Welcome to Acta Agronomica Sinica，

Acta Agronomica Sinica ›› 2022, Vol. 48 ›› Issue (12): 3004-3017.doi: 10.3724/SP.J.1006.2022.13060

• CROP GENETICS & BREEDING·GERMPLASM RESOURCES·MOLECULAR GENETICS • Previous Articles     Next Articles

Response of maize transcriptional factor ZmbHLH91 to abiotic stress

YUE Man-Fang1,2(), ZHANG Chun2(), ZHENG Deng-Yu2, ZOU Hua-Wen1(), WU Zhong-Yi2()   

  1. 1College of Agriculture, Yangtze University, Jingzhou 434025, Hubei, China
    2Institute of Biotechnology, Beijing Academy of Agriculture and Forestry Sciences / Beijing Key Laboratory of Agricultural Gene Resources and Biotechnology, Beijing 100097, China
  • Received:2021-10-25 Accepted:2022-02-25 Online:2022-12-12 Published:2022-04-01
  • Contact: ZOU Hua-Wen,WU Zhong-Yi E-mail:2278874241@qq.com;spring2007318@163.com;zouhuawen73@hotmail.com;zwu22@126.com
  • About author:First author contact:

    **Contributed equally to this work

  • Supported by:
    National Natural Science Foundation of China(32001430);National Natural Science Foundation of China(32171952);National Natural Science Foundation of China(31971839);Beijing Academy of Agriculture and Forestry Sciences(KJCX20200205);Beijing Academy of Agriculture and Forestry Sciences(KJCX20200407)

RichHTML405

36

PDF

316

Abstract:

bHLH (basic helix-loop-helix) is an important transcription factor family in plants and play an important role in regulating plant growth and development, adversity stress, and signal transduction. At present, most bHLH transcription factor function in animals is clear, but there are few studies reported in plants, especially in maize. In the early work, we carried out root phenotype identification and transcriptome sequencing analysis in the four key periods of maize growth and development. There was significantly differentially expressed in ZmbHLH91 during the adjacent periods of the sixth leaf stage (V6), the twelfth leaf stage (V12), and the tasseling stage (VT). The relative expression levels of ZmbHLH91 were higher in V6, V12, and VT, which were the active periods of root growth and development. We speculated that ZmbHLH91 may have important regulatory effect on the growth and development of maize root system. To study the function of ZmbHLH91 in root growth and response to stress, in this study, we cloned ZmbHLH91 (AC:NC_AQL05369) gene. This gene was 2112 bp in full-length with a unique conserved domain of the bHLH transcription factor family. The RT-qPCR analysis showed that ZmbHLH91 had a higher expression in roots, whereas, the expression in the third leaf young root was higher than that in the tasseling mature root. While under different adversity stress, ZmbHLH91 was up-regulated. There was no significant difference in root length between ZmbHLH91 transgenic Arabidopsis strains and wild type on a 1/2 MS medium without stress treatment, but the root length of ZmbHLH91 transgenic Arabidopsis lines was longer than that of wild type on the medium treated with gradient concentrations NaCl and mannitol, and the difference was significant. Compared to the wild type, transgenic Arabidopsis lines revealed better growth status, higher peroxidase (POD) activity, higher green leaf rate after drought, and higher salt treatment in the soil. It is speculated that the ZmbHLH91 gene may be involved in responding to high salt, drought, and osmotic stress. The ZmbHLH91 was also up-regulated under jasmonic acid (JA), abscisic acid (ABA), and other hormone treatments. On the medium treated with gradient concentration JA, the root length of ZmbHLH91 transgenic Arabidopsis lines was longer than that of wild type, and the difference was significant. ZmbHLH91 interacted with the ZmMYC2 proved by yeast two hybrid system, speculating that it may be involved in the JA signaling pathway. In conclusion, ZmbHLH91 may be involved in high salt, drought, and osmosis stress response and JA signal transduction pathways. This study provides an important reference for further analysis of the biological functions of ZmbHLH91 in maize.

Key words: maize, ZmbHLH91, salt stress, osmotic stress, yeast two-hybrid, signal transduction

Fig. 2

Relative expression level of ZmbHLH91 genes A: relative expression level of ZmbHLH91 in different maize tissues; B: relative expression level of ZmbHLH91gene at V6, V12, VT, and R3 stage; C-F: relative expression level of ZmbHLH91 after dehydration, high salt, osmosis, and cold treatment; G: relative expression level of ZmbHLH91 after different phytohormone treatments. The error bar represents ± SD of three biological replication. Different lowercase letters are significantly different at the 0.05 probability level; *: P < 0.05; **: P < 0.01."

