Welcome to Acta Agronomica Sinica，

Acta Agronomica Sinica ›› 2022, Vol. 48 ›› Issue (4): 851-859.doi: 10.3724/SP.J.1006.2022.13013

• CROP GENETICS & BREEDING · GERMPLASM RESOURCES · MOLECULAR GENETICS • Previous Articles     Next Articles

Overexpression of ZmCIPKHT enhances heat tolerance in plant

XU Jing1(), GAO Jing-Yang1, LI Cheng-Cheng2, SONG Yun-Xia1, DONG Chao-Pei1, WANG Zhao1, LI Yun-Meng1, LUAN Yi-Fan1, CHEN Jia-Fa2, ZHOU Zi-Jian2,*(), WU Jian-Yu1,2,*()   

  1. 1College of Agriculture, Henan Agricultural University, Zhengzhou 450002, Henan, China
    2College of Life Science, Henan Agricultural University, Zhengzhou 450002, Henan, China
  • Received:2021-02-03 Accepted:2021-07-12 Online:2022-04-12 Published:2021-08-10
  • Contact: ZHOU Zi-Jian,WU Jian-Yu E-mail:709823684@qq.com;zhouzijian19900601@136.com;wujianyu40@126.com
  • Supported by:
    Key Project of Henan Natural Science Foundation(162300410130)

RichHTML396

37

PDF

663

Abstract:

The effects of high temperature stress on the normal growth and yield of plants is more and more serious. To adapt the changes of external environment, plants have evolved a series of molecular genetic mechanisms to respond to high temperature stress. The calcineurin B-like protein (CBL) interacting protein kinase (CIPK) is actively involved in response to high temperature stress depended on ABA signal transduction pathway in plants. Based on previous genome-wide association analysis, a candidate gene ZmCIPKHT related to maize high temperature tolerance was cloned in this study. Real-time quantitative PCR results showed that ZmCIPKHT gene was significantly induced by high temperature stress. Transient transformation of maize protoplasts revealed that ZmCIPKHT was localized in the nucleus. Overexpressing ZmCIPKHT plants of transgenic Arabidopsis thaliana had significantly higher survival rate and better growth status than wild type under high temperature stress. The yeast two-hybrid experiment confirmed that the interaction between ZmCIPKHT protein and ZmCBL4 protein in maize CBLs family. The relative expression levels of genes related to abscisic acid (ABA) pathway in transgenic Arabidopsis thaliana with ZmCIPKHT under high temperature stress were changed accordingly, indicating that the regulations of ZmCIPKHT genes under high temperature stress were in the ABA-dependent pathway. These results provide a new experimental basis for elucidating the molecular mechanism of maize CBL-CIPK signaling pathway dependent on ABA pathway to abiotic stress in plants.

Key words: maize, heat tolerance, protein kinase, CBL-CIPK, ABA signal pathway

Table 1

Primers used in this study"

引物
Primer ID		 正向序列
Forward sequence (5'-3')		 反向序列
Reverse sequence (5'-3')
qZmCIPKHT-F/R CCATAACCAGATCACGTCAAAA GGTAACCTGAAACACAATTCCG
EF1α-F/R TGGGCCTACTGGTCTTACTACTGA ACATACCCACGCTTCAGATCCT
ZmCIPKHT-F/R CGGGGGACTCTTGACCATGGTAATGGACGAGAGGAGGACTA TACTAGTCAGATCTACCATGGTCTGCTGCGTCGGCAAA
PGBKT7-ZmCIPKHT-F/R ATGGCCATGGAGGCCGAATTCATGGACGAGAGGAGGACTATTTTG CCGCTGCAGGTCGACGGATCCCTACTGCTGCGTCGGCAAA
qPYL2-F/R GTCAGAGAAGTGACCGTAATCT CGACGTCACTGATTTCTAGTTC
qFOA1-F/R GCTTACATCGTTGGAGAAG GCACAGAACTTGGAACATAA
qHAI2-F/R TACATCCGTCTTTTGTACGGAA CGTGAAGTCTCTCTTTACACCT
qSnRK2.3-F/R ATTTCAAGAATCTTCGTGGCTG CTGTGTTGCTCTCGTTCATTAG

