Welcome to Acta Agronomica Sinica，

Acta Agronomica Sinica ›› 2022, Vol. 48 ›› Issue (12): 3004-3017.doi: 10.3724/SP.J.1006.2022.13060

;

• CROP GENETICS & BREEDING · GERMPLASM RESOURCES · MOLECULAR GENETICS • Previous Articles     Next Articles

Response of maize transcriptional factor ZmbHLH91 to abiotic stress

YUE Man-Fang1,2(), ZHANG Chun2(), ZHENG Deng-Yu2, ZOU Hua-Wen1(), WU Zhong-Yi2()   

  1. 1College of Agriculture, Yangtze University, Jingzhou 434025, Hubei, China
    2Institute of Biotechnology, Beijing Academy of Agriculture and Forestry Sciences / Beijing Key Laboratory of Agricultural Gene Resources and Biotechnology, Beijing 100097, China
  • Received:2021-10-25 Accepted:2022-02-25 Online:2022-12-12 Published:2022-04-01
  • Contact: ZOU Hua-Wen,WU Zhong-Yi E-mail:2278874241@qq.com;spring2007318@163.com;zouhuawen73@hotmail.com;zwu22@126.com
  • About author:First author contact:

    **Contributed equally to this work

  • Supported by:
    National Natural Science Foundation of China(32001430);National Natural Science Foundation of China(32171952);National Natural Science Foundation of China(31971839);Beijing Academy of Agriculture and Forestry Sciences(KJCX20200205);Beijing Academy of Agriculture and Forestry Sciences(KJCX20200407)

RichHTML405

43

PDF

431

Abstract:

bHLH (basic helix-loop-helix) is an important transcription factor family in plants and play an important role in regulating plant growth and development, adversity stress, and signal transduction. At present, most bHLH transcription factor function in animals is clear, but there are few studies reported in plants, especially in maize. In the early work, we carried out root phenotype identification and transcriptome sequencing analysis in the four key periods of maize growth and development. There was significantly differentially expressed in ZmbHLH91 during the adjacent periods of the sixth leaf stage (V6), the twelfth leaf stage (V12), and the tasseling stage (VT). The relative expression levels of ZmbHLH91 were higher in V6, V12, and VT, which were the active periods of root growth and development. We speculated that ZmbHLH91 may have important regulatory effect on the growth and development of maize root system. To study the function of ZmbHLH91 in root growth and response to stress, in this study, we cloned ZmbHLH91 (AC:NC_AQL05369) gene. This gene was 2112 bp in full-length with a unique conserved domain of the bHLH transcription factor family. The RT-qPCR analysis showed that ZmbHLH91 had a higher expression in roots, whereas, the expression in the third leaf young root was higher than that in the tasseling mature root. While under different adversity stress, ZmbHLH91 was up-regulated. There was no significant difference in root length between ZmbHLH91 transgenic Arabidopsis strains and wild type on a 1/2 MS medium without stress treatment, but the root length of ZmbHLH91 transgenic Arabidopsis lines was longer than that of wild type on the medium treated with gradient concentrations NaCl and mannitol, and the difference was significant. Compared to the wild type, transgenic Arabidopsis lines revealed better growth status, higher peroxidase (POD) activity, higher green leaf rate after drought, and higher salt treatment in the soil. It is speculated that the ZmbHLH91 gene may be involved in responding to high salt, drought, and osmotic stress. The ZmbHLH91 was also up-regulated under jasmonic acid (JA), abscisic acid (ABA), and other hormone treatments. On the medium treated with gradient concentration JA, the root length of ZmbHLH91 transgenic Arabidopsis lines was longer than that of wild type, and the difference was significant. ZmbHLH91 interacted with the ZmMYC2 proved by yeast two hybrid system, speculating that it may be involved in the JA signaling pathway. In conclusion, ZmbHLH91 may be involved in high salt, drought, and osmosis stress response and JA signal transduction pathways. This study provides an important reference for further analysis of the biological functions of ZmbHLH91 in maize.