Table 1

Primers used in this study"

引物名称
Primer name		 引物序列
Primer sequence (5'-3')
pZmbHLH91-F TGAAATCACCAGTCGGTACCATGAACCTGTGGACGGACGA (Kpn I)
pZmbHLH91-R CCCTTGCTCACCATGGTACCCCTGCCCATGACAGACCCGG (Kpn I)
pZmbHLH91RT-F1 GTGGACATCAAGGATTCCTACT
pZmbHLH91RT-R1 GAAATCCGAGAAGTTGAGCTCC
pZmbHLH91RT-F2 TCCATGACGCAGTCCTTCCTCAACGG
pZmbHLH91RT-R2 ATGGTCTCGGCGGTCTGGAACACG
pZmbHLH91JM-F GGCCATGGAGGCCGAATTCATGAACCTGTGGACGGACGAC (EcoR I)
pZmbHLH91JM-R TATGCTAGTTATGCGGCCGCTTACCTGCCCATGACAGACC (BamH I)
pGAPDHRT-F CCCTTCATCACCACGGACTAC
pGAPDHRT-R AACCTTCTTGGCACCACCCT
pActinRT-F1 GGTAACATTGTGCTCAGTGGTGG
pActinRT-R1 AACGACCTTAATCTTCATGCTGC
pActinRT-F2 TACGAGATGCCTGATGGTCAGGTCA
pActinRT-R2 TGGAGTTGTACGTGGCCTCATGGAC

Fig. 1

Bioinformatics analysis of ZmbHLH91 A: amino acid sequence alignment; B: transmembrane structure prediction; C: protein tertiary structure prediction; D: promoter analysis of ZmbHLH91."

Fig. 3

PCR detection and relative expression level of T3 generation Arabidopsis A: PCR detection of T3 generation Arabidopsis; B: RT-qPCR detection of T3 generation Arabidopsis. M: DL5000 marker; P: positive control; N: negative control; W: water control; WT: wild-type Arabidopsis; L-1-L-6: T3 Arabidopsis; **: P < 0.01."

Fig. 4

Root length of transgenic Arabidopsis thaliana on gradient NaCl concentrations A-D indicate the seedling growth under the NaCl concentrations of 0, 0.10, 0.15, and 0.18 mol L-1, respectively; E: the average main root length. WT: wild type; L-1, L-2, and L-3: ZmbHLH91 transgenic Arabidopsis thaliana; Bar: 1.5 cm; *: P < 0.05; **: P < 0.01."

Fig. 5

Root length of transgenic Arabidopsis thaliana on gradient mannitol concentrations A-D indicate the seedling growth under the mannitol concentrations of 0, 0.15, 0.20, and 0.30 mol L-1, respectively; E: the average main root length. Abbreviation are the same as those given in Fig. 4; Bar: 1.5 cm; *: P < 0.05; **: P < 0.01."

Fig. 6

Root length of transgenic Arabidopsis thaliana on gradient ABA and JA concentrations A: the seedling growth under the ABA concentrations of 0, 10, 25, and 50 µmol L-1, respectively; B: the average main root length under the ABA concentrations of 0, 10, 25, and 50 µmol L-1, respectively; C: the seedling growth under the JA concentrations of 0, 50, 75, and 100 µmol L-1, respectively; E: the average main root length under the JA concentrations of 0, 50, 75, and 100 µmol L-1, respectively. Abbreviations are the same as those given in Fig. 4; Bar: 1.5 cm; *: P < 0.05; **: P < 0.01."

Fig. 7

Analysis of transgenic Arabidopsis under drought treatment A: the phenotype of Arabidopsis thaliana; B: POD activity; C: the rate of green leaves under drought treatment; D: the rate of green leaves under Re-water treatment. Abbreviations are the same as those given in Fig. 4; **: P < 0.01."

Fig. 8

Analysis of transgenic Arabidopsis under high salt treatment A: the phenotype of Arabidopsis thaliana; B: POD activity; C: the rate of green leaves under high salt treatment. Abbreviations are the same as those given in Fig. 4; **: P < 0.01."

