Welcome to Acta Agronomica Sinica,

Acta Agronomica Sinica ›› 2024, Vol. 50 ›› Issue (12): 2940-2949.doi: 10.3724/SP.J.1006.2024.41027

;

• CROP GENETICS & BREEDING·GERMPLASM RESOURCES·MOLECULAR GENETICS • Previous Articles     Next Articles

Functional analysis of TaEMF2 in regulating wheat heading date

WU Li-Fen1,2(), XIA Chuan2, ZHANG Li-Chao2, KONG Xiu-Ying2, CHEN Jing-Tang1,3,*(), LIU Xu1,2,*()   

  1. 1College of Agronomy, Hebei Agricultural University / Hebei Sub-Center for National Maize Improvement Center / State Key Laboratory of North China Crop Improvement and Regulation, Baoding 071001, Hebei, China
    2Institute of Crop Sciences, Chinese Academy of Agricultural Sciences / State Key Laboratory of Crop Gene Resources and Breeding, Beijing 100081, China
    3College of Agronomy, Qingdao Agricultural University, Qingdao 266109, Shandong, China
  • Received:2024-04-15 Accepted:2024-08-15 Online:2024-12-12 Published:2024-09-02
  • Contact: *E-mail: chenjingtang@126.com; E-mail: liuxu03@caas.cn
  • Supported by:
    National Key Research and Development Program of China(2022YFF1002902)

Abstract:

A suitable heading date (flowering time) is a crucial breeding goal for achieving high and stable crop yields. EMF2 is an important gene involved in the regulation of heading date, but its function in wheat remains unclear. In this study, TaEMF2-2D, the orthologous gene of the rice heading date regulatory gene OsEMF2b, was cloned from wheat. Subcellular localization assays revealed that TaEMF2-2D is a nucleus and cytoplasm protein. To elucidate the role of TaEMF2 in regulating wheat heading date, we used the CRISPR/Cas9 gene editing system to knockout TaEMF2, which resulted in a delayed heading date in wheat. Conversely, overexpression of TaEMF2-2D caused an early heading date. Further analysis showed that the expression levels of the flowering-related genes VRN1 and VRN3 were significantly reduced in the knockout lines, while their expression levels were significantly increased in the overexpression plants, as determined by RT-qPCR. These results suggest that the TaEMF2 gene influences wheat heading date by regulating the expression levels of VRN1 and VRN3.

Key words: wheat (Triticum aestivum L.), heading date, TaEMF2 gene, CRISPR/Cas9 gene editing, overexpression

Table 1

Primers used in this study"