Key words: maize, ZmbHLH91, salt stress, osmotic stress, yeast two-hybrid, signal transduction

Fig. 2

Relative expression level of ZmbHLH91 genes A: relative expression level of ZmbHLH91 in different maize tissues; B: relative expression level of ZmbHLH91gene at V6, V12, VT, and R3 stage; C-F: relative expression level of ZmbHLH91 after dehydration, high salt, osmosis, and cold treatment; G: relative expression level of ZmbHLH91 after different phytohormone treatments. The error bar represents ± SD of three biological replication. Different lowercase letters are significantly different at the 0.05 probability level; *: P < 0.05; **: P < 0.01."

Table 1

Primers used in this study"

引物名称
Primer name		 引物序列
Primer sequence (5'-3')
pZmbHLH91-F TGAAATCACCAGTCGGTACCATGAACCTGTGGACGGACGA (Kpn I)
pZmbHLH91-R CCCTTGCTCACCATGGTACCCCTGCCCATGACAGACCCGG (Kpn I)
pZmbHLH91RT-F1 GTGGACATCAAGGATTCCTACT
pZmbHLH91RT-R1 GAAATCCGAGAAGTTGAGCTCC
pZmbHLH91RT-F2 TCCATGACGCAGTCCTTCCTCAACGG
pZmbHLH91RT-R2 ATGGTCTCGGCGGTCTGGAACACG
pZmbHLH91JM-F GGCCATGGAGGCCGAATTCATGAACCTGTGGACGGACGAC (EcoR I)
pZmbHLH91JM-R TATGCTAGTTATGCGGCCGCTTACCTGCCCATGACAGACC (BamH I)
pGAPDHRT-F CCCTTCATCACCACGGACTAC
pGAPDHRT-R AACCTTCTTGGCACCACCCT
pActinRT-F1 GGTAACATTGTGCTCAGTGGTGG
pActinRT-R1 AACGACCTTAATCTTCATGCTGC
pActinRT-F2 TACGAGATGCCTGATGGTCAGGTCA
pActinRT-R2 TGGAGTTGTACGTGGCCTCATGGAC

Fig. 1

Bioinformatics analysis of ZmbHLH91 A: amino acid sequence alignment; B: transmembrane structure prediction; C: protein tertiary structure prediction; D: promoter analysis of ZmbHLH91."

Fig. 3

PCR detection and relative expression level of T3 generation Arabidopsis A: PCR detection of T3 generation Arabidopsis; B: RT-qPCR detection of T3 generation Arabidopsis. M: DL5000 marker; P: positive control; N: negative control; W: water control; WT: wild-type Arabidopsis; L-1-L-6: T3 Arabidopsis; **: P < 0.01."

Fig. 4

Root length of transgenic Arabidopsis thaliana on gradient NaCl concentrations A-D indicate the seedling growth under the NaCl concentrations of 0, 0.10, 0.15, and 0.18 mol L-1, respectively; E: the average main root length. WT: wild type; L-1, L-2, and L-3: ZmbHLH91 transgenic Arabidopsis thaliana; Bar: 1.5 cm; *: P < 0.05; **: P < 0.01."

Fig. 5

Root length of transgenic Arabidopsis thaliana on gradient mannitol concentrations A-D indicate the seedling growth under the mannitol concentrations of 0, 0.15, 0.20, and 0.30 mol L-1, respectively; E: the average main root length. Abbreviation are the same as those given in Fig. 4; Bar: 1.5 cm; *: P < 0.05; **: P < 0.01."

Fig. 6

Root length of transgenic Arabidopsis thaliana on gradient ABA and JA concentrations A: the seedling growth under the ABA concentrations of 0, 10, 25, and 50 µmol L-1, respectively; B: the average main root length under the ABA concentrations of 0, 10, 25, and 50 µmol L-1, respectively; C: the seedling growth under the JA concentrations of 0, 50, 75, and 100 µmol L-1, respectively; E: the average main root length under the JA concentrations of 0, 50, 75, and 100 µmol L-1, respectively. Abbreviations are the same as those given in Fig. 4; Bar: 1.5 cm; *: P < 0.05; **: P < 0.01."