Fig. 1

Protein domains analysis of ZmCIPKHT and phylogenetic tree of CIPK protein in plants"

Fig. 2

Relative expression patterns of ZmCIPKHT genes"

Fig. 3

Molecular detection of ZmCIPKHT overexpression in Arabidopsis thaliana lines A: the detection of ZmCIPKHT overexpression lines; B: the transcriptional level of ZmCIPKHT; WT: wild type; OE: overexpression of Arabidopsis thaliana."

Fig. 4

Heat resistance identification and survival rates of transgenic Arabidopsis thaliana plants under high temperature stress A: phenotypic identification of transgenic Arabidopsis thaliana plants after heat stress; B: survival rates of transgenic Arabidopsis thaliana plants under high temperature stress; WT: wild type; OE: overexpression of Arabidopsis thaliana. The error bar represents mean ± SD of three biological replications."

Fig. 5

Relative expression levels of ABA pathway related genes of wild-type WT and overexpressed transgenic Arabidopsis thaliana OE-4 and OE-6 lines under normal conditions and high temperature stresses Wild-type materials (WT) and overexpressed Arabidopsis tharabidopsis lines (OE-4 and OE-6) were at 37℃ for a week to detect the relative expression levels of genes related to ABA pathway, the error bar represents mean ± SD of three biological replications."

Fig. 6

Subcellular localization of ZmCIPKHT in protoplasts GFP: GFP-labeled ZmCIPKHT was used for subcellular localization of maize protoplasts; Bright: protoplasts under the same field of view; Merged: the superposition of the light mirror and fluorescent picture; 35S:GFP: protoplast transferred into empty carrier; 35S:ZmCIPKHT: GFP: protoplast transferred into target carrier. Bar: 10 μm."

Fig. 7

Interaction between ZmCIPKHT and ZmCBLs by yeast two-hybrid experiment DDO: SD-Trp-Leu; QDO: SD-Trp-Leu-His-Ade."

Fig. 8

ZmCIPKHT-mediated Ca2+ pathway depended on ABA signaling pathway to regulate maize heat tolerance"