引物名称 Primer name 引物序列 Primer sequence (5'-3')
TaEMF2-2D-CDS-F CATCCTTATCCTTATCCTTAGGGCA
TaEMF2-2D-CDS-R GGGAACGACAAGTGCAAAGTC
pWMB110-TaEMF2-CDS-F GTCGACTCTAGAGGATCCCCGGGATGTGCCGTCAACCGTCG
pWMB110-TaEMF2-CDS-R CATGAATTCCGGCTCGAGACTAGTAAACGTCTTCTTCTTGGGTT
TaEMF2-CDS-SEQF TTGTGTTTCAGATTCAGAA
TaEMF2-CDS-SEQR TGCTCGGCAGAATCGGGTGCT
pBUE413-TaEMF2-F aataatggtctcAAGCgTGTCCTGCTCCAGAAATTTgttttagagctagaaatagc
pBUE413-TaEMF2-R attattggtctcTAAAcGACCACATGTGCCGTCAACcgcttcttggtgcc
pBUE413-413-seq-F TTTCCCAGTCACGACGTTGT
pBUE413-413-seq-R ATCTCTAGAGAGGGGCACGA
TaEMF2-G-2A-P1-F2 TACGCGATGCATTTTGACAGAGT
TaEMF2-G-2A-P1-R2 TATTGTGTTACCTTATAATATGAC
TaEMF2-G-2A-P2-F1 GTGGAAGCTTGCTATCCATGTGC
TaEMF2-G-2A-P2-R1 AATGAGAGCTACCTCTTTTTGCGGT
TaEMF2-G-2B-P1-F1 AATTAAGTTAGGCACCCGTACTTT
TaEMF2-G-2B-P1-R1 GGGGTCTCTCTTTTGAACAATCG
TaEMF2-G-2B-P2-R2 CATGATGGCATTGTTTAATGAGATA
TaEMF2-G-2D-P1-F1 GCATGTAACTTTAGTTGTCCTAG
TaEMF2-G-2D-P2-F1 GGATTGATTGGTGATACGATAG
TaEMF2-G-2D-P2-R1 TCACGTAAATGATAGTAAGTAGTC
TaEMF2-G-2A-P1-seq-R CAGAAGGTCTACAATATAATC
TaEMF2-G-2A-P2-seq-F CTCTAATTATCTATCTATCTATCC
TaEMF2-G-2B-P1-seq-F ATCAACCTTATTTATTTTAAAAAT
TaEMF2-G-2B-P2-seq-F TCTTTGTTAGACACGACCATC
TaEMF2-G-2D-P1-seq-R ATAATCCGTTGCCCTTAAATATG
TaEMF2-G-2D-P2-seq-R ATCAAGGGCTCGTTTTTGGATAACA
RT-TaGAPDH-F TTAGACTTGCGAAGCCAGCA
RT-TaGAPDH-R AAATGCCCTTGAGGTTTCCC
RT-TaEMF2-2D-F3 TGGAGGCGCTGGAGCGGCGGCTA
RT-TaEMF2-2D-R3 GCGCTCCCAGCCCAGCGACCCT
RT-VRN1-5A-F CAGCCTCAAACCAGCTCTTCA
RT-VRN1-5A-R CTCTGCCCTCTCGCCTGT
RT-VRN3-7ABD-F GTCGTTCGGGCAGGAG
RT-VRN3-7ABD-R TCGTGCTCGTACTCTTCCA
pAN-580-GFP-TaEMF2-2D-CDS-F AGCCCAGATCACTAGTATGTGCCGTCAACCGTCG
pAN-580-GFP-TaEMF2-2D-CDS-R TGCTCACCATGGATCCAAACGTCTTCTTCTTGGGTT

Fig. 1

Schematic representation of the structures of TaEMF2 genes in wheat"

Fig. 2

Evolutionary analysis of EMF2 homologs in dicots and monocots Evolutionary analysis of EMF2 among wheat (Triticum aestivum), wild emmer wheat (Triticum dicoccoides), durum wheat (Triticum turgidum), Aegilops tauschii, Triticum urartu, Thinopyrum elongatum, barley (Hordeum vulgare), Brachypodium distachyon, rice (Oryza sativa), maize (Zea mays), sorghum (Sorghum bicolor), sunflower (Helianthus annuus), ginkgo (Ginkgo biloba), Dendrocalamopsis oldhami (Bamboosa oldhami), rape (Brassica napus), Arabidopsis (Arabidopsis thaliana), soybean (Glycine max), and cotton (Gossypium raimondii). Hexaploid wheat homolog genes of TaEMF2 are marked with a red triangle; Brachypodium distachyon EMF2 is marked with a red block; maize and sorghum EMF2 are marked with red circles."

Fig. 3

Subcellular localization of TaEMF2 in wheat protoplast cells mCherry: nucleus marker; Merged: TaEMF2 and GFP signal fusion; Bar: 10 μm."

Fig. 4

Genotype and phenotype of CRISPR/Cas9 gene knockout lines of TaEMF2 A: TaEMF2 gene structure and editing target design. The black box represents the exon, the red line indicates the location of the target site, and the target sequence is below the gene structure. B: diagram of gene-editing vector structure. C: the genotypes of TaEMF2 knockout lines. The PAM and sgRNA targeting sites are indicated by red letters and black lines, respectively. The blue letter represents the insertion of nucleotide, and the black dotted line represents the missing nucleotide. D: the heading date phenotype of TaEMF2 knockout lines. The red arrow refers to the appeared wheat ears, bar: 20 cm. E: statistics of heading days of TaEMF2 knockout lines. Values are mean ± SD (n = 3). ** indicates highly significant difference at the P < 0.01."