Fig. 9

Factors of maize interact with ZmbHLH91 AD: pGADT7; BK: pGBKT7; SD2: Synthetic Dropout Medium without Leu-Trp; SD4: Synthetic Dropout Medium without Leu-Trp-His-Ade; P: positive control (pGADT7-largeT+ pGBKT7-p53); N: negative control (pGADT7-largeT+pGBKT7-laminC)."

[1] Mao H, Yu L, Han R, Li Z, Liu H. ZmNAC55, a maize stress-responsive NAC transcription factor, confers drought resistance in transgenic Arabidopsis. Plant Physiol Biochem, 2016, 105: 55-66.
doi: 10.1016/j.plaphy.2016.04.018
[2] Li F, Liu W. Genome-wide identification, classification, and functional analysis of the basic helix-loop-helix transcription factors in the cattle, Bos Taurus. Mamm Genome, 2017, 28: 176-197.
doi: 10.1007/s00335-017-9683-x pmid: 28299435
[3] Murre C, McCaw P S, Vaessin H, Caudy M, Jan L Y, Jan Y N, Cabrera C V, Buskin J N, Hauschka S D, Lassar A B. Interactions between heterologous helix-loop-helix proteins generate complexes that bind specifically to a common DNA sequence. Cell, 1989, 58: 537-544.
pmid: 2503252
[4] Jones S. An overview of the basic helix-loop-helix proteins. Genome Biol, 2004, 5: 226.
pmid: 15186484
[5] Murre C, McCaw P S, Baltimore D. A new DNA binding and dimerization motif in immunoglobulin enhancer binding, daughterless, MyoD, and myc proteins. Cell, 1989, 56: 777-783.
pmid: 2493990
[6] Wang C X, Qi C Y, Luo J H, Liu L, He Y, Chen L Q. Characterization of LRL5 as a key regulator of root hair growth in maize. Plant J, 2019, 98: 71-82.
doi: 10.1111/tpj.14200
[7] Jaqueth J S, Hou Z, Zheng P, Ren R, Nagel B A, Cutter G, Niu X, Vollbrecht E, Greene T W, Kumpatla S P. Fertility restoration of maize CMS-C altered by a single amino acid substitution within the Rf4 bHLH transcription factor. Plant J, 2020, 101: 101-111.
doi: 10.1111/tpj.14521
[8] Aslam M, Jakada B H, Fakher B, Greaves J G, Niu X, Su Z, Cheng Y, Cao S, Wang X, Qin Y. Genome-wide study of pineapple (Ananas comosus L.) bHLH transcription factors indicates that cryptochrome-interacting bHLH2 (AcCIB2) participates in flowering time regulation and abiotic stress response. BMC Genomics, 2020, 21: 735.
doi: 10.1186/s12864-020-07152-2
[9] Fan Y, Peng J, Wu J, Zhou P, He R, Allan A C, Zeng L. NtbHLH1, a JAF13-like bHLH, interacts with NtMYB6 to enhance proanthocyanidin accumulation in Chinese Narcissus. BMC Plant Biol, 2021, 21: 275.
doi: 10.1186/s12870-021-03050-1
[10] Guo J, Li W, Shang L, Wang Y, Yan P, Bai Y, Da X, Wang K, Guo Q, Jiang R, Mao C, Mo X. OsbHLH98 regulates leaf angle in rice through transcriptional repression of OsBUL1. New Phytol, 2021, 230: 1953-1966.
doi: 10.1111/nph.17303
[11] Nowak K, Gaj M D. Stress-related function of bHLH109 in somatic embryo induction in Arabidopsis. J Plant Physiol, 2016, 193: 119-126.
doi: 10.1016/j.jplph.2016.02.012
[12] Zhang L, Kang J, Xie Q, Gong J, Shen H, Chen Y, Chen G, Hu Z. The basic helix-loop-helix transcription factor bHLH95 affects fruit ripening and multiple metabolisms in tomato. J Exp Bot, 2020, 71: 6311-6327.
doi: 10.1093/jxb/eraa363
[13] Ortolan F, Fonini L S, Pastori T, Mariath J E A, Saibo N J M, Margis-Pinheiro M, Lazzarotto F. Tightly controlled expression of OsbHLH35 is critical for another development in rice. Plant Sci, 2021, 302: 110716.
[14] 汪德州, 莫小婷, 张霞, 徐妙云, 张兰, 赵军, 王磊. 玉米转录因子ZmbHLH4基因的克隆及功能分析. 中国农业科技导报, 2018, 20(12): 16-25.
doi: 10.13304/j.nykjdb.2018.0189