Fig. 7

Analysis of transgenic Arabidopsis under drought treatment A: the phenotype of Arabidopsis thaliana; B: POD activity; C: the rate of green leaves under drought treatment; D: the rate of green leaves under Re-water treatment. Abbreviations are the same as those given in Fig. 4; **: P < 0.01."

Fig. 8

Analysis of transgenic Arabidopsis under high salt treatment A: the phenotype of Arabidopsis thaliana; B: POD activity; C: the rate of green leaves under high salt treatment. Abbreviations are the same as those given in Fig. 4; **: P < 0.01."

Fig. 9

Factors of maize interact with ZmbHLH91 AD: pGADT7; BK: pGBKT7; SD2: Synthetic Dropout Medium without Leu-Trp; SD4: Synthetic Dropout Medium without Leu-Trp-His-Ade; P: positive control (pGADT7-largeT+ pGBKT7-p53); N: negative control (pGADT7-largeT+pGBKT7-laminC)."

[1] Mao H, Yu L, Han R, Li Z, Liu H. ZmNAC55, a maize stress-responsive NAC transcription factor, confers drought resistance in transgenic Arabidopsis. Plant Physiol Biochem, 2016, 105: 55-66.
doi: 10.1016/j.plaphy.2016.04.018
[2] Li F, Liu W. Genome-wide identification, classification, and functional analysis of the basic helix-loop-helix transcription factors in the cattle, Bos Taurus. Mamm Genome, 2017, 28: 176-197.
doi: 10.1007/s00335-017-9683-x pmid: 28299435
[3] Murre C, McCaw P S, Vaessin H, Caudy M, Jan L Y, Jan Y N, Cabrera C V, Buskin J N, Hauschka S D, Lassar A B. Interactions between heterologous helix-loop-helix proteins generate complexes that bind specifically to a common DNA sequence. Cell, 1989, 58: 537-544.
pmid: 2503252
[4] Jones S. An overview of the basic helix-loop-helix proteins. Genome Biol, 2004, 5: 226.
pmid: 15186484
[5] Murre C, McCaw P S, Baltimore D. A new DNA binding and dimerization motif in immunoglobulin enhancer binding, daughterless, MyoD, and myc proteins. Cell, 1989, 56: 777-783.
pmid: 2493990
[6] Wang C X, Qi C Y, Luo J H, Liu L, He Y, Chen L Q. Characterization of LRL5 as a key regulator of root hair growth in maize. Plant J, 2019, 98: 71-82.
doi: 10.1111/tpj.14200
[7] Jaqueth J S, Hou Z, Zheng P, Ren R, Nagel B A, Cutter G, Niu X, Vollbrecht E, Greene T W, Kumpatla S P. Fertility restoration of maize CMS-C altered by a single amino acid substitution within the Rf4 bHLH transcription factor. Plant J, 2020, 101: 101-111.
doi: 10.1111/tpj.14521
[8] Aslam M, Jakada B H, Fakher B, Greaves J G, Niu X, Su Z, Cheng Y, Cao S, Wang X, Qin Y. Genome-wide study of pineapple (Ananas comosus L.) bHLH transcription factors indicates that cryptochrome-interacting bHLH2 (AcCIB2) participates in flowering time regulation and abiotic stress response. BMC Genomics, 2020, 21: 735.
doi: 10.1186/s12864-020-07152-2
[9] Fan Y, Peng J, Wu J, Zhou P, He R, Allan A C, Zeng L. NtbHLH1, a JAF13-like bHLH, interacts with NtMYB6 to enhance proanthocyanidin accumulation in Chinese Narcissus. BMC Plant Biol, 2021, 21: 275.
doi: 10.1186/s12870-021-03050-1