Fig. 5

Gene expression and phenotype analyses in the overexpression lines of TaEMF2-2D A: relative expression levels, n = 3; B: the heading date phenotype in TaEMF2-2D overexpression lines, the red arrow refers to the appeared wheat ears. Bar: 20 cm. C: statistics of heading days in TaEMF2-2D overexpression lines. Values are mean ± SD (n = 3). ** indicates highly significant difference at the P < 0.01 level."

Fig. 6

Expression analysis of VRN1 and VRN3 in the TaEMF2 transgenic plants in wheat A, B: expression level of VRN1 and VRN3 in the TaEMF2 knockout lines, respectively. C, D: expression level of VRN1 and VRN3 in the TaEMF2 overexpression lines, respectively. TaGAPDH transcripts were used as an internal reference. Values are mean ± SD (n = 3). * and ** indicate significant difference at the P < 0.05 and P < 0.01, respectively."

[1] Xing L J, Li J, Xu Y Y, Xu Z H, Chong K. Phosphorylation modification of wheat lectin VER2 is associated with vernalization-induced O-GlcNAc signaling and intracellular motility. PLoS One, 2009, 4: e4854.
[2] Yan L L, Fu D L, Li C X, Blechl A, Tranquilli G, Bonafede M, Sanchez A, Valarik M, Yasuda S, Dubcovsky J. The wheat and barley vernalization gene VRN3 is an orthologue of FT. Proc Natl Acad Sci USA, 2006, 103: 19581-19586.
doi: 10.1073/pnas.0607142103 pmid: 17158798
[3] Yan L L, Loukoianov A, Blechl A, Tranquilli G, Ramakrishna W, Sanmiguel P, Bennetzen J L, Echenique V, Dubcovsky J. The wheat VRN2 gene is a flowering repressor down-regulated by vernalization. Science, 2004, 303: 1640-1644.
[4] Yan L L, Loukoianov A, Tranquilli G, Helguera M, Fahima T, Dubcovsky J. Positional cloning of the wheat vernalization gene VRN1. Proc Natl Acad Sci USA, 2003, 100: 6263-6268.
doi: 10.1073/pnas.0937399100 pmid: 12730378
[5] Yong W D, Xu Y Y, Xu W Z, Wang X, Li N, Wu J S, Liang T B, Chong K, Xu Z H, Tan K H, Zhu Z Q. Vernalization-induced flowering in wheat is mediated by a lectin-like gene VER2. Planta, 2003, 217: 261-270.
[6] Kippes N, Debernardi J M, Vasquez-Gross H A, Akpinar B A, Budak H, Kato K, Chao S, Akhunov E, Dubcovsky J. Identification of the VERNALIZATION 4 gene reveals the origin of spring growth habit in ancient wheats from South Asia. Proc Natl Acad Sci USA, 2015, 112: E5401-E5410.
[7] Xu S J, Dong Q, Deng M, Lin D X, Xiao J, Cheng P L, Xing L J, Niu Y D, Gao C X, Zhang W H, Xu Y Y, Chong K. The vernalization-induced long non-coding RNA VAS functions with the transcription factor TaRF2b to promote TaVRN1 expression for flowering in hexaploid wheat. Mol Plant, 2021, 14: 1525-1538.
[8] Lewis E B. A gene complex controlling segmentation in Drosophila. ANature, 1978, 276: 565-570.
[9] Margueron R, Reinberg D. The Polycomb complex PRC2 and its mark in life. Nature, 2011, 469: 343-349.
[10] De Lucia F, Crevillen P, Jones A M E, Greb T, Dean C. A PHD-polycomb repressive complex 2 triggers the epigenetic silencing of FLC during vernalization. Proc Natl Acad Sci USA, 2008, 105: 16831-16836.