Wang D Z, Mo X T, Zhang X, Xu M Y, Zhang L, Zhao J, Wang L. Cloning and functional analysis of transcription factors gene ZmbHLH4 from Zea mays. J Agric Sci Technol, 2018, 20(12): 16-25. (in Chinese with English abstract)
[15] Yang Y Y, Zheng P F, Ren Y R, Yao Y X, You C X, Wang X F, Hao Y J. Apple MdSAT1 encodes a bHLHm1 transcription factor involved in salinity and drought responses. Planta, 2021, 253: 46.
doi: 10.1007/s00425-020-03528-6
[16] Liu Y, Ji X, Nie X, Qu M, Zheng L, Tan Z, Zhao H, Huo L, Liu S, Zhang B, Wang Y. Arabidopsis AtbHLH112 regulates the expression of genes involved in abiotic stress tolerance by binding to their E-box and GCG-box motifs. New Phytol, 2015, 207: 692-709.
doi: 10.1111/nph.13387
[17] Yang X, Wang R, Hu Q, Li S, Mao X, Jing H, Zhao J, Hu G, Fu J, Liu C. DlICE1, a stress-responsive gene from Dimocarpus longan, enhances cold tolerance in transgenic Arabidopsis. Plant Physiol Biochem, 2019, 142: 490-499.
doi: 10.1016/j.plaphy.2019.08.007
[18] Zhao Q, Fan Z, Qiu L, Che Q, Wang T, Li Y, Wang Y. MdbHLH130, an apple bHLH transcription factor, confers water stress resistance by regulating stomatal closure and ROS homeostasis in transgenic tobacco. Front Plant Sci, 2020, 11: 543696.
[19] Babitha K C, Vemanna R S, Nataraja K N, Udayakumar M. Overexpression of EcbHLH57 transcription factor from Eleusine coracana L. in tobacco confers tolerance to salt, oxidative and drought stress. PLoS One, 2015, 10: e137098.
[20] Qian Y, Zhang T, Yu Y, Gou L, Yang J, Xu J, Pi E. Regulatory mechanisms of bHLH transcription factors in plant adaptive responses to various abiotic stresses. Front Plant Sci, 2021, 12: 677611.
[21] Li Z, Liu C, Zhang Y, Wang B, Ran Q, Zhang J. The bHLH family member ZmPTF1 regulates drought tolerance in maize by promoting root development and abscisic acid synthesis. J Exp Bot, 2019, 70: 5471-5486.
doi: 10.1093/jxb/erz307
[22] Chen H C, Cheng W H, Hong C Y, Chang Y S, Chang M C. The transcription factor OsbHLH035 mediates seed germination and enables seedling recovery from salt stress through ABA- dependent and ABA-independent pathways, respectively. Rice (New York), 2018, 11: 1-17.
[23] Zhao Q, Xiang X, Liu D, Yang A, Wang Y. Tobacco transcription factor NtbHLH123 confers tolerance to cold stress by regulating the NtCBF pathway and reactive oxygen species homeostasis. Front Plant Sci, 2018, 9: 381.
doi: 10.3389/fpls.2018.00381
[24] Liu H, Yang Y, Liu D, Wang X, Zhang L. Transcription factor TabHLH49 positively regulates dehydrin WZY2gene expression and enhances drought stress tolerance in wheat. BMC Plant Biol, 2020, 20: 259.
doi: 10.1186/s12870-020-02474-5
[25] Wei S, Xia R, Chen C, Shang X, Ge F, Wei H, Chen H, Wu Y, Xie Q. ZmbHLH124 identified in maize recombinant inbred lines contributes to drought tolerance in crops. Plant Biotechnol J, 2021, 19: 2069-2081.
doi: 10.1111/pbi.13637
[26] 杨梦婷, 张春, 王作平, 邹华文, 吴忠义. 玉米ZmbHLH161基因的克隆及功能研究. 作物学报, 2020, 46: 2008-2016.
doi: 10.3724/SP.J.1006.2020.03022
Yang M T, Zhang C, Wang Z P, Zou H W, Wu Z Y. Cloning and functional analysis of ZmbHLH161 gene in maize. Acta Agron Sin, 2020, 46: 2008-2016. (in Chinese with English abstract)
[27] Rabissi A, Vilela B, Lumbreras V, Ludevid D, Culiáñez-Macià F A, Pagés M. Molecular characterization of maize bHLH transcription factor (ZmKS), a new ZmOST1 kinase substrate. Plant Sci, 2016, 253: 1-12.
doi: S0168-9452(16)30423-X pmid: 27968978
[28] Duek P D, Fankhauser C. HFR1, a putative bHLH transcription factor, mediates both phytochrome A and cryptochrome signalling. Plant J, 2003, 34: 827-836.