[1] Burke J J, Chen J. Enhancement of reproductive heat tolerance in plants. PLoS One, 2015, 10:e0122933.
[2] 任寒, 刘鹏, 董树亭, 张吉旺, 赵斌. 高温胁迫影响玉米生长发育的生理机制研究进展. 玉米科学, 2019, 27(5):109-115.
Ren H, Liu P, Dong S T, Zhang J W, Zhao B. Research progress on physiological mechanism of high temperature stress on growth and development of maize. J Maize Sci, 2019, 27(5):109-115 (in Chinese with English abstract).
[3] Mittler R, Finka A, Goloubinoff P. How do plants feel the heat? Trends Biochem Sci, 2012, 37:118-125.
doi: 10.1016/j.tibs.2011.11.007 pmid: 22236506
[4] Saidi Y, Finka A, Muriset M, Bromberg Z, Weiss Y G, Maathuis F J, Goloubinoff P. The heat shock response in moss plants is regulated by specific calcium-permeable channels in the plasma membrane. Plant Cell, 2009, 21:2829-2843.
doi: 10.1105/tpc.108.065318
[5] Suzuki N, Sejima H, Tam R, Schlauch K, Mittler R. Identification of the MBF1 heat-response regulon of Arabidopsis thaliana. Plant J, 2011, 66:844-851.
doi: 10.1111/j.1365-313X.2011.04550.x
[6] Rudd J J, Franklin-Tong V E. Unravelling response-specificity in Ca2+ signalling pathways in plant cells. New Phytol, 2010, 151:7-33.
doi: 10.1046/j.1469-8137.2001.00173.x
[7] Hashimoto K, Eckert C, Anschütz U, Scholz M, Held K, Waadt R, Reyer A, Hippler M, Becker D, Kudla J. Phosphorylation of calcineurin B-like (CBL) calcium sensor proteins by their CBL- interacting protein kinases (CIPKs) is required for full activity of CBL-CIPK complexes toward their target proteins. J Biol Chem, 2012, 287:7956-7968.
doi: 10.1074/jbc.M111.279331 pmid: 22253446
[8] D’Angelo C, Weinl S, Batistic O, Pandey G K, Cheong Y H, Schültke S, Albrecht V, Ehlert B, Schulz B, Harter K, Luan S, Bock R, Kudla J. Alternative complex formation of the Ca- regulated protein kinase CIPK1 controls abscisic acid-dependent and independent stress responses in Arabidopsis. Plant J, 2006, 48:857-872.
doi: 10.1111/tpj.2006.48.issue-6
[9] Li L, Kim B G, Cheong Y H, Pandey G K, Luan S. A Ca2+ signaling pathway regulates a K+ channel for low-K response in Arabidopsis. Proc Natl Acad Sci USA, 2006, 103:12625-12630.
[10] DeFalco T A, Bender K W, Snedden W A. Breaking the code: Ca2+ sensors in plant signalling. Biochem J, 2009, 425:27-40.
doi: 10.1042/BJ20091147 pmid: 20001960
[11] Ma X, Li Q H, Yu Y N, Qiao Y M, Haq S U, Gong Z H. The CBL-CIPK pathway in plant response to stress signals. Int J Mol Sci, 2020, 21:5668.
doi: 10.3390/ijms21165668
[12] Yang Y, Wu Y, Ma L, Yang Z, Dong Q, Li Q, Ni X, Kudla J, Song C, Guo Y. The Ca2+ sensor SCaBP3/CBL7 modulates plasma membrane H+-ATPase activity and promotes alkali tolerance in Arabidopsis. Plant Cell, 2019, 31:1367-1384.
doi: 10.1105/tpc.18.00568
[13] Kolukisaoglu U, Weinl S, Blazevic D, Batistic O, Kudla J. Calcium sensors and their interacting protein kinases: genomics of the Arabidopsis and rice CBL-CIPK signaling networks. Plant Physiol, 2004, 134:43-58.
pmid: 14730064