[11] Wood C C, Robertson M, Tanner G, Peacock W J, Dennis E S, Helliwell C A. The Arabidopsis thaliana vernalization response requires a polycomb-like protein complex that also includes VERNALIZATION INSENSITIVE 3. Proc Natl Acad Sci USA, 2006, 103: 14631-14636.
[12] Gendall A R, Levy Y Y, Wilson A, Dean C. The VERNALIZATION 2 gene mediates the epigenetic regulation of vernalization in Arabidopsis. Cell, 2001, 107: 525-535.
doi: 10.1016/s0092-8674(01)00573-6 pmid: 11719192
[13] Baroux C, Pien S, Grossniklaus U. Chromatin modification and remodeling during early seed development. Curr Opin Genet Dev, 2007, 17: 473-479.
pmid: 18029170
[14] Berger F, Chaudhury A. Parental memories shape seeds. Trends Plant Sci, 2009, 14: 550-556.
doi: 10.1016/j.tplants.2009.08.003 pmid: 19748816
[15] Goodrich J, Puangsomlee P, Martin M, Long D, Meyerowitz E M, Coupland G. A Polycomb-group gene regulates homeotic gene expression in Arabidopsis. Nature, 1997, 386: 44-51.
[16] Schonrock N, Bouveret R, Leroy O, Borghi L, Kohler C, Gruissem W, Hennig L. Polycomb-group proteins repress the floral activator AGL19 in the FLC-independent vernalization pathway. Genes Dev, 2006, 20: 1667-1678.
[17] Park H Y, Lee S Y, Seok H Y, Kim S H, Sung Z R, Moon Y H. EMF1 interacts with EIP1, EIP6 or EIP9 involved in the regulation of flowering time in Arabidopsis. Plant Cell Physiol, 2011, 52: 1376-1388.
[18] Sanchez R, Kim M Y, Calonje M, Moon Y H, Sung Z R. Temporal and spatial requirement of EMF1 activity for Arabidopsis vegetative and reproductive development. Mol Plant, 2009, 2: 643-653.
[19] Yoshida N, Yanai Y, Chen L, Kato Y, Hiratsuka J, Miwa T, Sung Z R, Takahashi S. EMBRYONIC FLOWER2, a novel polycomb group protein homolog, mediates shoot development and flowering in Arabidopsis. Plant Cell, 2001, 13: 2471-2481.
pmid: 11701882
[20] Tonosaki K, Ono A, Kunisada M, Nishino M, Nagata H, Sakamoto S, Kijima S T, Furuumi H, Nonomura K I, Sato Y, Ohme-Takagi M, Endo M, Comai L, Hatakeyama K, Kawakatsu T, Kinoshita T. Mutation of the imprinted gene OsEMF2a induces autonomous endosperm development and delayed cellularization in rice. Plant Cell, 2021, 33: 85-103.
[21] Conrad L J, Khanday I, Johnson C, Guiderdoni E, An G, Vijayraghavan U, Sundaresan V. The polycomb group gene EMF2B is essential for maintenance of floral meristem determinacy in rice. Plant J, 2014, 80: 883-894.
[22] Chen C, Li T T, Zhu S, Liu Z H, Shi Z Y, Zheng X M, Chen R, Huang J F, Shen Y, Luo S Y, Wang L, Liu Q Q, Zhiguo E. Characterization of imprinted genes in rice reveals conservation of regulation and imprinting with other plant species. Plant Physiol, 2018, 177: 1754-1771.
doi: 10.1104/pp.17.01621 pmid: 29914891
[23] Yang J, Lee S, Hang R L, Kim S R, Lee Y S, Cao X F, Amasino R, An G. OsVIL2 functions with PRC2 to induce flowering by repressing OsLFL1 in rice. Plant J, 2013, 73: 566-578.