[10] Guo J, Li W, Shang L, Wang Y, Yan P, Bai Y, Da X, Wang K, Guo Q, Jiang R, Mao C, Mo X. OsbHLH98 regulates leaf angle in rice through transcriptional repression of OsBUL1. New Phytol, 2021, 230: 1953-1966.
doi: 10.1111/nph.17303
[11] Nowak K, Gaj M D. Stress-related function of bHLH109 in somatic embryo induction in Arabidopsis. J Plant Physiol, 2016, 193: 119-126.
doi: 10.1016/j.jplph.2016.02.012
[12] Zhang L, Kang J, Xie Q, Gong J, Shen H, Chen Y, Chen G, Hu Z. The basic helix-loop-helix transcription factor bHLH95 affects fruit ripening and multiple metabolisms in tomato. J Exp Bot, 2020, 71: 6311-6327.
doi: 10.1093/jxb/eraa363
[13] Ortolan F, Fonini L S, Pastori T, Mariath J E A, Saibo N J M, Margis-Pinheiro M, Lazzarotto F. Tightly controlled expression of OsbHLH35 is critical for another development in rice. Plant Sci, 2021, 302: 110716.
[14] 汪德州, 莫小婷, 张霞, 徐妙云, 张兰, 赵军, 王磊. 玉米转录因子ZmbHLH4基因的克隆及功能分析. 中国农业科技导报, 2018, 20(12): 16-25.
doi: 10.13304/j.nykjdb.2018.0189
Wang D Z, Mo X T, Zhang X, Xu M Y, Zhang L, Zhao J, Wang L. Cloning and functional analysis of transcription factors gene ZmbHLH4 from Zea mays. J Agric Sci Technol, 2018, 20(12): 16-25. (in Chinese with English abstract)
[15] Yang Y Y, Zheng P F, Ren Y R, Yao Y X, You C X, Wang X F, Hao Y J. Apple MdSAT1 encodes a bHLHm1 transcription factor involved in salinity and drought responses. Planta, 2021, 253: 46.
doi: 10.1007/s00425-020-03528-6
[16] Liu Y, Ji X, Nie X, Qu M, Zheng L, Tan Z, Zhao H, Huo L, Liu S, Zhang B, Wang Y. Arabidopsis AtbHLH112 regulates the expression of genes involved in abiotic stress tolerance by binding to their E-box and GCG-box motifs. New Phytol, 2015, 207: 692-709.
doi: 10.1111/nph.13387
[17] Yang X, Wang R, Hu Q, Li S, Mao X, Jing H, Zhao J, Hu G, Fu J, Liu C. DlICE1, a stress-responsive gene from Dimocarpus longan, enhances cold tolerance in transgenic Arabidopsis. Plant Physiol Biochem, 2019, 142: 490-499.
doi: 10.1016/j.plaphy.2019.08.007
[18] Zhao Q, Fan Z, Qiu L, Che Q, Wang T, Li Y, Wang Y. MdbHLH130, an apple bHLH transcription factor, confers water stress resistance by regulating stomatal closure and ROS homeostasis in transgenic tobacco. Front Plant Sci, 2020, 11: 543696.
[19] Babitha K C, Vemanna R S, Nataraja K N, Udayakumar M. Overexpression of EcbHLH57 transcription factor from Eleusine coracana L. in tobacco confers tolerance to salt, oxidative and drought stress. PLoS One, 2015, 10: e137098.
[20] Qian Y, Zhang T, Yu Y, Gou L, Yang J, Xu J, Pi E. Regulatory mechanisms of bHLH transcription factors in plant adaptive responses to various abiotic stresses. Front Plant Sci, 2021, 12: 677611.
[21] Li Z, Liu C, Zhang Y, Wang B, Ran Q, Zhang J. The bHLH family member ZmPTF1 regulates drought tolerance in maize by promoting root development and abscisic acid synthesis. J Exp Bot, 2019, 70: 5471-5486.
doi: 10.1093/jxb/erz307
[22] Chen H C, Cheng W H, Hong C Y, Chang Y S, Chang M C. The transcription factor OsbHLH035 mediates seed germination and enables seedling recovery from salt stress through ABA- dependent and ABA-independent pathways, respectively. Rice (New York), 2018, 11: 1-17.