[14] Piao H L, Xuan Y H, Park S H, Je B I, Park S J, Park S H, Kim C M, Huang J, Wang G K, Kim M J, Kang S M, Lee I J, Kwon T R, Kim Y H, Yeo U S, Yi G, Son D, Han C D. OsCIPK31, a CBL-interacting protein kinase is involved in germination and seedling growth under abiotic stress conditions in rice plants. Mol Cells, 2010, 30:19-27.
doi: 10.1007/s10059-010-0084-1
[15] Cheong Y H, Pandey G K, Grant J J, Batistic O, Li L, Kim B G, Lee S C, Kudla J, Luan S. Two calcineurin B-like calcium sensors, interacting with protein kinase CIPK23, regulate leaf ranspiration and root potassium uptake in Arabidopsis. Plant J, 2007, 52:223-239.
pmid: 17922773
[16] Pandey G K, Kanwar P, Singh A, Steinhorst L, Pandey A, Yadav A K, Tokas I, Sanyal S K, Kim B G, Lee S C, Cheong Y H, Kudla J, Luan S. Calcineurin B-Like protein-interacting protein kinase CIPK21 regulates osmotic and salt stress responses in Arabidopsis. Plant Physiol, 2015, 169:780-792.
doi: 10.1104/pp.15.00623
[17] Shi H, Ishitani M, Kim C, Zhu J K. The Arabidopsis thaliana salt tolerance gene SOS1 encodes a putative Na+/H+ antiporter. Proc Natl Acad Sci USA, 2000, 97:6896-6901.
doi: 10.1073/pnas.120170197
[18] Cui X Y, Du Y T, Fu J D, Yu T F, Wang C T, Chen M, Chen J, Ma Y Z, Xu Z S. Wheat CBL-interacting protein kinase 23 positively regulates drought stress and ABA responses. BMC Plant Biol, 2018, 18:93.
doi: 10.1186/s12870-018-1306-5
[19] Wang Y, Li T, John S J, Chen M, Chang J, Yang G, He G. A CBL-interacting protein kinase TaCIPK27 confers drought tolerance and exogenous ABA sensitivity in transgenic Arabidopsis. Plant Physiol Biochem, 2018, 123:103-113.
doi: 10.1016/j.plaphy.2017.11.019
[20] Gao J, Wang S, Zhou Z, Wang S, Dong C, Mu C, Song Y, Ma P, Li C, Wang Z, He K, Han C, Chen J, Yu H, Wu J. Linkage mapping and genome-wide association reveal candidate genes conferring thermotolerance of seed-set in maize. J Exp Bot, 2019, 70:4849-4864.
doi: 10.1093/jxb/erz171
[21] Yoo S D, Cho Y H, Sheen J. Arabidopsis mesophyll protoplasts: a versatile cell system for transient gene expression analysis. Nat Prot, 2007, 2:1565-1572.
doi: 10.1038/nprot.2007.199
[22] Wang Q, Yu G, Chen Z, Han J, Wang K. Optimization of protoplast isolation, transformation and its application in sugarcane (Saccharum spontaneum L.). Crop J, 2020, 2214-5141.
[23] Gao L, Shen G, Zhang L, Qi J, Zhang C, Ma C, Li J, Wang L, Malook S U, Wu J. An efficient system composed of maize protoplast transfection and HPLC-MS for studying the biosynthesis and regulation of maize benzoxazinoids. Plant Methods, 2019, 15:144.
doi: 10.1186/s13007-019-0529-2
[24] Zhang F, Li L, Jiao Z, Chen Y, Liu H, Chen X, Fu J, Wang G, Zheng J. Characterization of the calcineurin B-Like (CBL) gene family in maize and functional analysis of ZmCBL9 under abscisic acid and abiotic stress treatments. Plant Sci, 2016, 253:118-129.
doi: S0168-9452(16)30480-0 pmid: 27968980
[25] Kolukisaoglu U, Weinl S, Blazevic D, Batistic O, Kudla J. Calcium sensors and their interacting protein kinases: genomics of the Arabidopsis and rice CBL-CIPK signaling networks. Plant Physiol, 2004, 134:43-58.
pmid: 14730064
[26] Xiang Y, Huang Y, Xiong L. Characterization of stress-responsive CIPK genes in rice for stress tolerance improvement. Plant Physiol, 2007, 144:1416-1428.