[24] Xie S Y, Chen M, Pei R, Ouyang Y D, Yao J L. OsEMF2b acts as a regulator of flowering transition and floral organ identity by mediating H3K27me3 deposition at OsLFL1 and OsMADS4 in rice. Plant Mol Biol Rep, 2015, 33: 121-132.
[25] Ma Q F, Qu Z Y, Wang X Y, Qiao K K, Mangi N, Fan S L. EMBRYONIC FLOWER2B, coming from a stable QTL, represses the floral transition in cotton. Int J Biol Macromol, 2020, 163: 1087-1096.
doi: S0141-8130(20)33859-9 pmid: 32679317
[26] Liu M S, Chen L F O, Lin C H, Lai Y M, Huang J Y, Sung Z R. Molecular and functional characterization of broccoli EMBRYONIC FLOWER 2 genes. Plant Cell Physiol, 2012, 53: 1217-1231.
[27] Zhou X, Wang L L, Yan J, Ye J B, Cheng S Y, Xu F, Wang G Y, Zhang W W, Liao Y L, Liu X M. Functional characterization of the EMBRYONIC FLOWER 2 gene involved in flowering in Ginkgo biloba. Front Plant Sci, 2021, 12: 681166.
[28] 杨浩. 绿竹成花相关基因BoEMF2的克隆和功能分析. 浙江农林大学硕士学位论文,浙江杭州, 2011.
Yang H. Cloning and Functional Analysis of the BoEMF2 Gene Related to the Flowering of Green Bamboo. MS Thesis of Zhejiang A&F University, Hangzhou, Zhejiang, China, 2011 (in Chinese with English abstract).
[29] Chanvivattana Y, Bishopp A, Schubert D, Stock C, Moon Y H, Sung Z R, Goodrich J. Interaction of Polycomb-group proteins controlling flowering in Arabidopsis. Development, 2004, 131: 5263-5276.
doi: 10.1242/dev.01400 pmid: 15456723
[30] Jiang D H, Wang Y Q, Wang Y Z, He Y H. Repression of flowering locus c and flowering locus t by the Arabidopsis Polycomb repressive complex 2 components. PLoS One, 2008, 3: e3404.
[31] Chou M L, Haung M D, Yang C H. EMF genes interact with late-flowering genes in regulating floral initiation genes during shoot development in Arabidopsis thaliana. Plant Cell Physiol, 2001, 42: 499-507.
pmid: 11382816
[32] Zhang X L, Li W J, Liu Y, Li Y Z, Li Y, Yang W D, Chen X S, Pi L M, Yang H C. Replication protein RPA2A regulates floral transition by cooperating with PRC2 in Arabidopsis. New Phytol, 2022, 235: 2439-2453.
[1] Wang Wen-Yuan, Yan Xue-Jia, Liu Yu-Lin, Sun Xiao-Tong, Li Ya-Nan, Tang Xin-Hua, Shi Ying. Screening of low-light-tolerant potato varieties and cloning and functional analysis of the transcription factor gene StPIF3 [J]. Acta Agronomica Sinica, 2026, 52(6): 1631-1645.
[2] Chen Wei, Wei Wan-Juan, Zhao Qi-Bing, Chang Dong-Wei, Yu Ling-Bo, Zhai Peng-Fei, Feng Zhi-Ming, Chen Zong-Xiang, Ren Yang-Tao, Yang Peng, Liu Hai-Lang, Li Zhen-Fu, Yang Yong-Le, Jin Yan-Gang, Zuo Shi-Min. Developing new germplasm of high-quality and early-maturing rice by editing Hd6 via CRISPR/Cas9 [J]. Acta Agronomica Sinica, 2026, 52(4): 1046-1056.
[3] MA Juan-E, YAO You-Hua, YAO Xiao-Hua, WU Kun-Lun, CUI Yong-Mei. Cloning and functional analysis of HvERF039 gene in Qingke (Hordeum vulgare L. var. nudum Hook. f) [J]. Acta Agronomica Sinica, 2025, 51(9): 2341-2357.