[23] Zhao Q, Xiang X, Liu D, Yang A, Wang Y. Tobacco transcription factor NtbHLH123 confers tolerance to cold stress by regulating the NtCBF pathway and reactive oxygen species homeostasis. Front Plant Sci, 2018, 9: 381.
doi: 10.3389/fpls.2018.00381
[24] Liu H, Yang Y, Liu D, Wang X, Zhang L. Transcription factor TabHLH49 positively regulates dehydrin WZY2gene expression and enhances drought stress tolerance in wheat. BMC Plant Biol, 2020, 20: 259.
doi: 10.1186/s12870-020-02474-5
[25] Wei S, Xia R, Chen C, Shang X, Ge F, Wei H, Chen H, Wu Y, Xie Q. ZmbHLH124 identified in maize recombinant inbred lines contributes to drought tolerance in crops. Plant Biotechnol J, 2021, 19: 2069-2081.
doi: 10.1111/pbi.13637
[26] 杨梦婷, 张春, 王作平, 邹华文, 吴忠义. 玉米ZmbHLH161基因的克隆及功能研究. 作物学报, 2020, 46: 2008-2016.
doi: 10.3724/SP.J.1006.2020.03022
Yang M T, Zhang C, Wang Z P, Zou H W, Wu Z Y. Cloning and functional analysis of ZmbHLH161 gene in maize. Acta Agron Sin, 2020, 46: 2008-2016. (in Chinese with English abstract)
[27] Rabissi A, Vilela B, Lumbreras V, Ludevid D, Culiáñez-Macià F A, Pagés M. Molecular characterization of maize bHLH transcription factor (ZmKS), a new ZmOST1 kinase substrate. Plant Sci, 2016, 253: 1-12.
doi: S0168-9452(16)30423-X pmid: 27968978
[28] Duek P D, Fankhauser C. HFR1, a putative bHLH transcription factor, mediates both phytochrome A and cryptochrome signalling. Plant J, 2003, 34: 827-836.
pmid: 12795702
[29] Kiribuchi K, Jikumaru Y, Kaku H, Minami E, Hasegawa M, Kodama O, Seto H, Okada K, Nojiri H, Yamane H. Involvement of the basic helix-loop-helix transcription factor RERJ1in wounding and drought stress responses in rice plants. Biosci Biotechnol Biochem, 2005, 69: 1042-1044.
doi: 10.1271/bbb.69.1042
[30] Castillon A, Shen H, Huq E. Phytochrome Interacting Factors: central players in phytochrome-mediated light signaling networks. Trends Plant Sci, 2007, 12: 514-521.
doi: 10.1016/j.tplants.2007.10.001 pmid: 17933576
[31] Friedrichsen D M, Nemhauser J, Muramitsu T, Maloof J N, Alonso J, Ecker J R, Furuya M, Chory J. Three redundant brassinosteroid early response genes encode putative bHLH transcription factors required for normal growth. Genetics, 2002, 162: 1445-1456.
doi: 10.1093/genetics/162.3.1445 pmid: 12454087
[32] Seo J S, Joo J, Kim M J, Kim Y K, Nahm B H, Song S I, Cheong J J, Lee J S, Kim J K, Choi Y D. OsbHLH148, a basic helix-loop-helix protein, interacts with OsJAZ proteins in a jasmonate signaling pathway leading to drought tolerance in rice. Plant J, 2011, 65: 907-921.
doi: 10.1111/j.1365-313X.2010.04477.x
[33] Zhang T, Lv W, Zhang H, Ma L, Li P, Ge L, Li G. Genome-wide analysis of the basic Helix-Loop-Helix (bHLH) transcription factor family in maize. BMC Plant Biol, 2018, 18: 235.
doi: 10.1186/s12870-018-1441-z pmid: 30326829