pmid: 17535819
[27] Tai F, Yuan Z, Li S, Wang Q, Liu F, Wang W. ZmCIPK8, a CBL- interacting protein kinase, regulates maize response to drought stress. Plant Cell Tissue Organ Cult, 2016, 124:459-469.
doi: 10.1007/s11240-015-0906-0
[28] 李健, 王逸茹, 张凌霄, 孙明昊, 秦阳, 郑军. 玉米ZmCIPK24-2基因在盐胁迫应答中的功能研究. 作物学报, 2020, 46:1351-1358.
doi: 10.3724/SP.J.1006.2020.03008
Li J, Wang Y R, Zhang L X, Sun M H, Qin Y, Zheng J. Function of ZmCIPK24-2 in response to salt stress in maize. Acta Agron Sin, 2020, 46:1351-1358 (in Chinese with English abstract).
[29] Chen X, Gu Z, Xin D, Hao L, Liu C, Huang J, Ma B, Zhang H. Identification and characterization of putative CIPK genes in maize. J Genet Genomics, 2011, 38:77-87.
doi: 10.1016/j.jcg.2011.01.005
[30] Charng Y Y, Liu H C, Liu N Y, Chi W T, Wang C N, Chang S H, Wang T T. A heat-inducible transcription factor, HsfA2, is required for extension of acquired thermotolerance in Arabidopsis. Plant Physiol, 2007, 143:251-262.
doi: 10.1104/pp.106.091322
[31] Wang D F, Pang X J, Yang F, Kou S, Zhang, Yu P X, Niu Y B, Antioxidative enzymes, calcium, and ABA signaling pathway are required for the stress tolerance of transgenic wheat plant by the ectopic expression of harpin protein fragment Hpa110-42 under heat stress. Russ J Plant Physiol, 2017, 64:899-905.
doi: 10.1134/S1021443717060140
[32] Chen K, Li G J, Bressan R A, Song C P, Zhu J K, Zhao Y. Abscisic acid dynamics, signaling, and functions in plants. J Integr Plant Biol, 2020, 62:25-54.
doi: 10.1111/jipb.v62.1
[1] Liang Jin-Yu, Yin Jia-De, Wang Hong-Li, Zhang Guo-Ping, Hou Hui-Zhi, Dong Bo, Ma Ming-Sheng. Estimation of leaf nitrogen content in dryland forage maize using UAV-based hyperspectral imaging and machine learning [J]. Acta Agronomica Sinica, 2026, 52(6): 1788-1801.
[2] Yang Xin-Yu, Cui Wen-Tao, Dilinigeer Alimu, Wang Kai-Xiang, Wu Peng-Hao, Ren Jiao-Jiao. Genome-wide association and genomic selection analysis of the number of leaves above the ear in maize [J]. Acta Agronomica Sinica, 2026, 52(5): 1573-1590.
[3] Han Ya-Xin, He Guan-Hua, Zhang Xiao-Qiong, Zhang Deng-Feng, Li Yong-Xiang, Liu Xu-Yang, Wang Tian-Yu, Li Yu, Zou Hua-Wen, Li Chun-Hui. Identification of maize lateral root density genes resources through integrated RNA-seq and BSA-seq analyses [J]. Acta Agronomica Sinica, 2026, 52(5): 1341-1352.
[4] Sun Shu-Feng, Xu Zhen-Nan, Huang Jia-Xin, Weng Jian-Feng, Li Xin-Hai. Genome-wide identification of the maize MAPK gene family and its response to Fusarium verticillioides infection [J]. Acta Agronomica Sinica, 2026, 52(5): 1291-1308.
[5] Zhang Ning-Ning, Teng Yu-Fei, Ren Na-Na, Wei Xing-Zhuo, Yan Shu-Hao, Fan Ke-Xin, Wang Yong-Hong, Chen Wen-Kang, Zhang Xing-Hua, Zhu Wan-Chao, Xu Shu-Tu, Xue Ji-Quan. Phenotypic evaluation and plasticity analysis of drought resistance in 201 maize inbred lines [J]. Acta Agronomica Sinica, 2026, 52(5): 1309-1325.
