Welcome to Acta Agronomica Sinica，

Acta Agronomica Sinica ›› 2022, Vol. 48 ›› Issue (11): 2706-2714.doi: 10.3724/SP.J.1006.2022.14220

• CROP GENETICS & BREEDING·GERMPLASM RESOURCES·MOLECULAR GENETICS • Previous Articles     Next Articles

Construction and application of soybean CRISPR/Cas9 multiplex editing vector

CHEN Xiang-Qian(), JIANG Qi-Yan(), SUN Xian-Jun, NIU Feng-Juan, ZHANG Hui-Yuan, HU Zheng*(), ZHANG Hui*()   

  1. Institute of Crop Sciences, Chinese Academy of Agricultural Sciences, Beijing 100081, China
  • Received:2021-11-26 Accepted:2022-02-25 Online:2022-11-12 Published:2022-03-08
  • Contact: HU Zheng,ZHANG Hui E-mail:chen810702351@gmail.com;jiangqiyan@caas.cn;huzheng@caas.cn;zhanghui06@caas.cn
  • Supported by:
    The Key Research and Development Program of Hainan Province(ZDYF2022XDNY135);The Agricultural Science and Technology Program for Innovation Program(CAAS-ZDRW202201);The National Key Research and Development Program of China(2021YFD1201603-2);The National Natural Science Foundation of China(31601302)

RichHTML404

34

PDF

502

Abstract:

Most members of one gene family have similar function in soybean. Construction of soybean multiplex editing vector to edit multiple genes or gene families have important application value in soybean gene editing and gene functions, especially for the soybean with low transformation efficiency. Here, we reported a CRISPR/Cas9 multiplex editing vector, pCambia3301- Cas9-GmU6n-gDNAn, that enabled the editing of multiple genes in soybean. In this vector, different sgRNAs were driven by different soybean U6 promoters, and multiple sgRNA expression cassettes were assembled into pCambia3301-Cas9 vector by isocaudamers. The result showed that this system could simultaneously produce multiple mutations in soybean hairy roots by targeting multiple GRF genes via single transformation events. This vector can improve the efficiency of gene editing in soybean, and provide a simple toolbox for studying functions of multiple genes and gene families in soybean for basic research and genetic improvement.

Key words: soybean, GmU6 promoter, CRISPR/Cas9 multiplex editing vector, hairy root

Table 1

Primers used in this study"

引物名称
Primer name		 引物序列
Primer sequence (5°-3°)
载体构建引物Primers used in construction of vectors
PDS-HF GAAATGTGCCACCACATGGATTggtgaccGCGCACAACCCTTTCCAGTTTCT
PDS-HR AACTTGCTATTTCTAGCTCTAAAAcctaggCATCATAGTTACTAACCTCACT
GmU6-2-HF TGTAAAACGACGGCCAGAGAATTCGAGCTCGAGTCCAATATGCCC
GmU6-2-HR AACTGGAAAGGGTTGTGCGCGGTCACCAACATCTTGAATGTTGTATGTC
GmU6-8-HF TGTAAAACGACGGCCAGAGAATTCGAGCTCGAGATTCGAGCTCGA
GmU6-8-HR AACTGGAAAGGGTTGTGCGCGGTCACCAATCCATATGTTTTCCTGGGACT
GmU6-11-HF TGTAAAACGACGGCCAGAGAATTCGAGCTCGAGATGGTCTATGAG
GmU6-11-HR AACTGGAAAGGGTTGTGCGCGGTCACCAACCAGTTTGTTCCATCTCTG
串联sgRNA构建引物Primers used in assembling of multiple sgRNA expression cassettes
U2-GRF TGACATACAACATTCAAGATGTTGAAACCGTTCAAGAAAGCCTGGTTTTAGAGCTAGAAATAGCAAGT
U8-GRF TAGTCCCAGGAAAACATATGGATTGCCACAGGCTTTCTTGAACGAGTTTTAGAGCTAGAAATAGCAAGT
U10-GRF GAAATGTGCCACCACATGGATTGGTTCCACAGGCTTTCTTGAAGTTTTAGAGCTAGAAATAGCAAGT
U11-GRF CAGAGATGGAACAAACTGGTTGGAATCGTTCAAGAAAGCCTGGTTTTAGAGCTAGAAATAGCAAGT
GRF突变检测PCR引物Primers used in the detection of GRF mutations
GRF5-F/R GAGCCAGGGAGGTGTAGGAG/AATGTGATGAATGGAATAAACGA
GRF6-F/R ATGGAAAGAAATGGCGATGC/ACCAACCACAAACGAGGAAA
GRF7-F/R ATGGGATGAGGATGATGATGT/GAGGAATGAGGAGGAATAGGG
GRF8-F/R GAGCCAGGCAGGTGTAGGAG/ACGAATGAGGTGGAAGAGGG
GRF9-F/R CACATCCTCTTCTCGCTCTTC/GAAACTCACCTGGGTTCCTTAT
GRF10-F/R GTTCACAGTGGATGGTGGTTT/CAAGGTATGGCTGAGTGGTAGTA
GRF13-F/R GCAGGAGGACTGATGGAAAA/TACTTGGAATCGCATAGGGA
GRF14-F/R CCATTTTGTCTTTATTGCTGC/TGGGAAGGTTTTGGAAGTTTA
GRF15-F/R TGTTGATTGGTTATTTGGTGC/TGTGATAGTGGGTTTGGTCTGA
GRF16-F/R ATATTAGTGATAAAGTAGAGGTGGGA/AACTCAATAACAAGCAGACGC
GRF17-F/R ATGAGCGTTCCTCCGCCGTCT/CCCTTGCGCCATTGATGTGC
GRF18-F/R TGACCTCCTTCTCCCCATTC/CAGTTGCAGTTCCAGAAACATTA
GRF19-F/R AATCAGGGTATTGGGGTAGAG/AGGGTGGTGAACAAATGGAA
GRF20-F/R AGGGTATTGGGGTAGAGGAGC/CGAAGAAGATCAAATGGGGAT
GRF21-F/R TCAGGGTACTACTGGCGAAGA/TGACCGAGGTGAAGGAGATT