pmid: 12795702
[29] Kiribuchi K, Jikumaru Y, Kaku H, Minami E, Hasegawa M, Kodama O, Seto H, Okada K, Nojiri H, Yamane H. Involvement of the basic helix-loop-helix transcription factor RERJ1in wounding and drought stress responses in rice plants. Biosci Biotechnol Biochem, 2005, 69: 1042-1044.
doi: 10.1271/bbb.69.1042
[30] Castillon A, Shen H, Huq E. Phytochrome Interacting Factors: central players in phytochrome-mediated light signaling networks. Trends Plant Sci, 2007, 12: 514-521.
doi: 10.1016/j.tplants.2007.10.001 pmid: 17933576
[31] Friedrichsen D M, Nemhauser J, Muramitsu T, Maloof J N, Alonso J, Ecker J R, Furuya M, Chory J. Three redundant brassinosteroid early response genes encode putative bHLH transcription factors required for normal growth. Genetics, 2002, 162: 1445-1456.
doi: 10.1093/genetics/162.3.1445 pmid: 12454087
[32] Seo J S, Joo J, Kim M J, Kim Y K, Nahm B H, Song S I, Cheong J J, Lee J S, Kim J K, Choi Y D. OsbHLH148, a basic helix-loop-helix protein, interacts with OsJAZ proteins in a jasmonate signaling pathway leading to drought tolerance in rice. Plant J, 2011, 65: 907-921.
doi: 10.1111/j.1365-313X.2010.04477.x
[33] Zhang T, Lv W, Zhang H, Ma L, Li P, Ge L, Li G. Genome-wide analysis of the basic Helix-Loop-Helix (bHLH) transcription factor family in maize. BMC Plant Biol, 2018, 18: 235.
doi: 10.1186/s12870-018-1441-z pmid: 30326829
[34] Zhang C, Li X, Wang Z, Zhang Z, Wu Z. Identifying key regulatory genes of maize root growth and development by RNA sequencing. Genomics, 2020, 112: 5157-5169.
doi: 10.1016/j.ygeno.2020.09.030 pmid: 32961281
[35] Clough S J, Bent A F. Floral dip: a simplified method for Agrobacterium mediated transformation of Arabidopsis thaliana. Plant J, 1998, 16: 735-743.
pmid: 10069079
[36] Chini A, Fonseca S, Fernández G, Adie B, Chico J M, Lorenzo O, García-Casado G, López-Vidriero I, Lozano F M, Ponce M R, Micol J L, Solano R. The JAZ family of repressors is the missing link in jasmonate signalling. Nature, 2007, 448: 666-671.
doi: 10.1038/nature06006
[37] Fernández-Calvo P, Chini A, Fernández-Barbero G, Chico J M, Gimenez-Ibanez S, Geerinck J, Eeckhout D, Schweizer F, Godoy M, Franco-Zorrilla J M, Pauwels L, Witters E, Puga M I, Paz-Ares J, Goossens A, Reymond P, De Jaeger G, Solano R. The Arabidopsis bHLH transcription factors MYC3 and MYC4 are targets of JAZ repressors and act additively with MYC2 in the activation of jasmonate responses. Plant Cell, 2011, 23: 701-715.
doi: 10.1105/tpc.110.080788
[38] Liu X, Galli M, Camehl I, Gallavotti A. RAMOSA1 ENHANCER LOCUS2-mediated transcriptional repression regulates vegetative and reproductive architecture. Plant Physiol, 2019, 179: 348-363.
doi: 10.1104/pp.18.00913 pmid: 30348817
[39] Fu J, Liu L, Liu Q, Shen Q, Wang C, Yang P, Zhu C, Wang Q. ZmMYC2 exhibits diverse functions and enhances JA signaling in transgenic Arabidopsis. Plant Cell Rep, 2020, 39: 273-288.
doi: 10.1007/s00299-019-02490-2
[1] SUN Zhi-Chao, ZHANG Ji-Wang. Physiological mechanism and regulation effect of low light on maize yield formation [J]. Acta Agronomica Sinica, 2023, 49(1): 12-23.
[2] PU Xue, WANG Kai-Tong, ZHANG Ning, SI Huai-Jun. Relative expression analysis of StMAPKK4 gene and screening and identification of its interacting proteins in potato (Solanum tuberosum L.) [J]. Acta Agronomica Sinica, 2023, 49(1): 36-45.