[34] Zhang C, Li X, Wang Z, Zhang Z, Wu Z. Identifying key regulatory genes of maize root growth and development by RNA sequencing. Genomics, 2020, 112: 5157-5169.
doi: 10.1016/j.ygeno.2020.09.030 pmid: 32961281
[35] Clough S J, Bent A F. Floral dip: a simplified method for Agrobacterium mediated transformation of Arabidopsis thaliana. Plant J, 1998, 16: 735-743.
pmid: 10069079
[36] Chini A, Fonseca S, Fernández G, Adie B, Chico J M, Lorenzo O, García-Casado G, López-Vidriero I, Lozano F M, Ponce M R, Micol J L, Solano R. The JAZ family of repressors is the missing link in jasmonate signalling. Nature, 2007, 448: 666-671.
doi: 10.1038/nature06006
[37] Fernández-Calvo P, Chini A, Fernández-Barbero G, Chico J M, Gimenez-Ibanez S, Geerinck J, Eeckhout D, Schweizer F, Godoy M, Franco-Zorrilla J M, Pauwels L, Witters E, Puga M I, Paz-Ares J, Goossens A, Reymond P, De Jaeger G, Solano R. The Arabidopsis bHLH transcription factors MYC3 and MYC4 are targets of JAZ repressors and act additively with MYC2 in the activation of jasmonate responses. Plant Cell, 2011, 23: 701-715.
doi: 10.1105/tpc.110.080788
[38] Liu X, Galli M, Camehl I, Gallavotti A. RAMOSA1 ENHANCER LOCUS2-mediated transcriptional repression regulates vegetative and reproductive architecture. Plant Physiol, 2019, 179: 348-363.
doi: 10.1104/pp.18.00913 pmid: 30348817
[39] Fu J, Liu L, Liu Q, Shen Q, Wang C, Yang P, Zhu C, Wang Q. ZmMYC2 exhibits diverse functions and enhances JA signaling in transgenic Arabidopsis. Plant Cell Rep, 2020, 39: 273-288.
doi: 10.1007/s00299-019-02490-2
[1] Zuo Tong-Hong, Zhang He-Cui, Zeng Jing, Zhu Li-Quan. Molecular cloning and expression analysis of BoPUB3L associated with self-incompatibility in Brasscia oleracea [J]. Acta Agronomica Sinica, 2026, 52(6): 1698-1710.
[2] Liang Jin-Yu, Yin Jia-De, Wang Hong-Li, Zhang Guo-Ping, Hou Hui-Zhi, Dong Bo, Ma Ming-Sheng. Estimation of leaf nitrogen content in dryland forage maize using UAV-based hyperspectral imaging and machine learning [J]. Acta Agronomica Sinica, 2026, 52(6): 1788-1801.
[3] Zou Yi-Mei, Xu Min, Wang Hai-Yang, Yao Hui, Wang Jia-Feng, Liu Hao, Ren Dai-Sheng. Analysis of transcription factor regulatory networks in two-line male sterile rice seedling roots in response to salt stress [J]. Acta Agronomica Sinica, 2026, 52(6): 1728-1742.
[4] Sun Shu-Feng, Xu Zhen-Nan, Huang Jia-Xin, Weng Jian-Feng, Li Xin-Hai. Genome-wide identification of the maize MAPK gene family and its response to Fusarium verticillioides infection [J]. Acta Agronomica Sinica, 2026, 52(5): 1291-1308.
[5] Zhang Ning-Ning, Teng Yu-Fei, Ren Na-Na, Wei Xing-Zhuo, Yan Shu-Hao, Fan Ke-Xin, Wang Yong-Hong, Chen Wen-Kang, Zhang Xing-Hua, Zhu Wan-Chao, Xu Shu-Tu, Xue Ji-Quan. Phenotypic evaluation and plasticity analysis of drought resistance in 201 maize inbred lines [J]. Acta Agronomica Sinica, 2026, 52(5): 1309-1325.
[6] Yang Xin-Yu, Cui Wen-Tao, Dilinigeer Alimu, Wang Kai-Xiang, Wu Peng-Hao, Ren Jiao-Jiao. Genome-wide association and genomic selection analysis of the number of leaves above the ear in maize [J]. Acta Agronomica Sinica, 2026, 52(5): 1573-1590.