Fig. 1

Vector construction of sgRNA3.0 with different sgRNAs driven by different soybean U6 promoters A and B: construction of pGmU6-sgRNA3.0 vector, M: DL2000; A1: PCR clone of PDS gene; A2: pGmU6-10-sgRNA2.0 digested with Bsa I; A3: pGmU6-10-sgRNA3.0 digested with BstE II and Avr II; B1: pGmU6-2-sgRNA3.0 digested with BstE II and Xho I; B2: GmU6-2, B3: GmU6-8, B4: GmU6-11. C: structure of pGmU6-sgRNA3.0 vector."

Fig. 2

Vector construction of pCambia3301-Cas9-GmU6n-gDNAn A: pGmU6-sgRNA3.0 digested with BstE II and Avr II. M: DL2000; 1-4: pGmU6-2/8/10/11-sgRNA3.0 digested with BstE II and Avr II. B: pGmU6-gDNA digested with appropriate restriction enzymes. M: DL2000; 1: pGmU6-10-gDNA digested with BamH I and Sal I; 2-4: pGmU6-2-gDNA, pGmU6-8-gDNA, pGmU6-11-gDNA digested with BamH I and Xho I separately. C: vector construction of pCambia3301-Cas9-GmU6n-gDNAn. M: 1 kb ladder; 1: pCambia3301-Cas9 digested with EcoR I and Hind III; 2: pGmU6n-gDNAn digested with EcoR I and Hind III; 3: pCambia3301-Cas9-GmU6n-gDNAnv vector; 4: pCambia3301-Cas9-GmU6n-gDNAn digested with EcoR I and Hind III."

Fig. 3

Diagram of binary CRISPR/Cas9 multiplex editing vectors Cas9 fused with a single nuclear localization signal (NLS) is expressed with a Cauliflower mosaic virus 35S (CaMV 35S) promoter. Synthetic guide RNA (sgRNA) is derived using different soybean U6 promoters. The synthetic skeleton of multiplex editing vector consists of tandemly arrayed GmU6-gDNA-sgRNA units, containing one soybean U6 promoter (GmU6-2/8/10/11), a target-specific spacer (gDNA1/2/3/4) and conserved sgRNA scaffold in each unit. LB: left border; RB: right border."

Fig. 4

Detection of GRF mutation with PCR-T7 Endonuclease I Lanes 1-12 indicates digested products with T7 Endonuclease I of GRF gene cloned in different single hairy root of soybean, and the single band means no mutation in GRF, multiple bands mean mutation in GRF gene (indicated with arrows). M: DL2000 marker."

Fig. 5

Mutation detection by sequencing of GRF gene cloned in the same transgenic hairy root in soybean Wild-type sequences of the target genes are the PAM sequence highlighted in red and gDNA sequence highlighted in blue. GRFn indicates the mutant sequence of GRF gene, and the change in the number of nucleotides is the right of each sequence. -: deletion."

