] Deniaud A, Rossi C, Berquand A, Homand J, Campagna S, Knoll W, Brenner C, Chopineau J. Voltage-dependent anion channel transports calcium ions through biomimetic membranes. Langmuir, 2007, 23: 3898-3905.
doi: 10.1021/la063105+
[22] Tan W, Colombini M. VDAC closure increases calcium ion flux. Biochim Biophys Acta, 2007, 1768: 2510-2515.
[23] Bathori G, Csordas G, Garcia-Perez C, Davies E, Hajnoczky G. Ca2+-dependent control of the permeability properties of the mitochondrial outer membrane and voltage-dependent anion- selective channel (VDAC). J Biol Chem, 2006, 281: 17347-17358.
doi: 10.1074/jbc.M600906200
[24] Kordyum E L. Calcium signaling in plant cells in altered gravity. Adv Space Res, 2003, 32: 1621-1630.
doi: 10.1016/S0273-1177(03)90403-0 pmid: 15002419
[25] Sinclair W, Trewavas A J. Calcium in gravitropism. A re-examination. Planta, 1997, 203: S85-S90.
doi: 10.1007/pl00008120 pmid: 11540333
[26] Trewavas A J, Malhó R. Ca2+ signalling in plant cells: the big network! Curr Opin Plant Biol, 1998, 1: 428-433.
pmid: 10066614
[27] Shoshan-Barmatz V, Israelson A. The voltage-dependent anion channel in endoplasmic/ sarcoplasmic reticulum: characterization, modulation and possible function. J Membr Biol, 2004, 204: 57-66.
doi: 10.1007/s00232-005-0749-4
[28] Sabirov R Z, Okada Y. The maxi-anion channel: a classical channel playing novel roles through an unidentified molecular entity. J Physiol Sci, 2009, 59: 3-21.
doi: 10.1007/s12576-008-0008-4
[29] Zhou L M, Lan W Z, Jiang Y Q, Fang W, Luan S. A calcium-dependent protein kinase interacts with and activates A calcium channel to regulate pollen tube growth. Mol Plant, 2014, 7: 369-376.
doi: 10.1093/mp/sst125
[30] Messerli M, Robinson K R. Tip localized Ca2+ pulses are coincident with peak pulsatile growth rates in pollen tubes of Lilium longiflorum. J Cell Sci, 1997, 110: 1269-1278.
doi: 10.1242/jcs.110.11.1269
[1] Zheng Yu-Zhen, Qi Fei-Yan, Sun Zi-Qi, Liu Hua, Qin Li, Shi Lei, Wang Juan, Wang Meng-Meng, Han Suo-Yi, Xu Jing, Miao Li-Juan, Huang Bing-Yan, Dong Wen-Zhao, Zheng Zheng, Zhang Xin-You. QTL mapping of total very long-chain fatty acids and seven fatty acid components in peanut seeds [J]. Acta Agronomica Sinica, 2026, 52(6): 1646-1657.
[2] Lu Yi-Chu, Li Zhen-Ying, Mai Chun-Hai, Zhao Xiao-Rui, Wang Li-Xiang. Positively regulating role of the key evening complex gene AhLUX1 in peanut nodulation [J]. Acta Agronomica Sinica, 2026, 52(6): 1658-1668.
[3] Yu Tian-Yi, Wang Chun-Xiao, Xiao Li, Zhong Zhao-Di, Wang Xuan-Cang, Zhao Yong, Lu Ya, Wu Yue, Wu Zheng-Feng. Response of nitrogen accumulation, yield, and quality characteristics of peanut varieties with different nodulation traits to nitrogen fertilizer application rate [J]. Acta Agronomica Sinica, 2026, 52(3): 881-894.
[4] Zhang Sheng-Zhong, Li Guo-Wei, Ge Li-Jiang, Wang Fei-Fei, Hu Xiao-Hui, Miao Hua-Rong, Li Yan, Zhong Wen, Chen Jing. Screening and QTL mapping for mechanical shelling damage related traits in peanut [J]. Acta Agronomica Sinica, 2026, 52(2): 644-652.
[5] Yu Kai-Hang, Zhou Hong-Bin, Luo Liang-Zha, Wang Mei-Li, Jiang Rui-Mei, Dong-Chen Wen-Hua, Li Shi-Jin, Mao Xiao-Qiang, Chen Sheng-Wei. Cloning and expression analysis of the HvLRR-RLK-510 gene encoding a leucine-rich repeat receptor-like kinase in barley [J]. Acta Agronomica Sinica, 2026, 52(2): 421-432.