[7] Han Ya-Xin, He Guan-Hua, Zhang Xiao-Qiong, Zhang Deng-Feng, Li Yong-Xiang, Liu Xu-Yang, Wang Tian-Yu, Li Yu, Zou Hua-Wen, Li Chun-Hui. Identification of maize lateral root density genes resources through integrated RNA-seq and BSA-seq analyses [J]. Acta Agronomica Sinica, 2026, 52(5): 1341-1352.
[8] Zhang Hong-Rong, Wang Fei-Er, Li Pan, Qiu Hai-Long, Zhu Jing, Zhao Lian-Hao, Nan Yun-You, He Wei, Fan Zhi-Long, Hu Fa-Long, Chai Qiang, Yin Wen. Photosynthetic characteristics of 20% reduced irrigation combined with 25% organic substitution for chemical fertilizer in increasing silage maize yield [J]. Acta Agronomica Sinica, 2026, 52(5): 1487-1500.
[9] Yang Yang, Chang Shi-Hui, Tian Hong-Li, Yi Hong-Mei, Wang Lu, Ren Jie, Fan Ya-Ming, Liu Ya-Wei, Wang Feng-Ge, Zhao Jiu-Ran. Genetic diversity analysis of nationally approved maize varieties in different ecological regions [J]. Acta Agronomica Sinica, 2026, 52(5): 1352-1364.
[10] Cai Hong-Wei, Yu Ai-Zhong, Jiang Ke-Qiang, Wang Peng-Fei, Wang Yu-Long, Huo Jian-Zhe, Pang Xiao-Neng, Yin Bo, Shang Yong-Pan. Key mechanisms underlying the enhancement of sweet maize yield through partial substitution of chemical fertilizers with organic manure in arid irrigation districts [J]. Acta Agronomica Sinica, 2026, 52(4): 1166-1180.
[11] Tian Hong-Li, Yang Yang, Fan Ya-Ming, Yi Hong-Mei, Guo Dan-Dan, Wang Feng-Ge, Zhao Jiu-Ran. A novel set of tri-allelic variant SNP loci suitable for maize variety identification [J]. Acta Agronomica Sinica, 2026, 52(4): 993-1005.
[12] Song Yu-Zhen, Bheel Chander Kumar, Wang Yue, Zhang Ying-Xing, Guo Juan, Khound Rituraj, Santra Dipak Kumar, Cao Xiao-Ning, Wang Rui-Yun. Genome-wide identification of the AP2 subfamily in broomcorn millet and functional characterization of PmAP2-1 and PmAP2-9 in salt tolerance [J]. Acta Agronomica Sinica, 2026, 52(4): 1127-1139.
[13] Guo Xiang-Yang, Tu Liang, Wang Dong, Liu Peng-Fei, Wang An-Gui, Yi Qiang, Ren Hong, Li Gang, Zhu Yun-Fang, Wu Xun, Jiang Yu-Lin, Tian Feng, Chen Ze-Hui. Application and prospects of Suwan germplasm in maize breeding in China [J]. Acta Agronomica Sinica, 2026, 52(3): 655-664.
[14] Ma Liang, Ma Lu, Zhang Shu-Yu, Zhang Hui-Min, Wang Ren-Ming, Song Xu-Dong, Zhang Zhen-Liang, Mao Yu-Xiang, Lu Hu-Hua, Chen Guo-Qing, Hao De-Rong, Zhou Guang-Fei. Transcriptome analysis and identification of candidate genes associated with husk number in maize [J]. Acta Agronomica Sinica, 2026, 52(3): 790-801.
[15] Qin Yi-Yan, Fu Yao, Su Chang, Li Na, Xu Jing-Ru, Cheng Xiao-Ran, Zhang Qi, Zhao Ming-Hui. Functional analysis of OsST41 regulating salt tolerance in rice seedlings [J]. Acta Agronomica Sinica, 2026, 52(3): 802-812.
Viewed
Full text


Abstract

Cited
  Shared   
  Discussed   
No Suggested Reading articles found!
Add: No. 80 Xueyuan South Rd, Beijing 100081, P. R. China E-mail: zwxb301@caas.cn
Supported by Beijing Magtech Co.Ltd