[1] Wyman C, Kanaar R. DNA double-strand break repair: all’s well that ends well. Annu Rev Genet, 2006, 40: 363-383.
doi: 10.1146/annurev.genet.40.110405.090451
[2] Li J F, Norville J E, Aach J, McCormack M, Zhang D, Bush J, Church G M, Sheen J. Multiplex and homologous recombination-mediated genome editing in Arabidopsis and Nicotiana benthamiana using guide RNA and Cas9. Nat Biotechnol, 2013, 31: 688-691.
doi: 10.1038/nbt.2654
[3] Li W, Teng F, Li T, Zhou Q. Simultaneous generation and germline transmission of multiple gene mutations in rat using CRISPR-Cas systems. Nat Biotechnol, 2013, 31: 684-686.
doi: 10.1038/nbt.2652
[4] Shan Q, Wang Y, Li J, Zhang Y, Chen K, Liang Z, Zhang K, Liu J, Xi J J, Qiu J L, Gao C. Targeted genome modification of crop plants using a CRISPR-Cas system. Nat Biotechnol, 2013, 31: 686-688.
doi: 10.1038/nbt.2650
[5] Zhan X, Lu Y, Zhu J K, Botella J R. Genome editing for plant research and crop improvement. J Integr Plant Biol, 2021, 63: 3-33.
doi: 10.1111/jipb.13063
[6] Feng Z, Mao Y, Xu N, Zhang B, Wei P, Yang D L, Wang Z, Zhang Z, Zheng R, Yang L, Zeng L, Liu X, Zhu J K. Multigeneration analysis reveals the inheritance, specificity, and patterns of CRISPR/Cas-induced gene modifications in Arabidopsis. Proc Natl Acad Sci USA, 2014, 111: 4632-4637.
doi: 10.1073/pnas.1400822111
[7] Jiang W Z, Yang B, Weeks D P. Efficient CRISPR/Cas9-mediated gene editing in Arabidopsis thaliana and inheritance of modified genes in the T2 and T3 generations. PLoS One, 2014, 9: e99225.
doi: 10.1371/journal.pone.0099225
[8] Zhang H, Zhang J, Wei P, Zhang B, Gou F, Feng Z, Mao Y, Yang L, Zhang H, Xu N, Zhu J K. The CRISPR/Cas9 system produces specific and homozygous targeted gene editing in rice in one generation. Plant Biotechnol J, 2014, 12: 797-807.
doi: 10.1111/pbi.12200 pmid: 24854982
[9] Wang Y, Cheng X, Shan Q, Zhang Y, Liu J, Gao C, Qiu J L. Simultaneous editing of three homoeoalleles in hexaploid bread wheat confers heritable resistance to powdery mildew. Nat Biotechnol, 2014, 32: 947-951.
doi: 10.1038/nbt.2969
[10] Zheng M, Zhang L, Tang M, Liu J, Liu H, Yang H, Fan S, Terzaghi W, Wang H, Hua W. Knockout of two bnamax1 homologs by CRIPSR/Cas9-targeted mutagenesis improves plant architecture and increases yield in rapeseed (Brassica napus L.). Plant Biotechnol J, 2020, 18: 644-654.
doi: 10.1111/pbi.13228 pmid: 31373135
[11] Li B, Liang S, Alariqi M, Wang F, Wang G, Wang Q, Xu Z, Yu L, Naeem Zafar M, Sun L, Si H, Yuan D, Guo W, Wang Y, Lindsey K, Zhang X, Jin S. The application of temperature sensitivity CRISPR/LbCpf1 (LbCas12a) mediated genome editing in allotetraploid cotton (G. hirsutum) and creation of nontransgenic, gossypol-free cotton. Plant Biotechnol J, 2021, 19: 221-223.
doi: 10.1111/pbi.13470
[12] Pramanik D, Shelake R M, Park J, Kim M J, Hwang I, Park Y, Kim J Y. CRISPR/Cas9-mediated generation of pathogen- resistant tomato against Tomato yellow leaf curl virus and powdery mildew. Int J Mol Sci, 2021, 22: 1878.
doi: 10.3390/ijms22041878
[13] Qi X, Zhang C, Zhu J, Liu C, Huang C, Li X, Xie C. Genome editing enables next-generation hybrid seed production technology. Mol Plant, 2020, 13: 1262-1269.
doi: 10.1016/j.molp.2020.06.003
[14] Ma X, Zhu Q, Chen Y, Liu Y G. CRISPR/Cas9 platforms for genome editing in plants: developments and applications. Mol Plant, 2016, 9: 961-974.