[4] YIN Yu-Meng, WANG Yan-Nan, KANG Zhi-He, QIAO Shou-Chen, BIAN Qian-Qian, LI Ya-Wei, CAO Guo-Zheng, ZHAO Guo-Rui, XU Dan-Dan, YANG Yu-Feng. Cloning and functional analysis of glutathione S-transferase gene IbGSTU7 in sweetpotato [J]. Acta Agronomica Sinica, 2025, 51(7): 1736-1746.
[5] ZHAO Ling, LIANG Wen-Hua, ZHAO Chun-Fang, WEI Xiao-Dong, ZHOU Li-Hui, YAO Shu, WANG Cai-Lin, ZHANG Ya-Dong. Mapping of QTLs for heading date of rice with high-density bin genetic map [J]. Acta Agronomica Sinica, 2023, 49(1): 119-128.
[6] XU Kai, ZHENG Xing-Fei, ZHANG Hong-Yan, HU Zhong-Li, NING Zi-Lan, LI Lan-Zhi. Genome-wide association analysis of indica-rice heading date based on NCII genetic mating design [J]. Acta Agronomica Sinica, 2023, 49(1): 86-96.
[7] YUAN Da-Shuang, DENG Wan-Yu, WANG Zhen, PENG Qian, ZHANG Xiao-Li, YAO Meng-Nan, MIAO Wen-Jie, ZHU Dong-Ming, LI Jia-Na, LIANG Ying. Cloning and functional analysis of BnMAPK2 gene in Brassica napus [J]. Acta Agronomica Sinica, 2022, 48(4): 840-850.
[8] LIU Yan-Di, ZHAO Bao-Ping, ZHANG Yu, MI Jun-Zhen, WU Jun-Ying, LIU Jing-Hui. Relationship between yield differences of different genotypes of oats and leaf physiological characteristics [J]. Acta Agronomica Sinica, 2022, 48(11): 2953-2964.
[9] GUO Bao-Jian, WANG Shuang, LYU Chao, WANG Fei-Fei, XU Ru-Gen. Regulation of adventitious root development by HvLBD19 gene in barley (Hordeum vulgare L.) [J]. Acta Agronomica Sinica, 2022, 48(10): 2435-2442.
[10] LI Xiao-Xu, WANG Rui, ZHANG Li-Xia, SONG Ya-Meng, TIAN Xiao-Nan, GE Rong-Chao. Cloning and functional identification of gene OsATS in rice [J]. Acta Agronomica Sinica, 2021, 47(10): 2045-2052.
[11] ZHANG Huan, YANG Nai-Ke, SHANG Li-Li, GAO Xiao-Ru, LIU Qing-Chang, ZHAI Hong, GAO Shao-Pei, HE Shao-Zhen. Cloning and functional analysis of a drought tolerance-related gene IbNAC72 in sweet potato [J]. Acta Agronomica Sinica, 2020, 46(11): 1649-1658.
[12] HAO Zhi-Ming,GENG Miao-Miao,WEN Shu-Min,YAN Gui-Jun,WANG Rui-Hui,LIU Gui-Ru. Development and validation of markers linked to genes resistant to Sitodiplosis mosellana in wheat [J]. Acta Agronomica Sinica, 2020, 46(02): 179-193.
[13] MA Jin-Jiao,LAN Jin-Ping,ZHANG Tong,CHEN Yue,GUO Ya-Lu,LIU Yu-Qing,YAN Gao-Wei,WEI Jian,DOU Shi-Juan,YANG Ming,LI Li-Yun,LIU Guo-Zhen. Overexpression of OsMPK17 protein enhances drought tolerance of rice [J]. Acta Agronomica Sinica, 2020, 46(01): 20-30.
[14] Lhundrupnamgyal,Hui-Hui LI,Gang-Gang GUO, Chemiwangmo,Li-Yun GAO,Ya-Wei TANG, Nyematashi, Dawadondrup, Dolkar. Growth habit identification and diversity and stability analysis of heading date in Tibetan barley (Hordeum vulgare L.) [J]. Acta Agronomica Sinica, 2019, 45(12): 1796-1805.
[15] Hai-Xin LONG,Hai-Yang QIU,UZAIR Muhammad,Jing-Jing FANG,Jin-Feng ZHAO,Xue-Yong LI. Phenotypic Analysis and Gene Mapping of the Rice Narrow-leaf Mutant nal20 [J]. Acta Agronomica Sinica, 2018, 44(9): 1301-1310.
Viewed
Full text


Abstract

Cited

  Shared   
  Discussed   
No Suggested Reading articles found!