[3] CHEN Bing-Jie, ZHANG Fu-Liang, YANG Shuo, LI Xiao-Li, HE Tang-Qing, ZHANG Chen-Xi, TIAN Ming-Hui, WU Mei, HAO Xiao-Feng, ZHANG Xue-Lin. Effects of arbuscular mycorrhizae fungi on maize physiological characteristics during grain filling stage, yield, and grain quality under different nitrogen fertilizer forms [J]. Acta Agronomica Sinica, 2023, 49(1): 249-261.
[4] ZHANG Jing, WANG Hong-Zhang, REN Hao, YIN Fu-Wei, WU Hong-Yan, ZHAO Bin, ZHANG Ji-Wang, REN Bai-Zhao, DAI Ai-Bin, LIU Peng. Relationship between root architecture and root pulling force of summer maize [J]. Acta Agronomica Sinica, 2023, 49(1): 188-199.
[5] WANG Rui-Pu, DONG Zhen-Ying, GAO Yue-Xin, BAO Jian-Xi, YIN Fang-Bing, LI Jin-Ping, LONG Yan, WAN Xiang-Yuan. Genome-wide association study and candidate gene prediction of kernel starch content in maize [J]. Acta Agronomica Sinica, 2023, 49(1): 140-152.
[6] SHANG Meng-Fei, SHI Xiao-Yu, ZHAO Jiong-Chao, LI Shuo, CHU Qing-Quan. Spatiotemporal variation of high temperature stress in different regions of China under climate change [J]. Acta Agronomica Sinica, 2023, 49(1): 167-176.
[7] DUAN Can-Xing, CUI Li-Na, XIA Yu-Sheng, DONG Huai-Yu, YANG Zhi-Huan, HU Qing-Yu, SUN Su-Li, LI Xiao, ZHU Zhen-Dong, WANG Xiao-Ming. Precise characterization and analysis of maize germplasm resources for resistance to Fusarium ear rot and Gibberella ear rot [J]. Acta Agronomica Sinica, 2022, 48(9): 2155-2167.
[8] ZHANG Zhen-Bo, QU Xin-Yue, YU Ning-Ning, REN Bai-Zhao, LIU Peng, ZHAO Bin, ZHANG Ji-Wang. Effects of nitrogen application rate on grain filling characteristics and endogenous hormones in summer maize [J]. Acta Agronomica Sinica, 2022, 48(9): 2366-2376.
[9] GUO Yao, CHAI Qiang, YIN Wen, FAN Hong. Research progress of photosynthetic physiological mechanism and approaches to application in dense planting maize [J]. Acta Agronomica Sinica, 2022, 48(8): 1871-1883.
[10] WANG Tian-Bo, HE Wen-Xue, ZHANG Jun-Ming, LYU Wei-Zeng, LIANG Yu-Huan, LU Yang, WANG Yu-Lu, GU Feng-Xu, SONG Ci, CHEN Jun-Ying. ROS production and ATP synthase subunit mRNAs integrity in artificially aged maize embryos [J]. Acta Agronomica Sinica, 2022, 48(8): 1996-2006.
[11] PEI Li-Zhen, CHEN Yuan-Xue, ZHANG Wen-Wen, XIAO Hua, ZHANG Sen, ZHOU Yuan, XU Kai-Wei. Effects of organic material returned on photosynthetic performance and nitrogen metabolism of ear leaf in summer maize [J]. Acta Agronomica Sinica, 2022, 48(8): 2115-2124.
[12] GUO Jia-Xin, LU Xiao-Yu, TAO Yi-Fan, GUO Hui-Juan, MIN Wei. Analysis of metabolites and pathways in cotton under salt and alkali stresses [J]. Acta Agronomica Sinica, 2022, 48(8): 2100-2114.
[13] YANG Ying-Xia, ZHANG Guan, WANG Meng-Meng, LU Guo-Qing, WANG Qian, CHEN Rui. Molecular characterization of transgenic maize GM11061 based on high-throughput sequencing technology [J]. Acta Agronomica Sinica, 2022, 48(7): 1843-1850.
[14] WANG Dan, ZHOU Bao-Yuan, MA Wei, GE Jun-Zhu, DING Zai-Song, LI Cong-Feng, ZHAO Ming. Characteristics of the annual distribution and utilization of climate resource for double maize cropping system in the middle reaches of Yangtze River [J]. Acta Agronomica Sinica, 2022, 48(6): 1437-1450.
[15] YAN Jia-Qian, GU Yi-Biao, XUE Zhang-Yi, ZHOU Tian-Yang, GE Qian-Qian, ZHANG Hao, LIU Li-Jun, WANG Zhi-Qin, GU Jun-Fei, YANG Jian-Chang, ZHOU Zhen-Ling, XU Da-Yong. Different responses of rice cultivars to salt stress and the underlying mechanisms [J]. Acta Agronomica Sinica, 2022, 48(6): 1463-1475.
Viewed
Full text