[6] Zhan Ge-Rui, Yu Wen, Li Feng, Wu Ming-Zhu, Xu Xin, Luo Zhao-Peng, Wu Sheng-Xin, Yang Jun, Zhang Zhi-Qiang, Wang Zhong. Functional study of NtWRKY6 in response to ABA expression and regulation of polyphenol synthesis [J]. Acta Agronomica Sinica, 2026, 52(2): 446-458.
[7] Wang Fei-Fei, Zhang Sheng-Zhong, Yang Gui-Hua, Miao Hua-Rong, Hu Xiao-Hui, Zhang Ze-Lin, Liu Sha-Sha, Qiao Li-Xian, Shan Shi-Hua, Chen Jing. Comprehensive evaluation of salt tolerance and identification of elite salt-tolerant germplasm in 331 peanut accessions at seedling stage [J]. Acta Agronomica Sinica, 2026, 52(1): 279-294.
[8] Jin Xin-Xin, Song Ya-Hui, Su Qiao, Yang Yong-Qing, Wang Jin. Growth and dry matter production characteristics of high-yielding, high-oil, and high oleic acid peanut varieties [J]. Acta Agronomica Sinica, 2026, 52(1): 191-201.
[9] Chi Xiao-Yuan, Liu Qing, Zhang Jun, Zhao Xu-Hong, Li Mei, Yu Tian-Yi, Pan Li-Juan, Xu Jing, Jiang Xiao, Yin Xiang-Zhen, Ma Jun-Qing, Chen Na. Field evaluation of salt-alkaline tolerance and trait correlation analysis in different peanut varieties (lines) [J]. Acta Agronomica Sinica, 2026, 52(1): 85-98.
[10] Sun Chen-Shuo, Zhang Yue, Tian Ze-Kai, Yan Li-Ying, Kang Yan-Ping, Chen Yu-Ning, Wang Xin, Huai Dong-Xin, Wang Qian-Qian, Jiang Hui-Fang, Luo Huai-Yong, Huang Li, Liao Bo-Shou, Wang Zhi-Hui, Lei Yong. Genetic differentiation of peg strength and analysis of major influencing factors in peanut germplasm [J]. Acta Agronomica Sinica, 2026, 52(1): 118-130.
[11] Jing Xiu-Qing, Cai Yong-Duo, Deng Ning, Zhao Xiao-Dong, Zhai Fei-Hong, Zeng Qun. Identification and expression pattern analysis of RopGEF family genes in Chenopodium quinoa [J]. Acta Agronomica Sinica, 2026, 52(1): 28-43.
[12] WAN Shu-Bo, ZHANG Jia-Lei, GAO Hua-Xin, WANG Cai-Bin. Advances and prospects of high-yield peanut cultivation in China [J]. Acta Agronomica Sinica, 2025, 51(7): 1703-1711.
[13] GUO Teng-Da, CUI Meng-Jie, CHEN Lin-Jie, HAN Suo-Yi, GUO Jing-Kun, WU Chen-Di, FU Liu-Yang, HUANG Bing-Yan, DONG Wen-Zhao, ZHANG Xin-You. Cloning and expression analysis of the phosphatidylinositol transfer protein AhSFH gene in peanuts responsive to Aspergillus flavus infection [J]. Acta Agronomica Sinica, 2025, 51(6): 1489-1500.
[14] LI Wen-Jia, LIAO Yong-Jun, HUANG Lu, LU Qing, LI Shao-Xiong, CHEN Xiao-Ping, JIN Jing-Wei, WANG Run-Feng. Genome-wide associate analysis of flowering traits and identification of candidate genes in peanut [J]. Acta Agronomica Sinica, 2025, 51(5): 1400-1408.
[15] LIN Wei-Jin, GUO Ze-Jia, LIU Hao, LI Hai-Fen, WANG Run-Feng, HUANG Lu, YU Qian-Xia, CHEN Xiao-Ping, HONG Yan-Bin, LI Shao-Xiong, LU Qing. QTL mapping and candidate gene analysis of peanut pod yield-related traits [J]. Acta Agronomica Sinica, 2025, 51(4): 969-981.
Viewed
Full text


Abstract

Cited
  Shared   
  Discussed   
No Suggested Reading articles found!
Add: No. 80 Xueyuan South Rd, Beijing 100081, P. R. China E-mail: zwxb301@caas.cn
Supported by Beijing Magtech Co.Ltd