[6] Zhang Hong-Rong, Wang Fei-Er, Li Pan, Qiu Hai-Long, Zhu Jing, Zhao Lian-Hao, Nan Yun-You, He Wei, Fan Zhi-Long, Hu Fa-Long, Chai Qiang, Yin Wen. Photosynthetic characteristics of 20% reduced irrigation combined with 25% organic substitution for chemical fertilizer in increasing silage maize yield [J]. Acta Agronomica Sinica, 2026, 52(5): 1487-1500.
[7] Yang Yang, Chang Shi-Hui, Tian Hong-Li, Yi Hong-Mei, Wang Lu, Ren Jie, Fan Ya-Ming, Liu Ya-Wei, Wang Feng-Ge, Zhao Jiu-Ran. Genetic diversity analysis of nationally approved maize varieties in different ecological regions [J]. Acta Agronomica Sinica, 2026, 52(5): 1352-1364.
[8] Cai Hong-Wei, Yu Ai-Zhong, Jiang Ke-Qiang, Wang Peng-Fei, Wang Yu-Long, Huo Jian-Zhe, Pang Xiao-Neng, Yin Bo, Shang Yong-Pan. Key mechanisms underlying the enhancement of sweet maize yield through partial substitution of chemical fertilizers with organic manure in arid irrigation districts [J]. Acta Agronomica Sinica, 2026, 52(4): 1166-1180.
[9] Tian Hong-Li, Yang Yang, Fan Ya-Ming, Yi Hong-Mei, Guo Dan-Dan, Wang Feng-Ge, Zhao Jiu-Ran. A novel set of tri-allelic variant SNP loci suitable for maize variety identification [J]. Acta Agronomica Sinica, 2026, 52(4): 993-1005.
[10] Guo Xiang-Yang, Tu Liang, Wang Dong, Liu Peng-Fei, Wang An-Gui, Yi Qiang, Ren Hong, Li Gang, Zhu Yun-Fang, Wu Xun, Jiang Yu-Lin, Tian Feng, Chen Ze-Hui. Application and prospects of Suwan germplasm in maize breeding in China [J]. Acta Agronomica Sinica, 2026, 52(3): 655-664.
[11] Ma Liang, Ma Lu, Zhang Shu-Yu, Zhang Hui-Min, Wang Ren-Ming, Song Xu-Dong, Zhang Zhen-Liang, Mao Yu-Xiang, Lu Hu-Hua, Chen Guo-Qing, Hao De-Rong, Zhou Guang-Fei. Transcriptome analysis and identification of candidate genes associated with husk number in maize [J]. Acta Agronomica Sinica, 2026, 52(3): 790-801.
[12] Meng Cheng, Wang Zhe. Genome-wide identification and expression analysis of the ZmPFK gene family under biotic and abiotic stresses in maize [J]. Acta Agronomica Sinica, 2026, 52(3): 764-779.
[13] Li Xin-Hao, Xing Meng-Ke, Zhou Zi-Hui, Li Si-Ye, Ren Hao, Wang Hong-Zhang, Lai Hua-Jiang. Exogenous melatonin enhances heat tolerance of maize at the seedling stage by coordinating light and dark reactions [J]. Acta Agronomica Sinica, 2026, 52(3): 839-856.
[14] Liu Ji-Chang, Li Si-Ye, Li Xue-Ting, Wang Hong-Zhang, Liu Peng, Zhang Ji-Wang, Zhao Bin, Ren Bai-Zhao, Ren Hao. Effects of salt stress on root growth and nutrient absorption efficiency of different salt-tolerant summer maize varieties [J]. Acta Agronomica Sinica, 2026, 52(2): 565-577.
[15] Lin Zi-Qing, Zhong Xing-Yu, Liu Fan, Ren Zi-Ao, Ma Rui, Deng Xiu-Feng, Wang Dong-Wei, Liu Shao-Peng, Chen Kang, Zhang Ming-Cai, Li Zhao-Hu, Zhou Yu-Yi, Duan Liu-Sheng. Development of ultra-high-yield technology for a wheat-maize double cropping system achieving a 2-ton annual grain yield per mu in the coastal plain of Northern Shandong peninsula, China [J]. Acta Agronomica Sinica, 2026, 52(2): 631-643.
Viewed
Full text


Abstract

Cited
  Shared   
  Discussed   
No Suggested Reading articles found!
Add: No. 80 Xueyuan South Rd, Beijing 100081, P. R. China E-mail: zwxb301@caas.cn
Supported by Beijing Magtech Co.Ltd