Abstract

Cited
  Shared   
  Discussed   
[1] Yan Mei;Yang Guangsheng;Fu Tingdong;Yan Hongyan. Studies on the Ecotypical Male Sterile-fertile Line of Brassica napus L.Ⅲ. Sensitivity to Temperature of 8-8112AB and Its Inheritance[J]. Acta Agron Sin, 2003, 29(03): 330 -335 .
[2] Wang Yongsheng;Wang Jing;Duan Jingya;Wang Jinfa;Liu Liangshi. Isolation and Genetic Research of a Dwarf Tiilering Mutant Rice[J]. Acta Agron Sin, 2002, 28(02): 235 -239 .
[3] Hu Yuqi;Liao Xiaohai. A STUDY ON THE COEFFICIENT OF LEAVES SHAPE OF MAIZE[J]. Acta Agron Sin, 1986, (01): 71 -72 .
[4] LIANG Tai-Bo;YIN Yan-Ping;CAI Rui-Guo;YAN Su-Hui;LI Wen-Yang;GENG Qing-Hui;WANG Ping;WANG Zhen-Lin. Starch Accumulation and Related Enzyme Activities in Superior and Inferior Grains of Large Spike Wheat[J]. Acta Agron Sin, 2008, 34(01): 150 -156 .
[5] WANG Cheng-Zhang;HAN Jin-Feng;SHI Ying-Hua;LI Zhen-Tian;LI De-Feng. Production Performance in Alfalfa with Different Classes of Fall Dormancy[J]. Acta Agron Sin, 2008, 34(01): 133 -141 .
[6] TIAN Zhi-Jian;Yi Rong;CHEN Jian-Rong;GUO Qing-Quan;ZHANG Xue-Wen;. Cloning and Expression of Cellulose Synthase Gene in Ramie [Boehme- ria nivea (Linn.) Gaud.][J]. Acta Agron Sin, 2008, 34(01): 76 -83 .
[7] ZHAO Xiu-Qin;ZHU Ling-Hua;XU Jian-Long;LI Zhi-Kang. QTL Mapping of Yield under Irrigation and Rainfed Field Conditions for Advanced Backcrossing Introgression Lines in Rice[J]. Acta Agron Sin, 2007, 33(09): 1536 -1542 .
[8] WU Ying ; SONG Feng-Sun ; LU Xu-Zhong; ZHAO Wei; YANG Jian-Bo; LI Li ;. Detecting Genetically Modified Soybean by Real-time Quantitative PCR Technique[J]. Acta Agron Sin, 2007, 33(10): 1733 -1737 .
[9] GOU Ling ; HUANG Jian-Jun; ZHANG Bin; LI Tao; SUN Rui; ZHAO Ming ;. Effects of Population Density on Stalk Lodging Resistant Mechanism and Agronomic Characteristics of Maize[J]. Acta Agron Sin, 2007, 33(10): 1688 -1695 .
[10] YU Jing;ZHANG Lin;CUI Hong;ZHANG Yong-Xia;CANG Jing;HAO Zai-Bin;LI Zhuo-Fu. Physiological and Biochemical Characteristics of Dongnongdongmai 1 before Wintering in High-Cold Area[J]. Acta Agron Sin, 2008, 34(11): 2019 -2025 .
Add: No. 80 Xueyuan South Rd, Beijing 100081, P. R. China E-mail: zwxb301@caas.cn
Supported by Beijing Magtech Co.Ltd