doi: 10.1016/j.molp.2016.04.009
[15] Schmutz J, Cannon S B, Schlueter J, Ma J, Mitros T, Nelson W, Hyten D L, Song Q, Thelen J J, Cheng J, Xu D, Hellsten U, May G D, Yu Y, Sakurai T, Umezawa T, Bhattacharyya M K, Sandhu D, Valliyodan B, Lindquist E, Peto M, Grant D, Shu S, Goodstein D, Barry K, Futrell-Griggs M, Abernathy B, Du J, Tian Z, Zhu L, Gill N, Joshi T, Libault M, Sethuraman A, Zhang X C, Shinozaki K, Nguyen H T, Wing R A, Cregan P, Specht J, Grimwood J, Rokhsar D, Stacey G, Shoemaker R C, Jackson S A. Genome sequence of the palaeopolyploid soybean. Nature, 2010, 463: 178-183.
doi: 10.1038/nature08670
[16] Xie K, Minkenberg B, Yang Y. Boosting CRISPR/Cas9 multiplex editing capability with the endogenous tRNA-processing system. Proc Natl Acad Sci USA, 2015, 12: 3570-3575.
[17] Bollier N, Andrade Buono R, Jacobs T B, Nowack M K. Efficient simultaneous mutagenesis of multiple genes in specific plant tissues by multiplex CRISPR. Plant Biotechnol J, 2021, 19: 651-653.
doi: 10.1111/pbi.13525
[18] Ma X, Zhang Q, Zhu Q, Liu W, Chen Y, Qiu R, Wang B, Yang Z, Li H, Lin Y, Xie Y, Shen R, Chen S, Wang Z, Chen Y, Guo J, Chen L, Zhao X, Dong Z, Liu Y G. A Robust CRISPR/Cas9 system for convenient, high-efficiency multiplex genome editing in monocot and dicot plants. Mol Plant, 2015, 8: 1274-1284.
doi: 10.1016/j.molp.2015.04.007
[19] Bao A, Chen H, Chen L, Chen S, Hao Q, Guo W, Qiu D, Shan Z, Yang Z, Yuan S, Zhang C, Zhang X, Liu B, Kong F, Li X, Zhou X, Tran L P, Cao D. CRISPR/Cas9-mediated targeted mutagenesis of GmSPL9 genes alters plant architecture in soybean. BMC Plant Biol, 2019, 19: 131.
doi: 10.1186/s12870-019-1746-6
[20] Cheng Q, Dong L, Su T, Li T, Gan Z, Nan H, Lu S, Fang C, Kong L, Li H, Hou Z, Kou K, Tang Y, Lin X, Zhao X, Chen L, Liu B, Kong F. CRISPR/Cas9-mediated targeted mutagenesis of GmLHY genes alters plant height and internode length in soybean. BMC Plant Biol, 2019, 19: 562.
doi: 10.1186/s12870-019-2145-8 pmid: 31852439
[21] Di Y H, Sun X J, Hu Z, Jiang Q Y, Song G H, Zhang B, Zhao S S, Zhang H. Enhancing the CRISPR/Cas9 system based on multiple GmU6 promoters in soybean. Biochem Biophys Res Commun, 2019, 519: 819-823.
doi: 10.1016/j.bbrc.2019.09.074
[22] Sun X, Hu Z, Chen R, Jiang Q, Song G, Zhang H, Xi Y. Targeted mutagenesis in soybean using the CRISPR-Cas9 system. Sci Rep, 2015, 5: 10342.
doi: 10.1038/srep10342
[23] Liu W, Zhou Y, Li X, Wang X, Dong Y, Wang N, Liu X, Chen H, Yao N, Cui X, Jameel A, Wang F, Li H. Tissue-specific regulation of Gma-miR396 family on coordinating development and low water availability responses. Front Plant Sci, 2017, 8: 1112.
doi: 10.3389/fpls.2017.01112
[24] Niu F N, Jiang Q Y, Sun X J, Hu Z, Wang L X, Zhang H. Large DNA fragment deletion in lncRNA77580 regulates neighboring gene expression in soybean (Glycine max). Funct Plant Biol, 2021, 48: 1139-1147.
doi: 10.1071/FP20400
[25] Zhang X H, Tee L Y, Wang X G, Huang Q S, Yang S H. Off-target effects in CRISPR/Cas9-mediated genome engineering. Mol Theor Nucl Acids, 2015, 4: e264.
[26] Cai Y, Chen L, Sun S, Wu C, Yao W, Jiang B, Han T, Hou W. CRISPR/Cas9-mediated deletion of large genomic fragments in soybean. Int J Mol Sci, 2018, 19: 3835.
doi: 10.3390/ijms19123835
[27] Zhang P P, Du H Y, Wang J, Pu Y X, Yang C Y, Yan R J, Yang H, Cheng H, Yu D Y. Mutiplex CRISPR/Cas9-mediated metabolic engineering increases soybean isoflavone content and resistance to soybean mosaic virus. Plant Biotechnol J, 2020, 18: 1384-1395.
doi: 10.1111/pbi.13302
[28] Luo Y, Na R, Nowak J S. Qiu Y, Lu Q S, Yang C, Marsolais F, Tian L. Development of a Csy4-processed guide RNA delivery system with soybean-infecting virus ALSV for genome editing. BMC Plant Biol, 2021, 21: 419.
doi: 10.1186/s12870-021-03138-8
[29] Ye F, Signer E R. RIGS (repeat-induced gene silencing) in Arabidopsis is transcriptional and alters chromatin configuration. Proc Natl Acad Sci USA, 1996, 93: 10881-10886.
doi: 10.1073/pnas.93.20.10881
[30] Rosser J M, An W. Repeat-induced gene silencing of L1 transgenes is correlated with differential promoter methylation. Gene, 2010, 456: 15-23.
doi: 10.1016/j.gene.2010.02.005 pmid: 20167267
[1] LIU Cheng, ZHANG Ya-Xuan, CHEN Xian-Lian, HAN Wei, XING Guang-Nan, HE Jian-Bo, ZHANG Jiao-Ping, ZHANG Feng-Kai, SUN Lei, LI Ning, WANG Wu-Bin, GAI Jun-Yi. Wild segments associated with 100-seed weight and their candidate genes in a wild chromosome segment substitution line population [J]. Acta Agronomica Sinica, 2022, 48(8): 1884-1893.
[2] HUAI Yuan-Yuan, ZHANG Sheng-Rui, WU Ting-Ting, AZAM Muhammad, LI Jing, SUN Shi, HAN Tian-Fu, LI Bin, SUN Jun-Ming. Potential evaluation of molecular markers related to major nutritional quality traits in soybean breeding [J]. Acta Agronomica Sinica, 2022, 48(8): 1957-1976.
[3] KE Dan-Xia, HUO Ya-Ya, LIU Yi, LI Jin-Ying, LIU Xiao-Xue. Functional analysis of GmTGA26 gene under salt stress in soybean [J]. Acta Agronomica Sinica, 2022, 48(7): 1697-1708.
[4] YANG Huan, ZHOU Ying, CHEN Ping, DU Qing, ZHENG Ben-Chuan, PU Tian, WEN Jing, YANG Wen-Yu, YONG Tai-Wen. Effects of nutrient uptake and utilization on yield of maize-legume strip intercropping system [J]. Acta Agronomica Sinica, 2022, 48(6): 1476-1487.
[5] CHEN Ling-Ling, LI Zhan, LIU Ting-Xuan, GU Yong-Zhe, SONG Jian, WANG Jun, QIU Li-Juan. Genome wide association analysis of petiole angle based on 783 soybean resources (Glycine max L.) [J]. Acta Agronomica Sinica, 2022, 48(6): 1333-1345.
[6] YU Chun-Miao, ZHANG Yong, WANG Hao-Rang, YANG Xing-Yong, DONG Quan-Zhong, XUE Hong, ZHANG Ming-Ming, LI Wei-Wei, WANG Lei, HU Kai-Feng, GU Yong-Zhe, QIU Li-Juan. Construction of a high density genetic map between cultivated and semi-wild soybeans and identification of QTLs for plant height [J]. Acta Agronomica Sinica, 2022, 48(5): 1091-1102.
[7] LI A-Li, FENG Ya-Nan, LI Ping, ZHANG Dong-Sheng, ZONG Yu-Zheng, LIN Wen, HAO Xing-Yu. Transcriptome analysis of leaves responses to elevated CO2 concentration, drought and interaction conditions in soybean [Glycine max (Linn.) Merr.] [J]. Acta Agronomica Sinica, 2022, 48(5): 1103-1118.
[8] PENG Xi-Hong, CHEN Ping, DU Qing, YANG Xue-Li, REN Jun-Bo, ZHENG Ben-Chuan, LUO Kai, XIE Chen, LEI Lu, YONG Tai-Wen, YANG Wen-Yu. Effects of reduced nitrogen application on soil aeration and root nodule growth of relay strip intercropping soybean [J]. Acta Agronomica Sinica, 2022, 48(5): 1199-1209.
[9] WANG Hao-Rang, ZHANG Yong, YU Chun-Miao, DONG Quan-Zhong, LI Wei-Wei, HU Kai-Feng, ZHANG Ming-Ming, XUE Hong, YANG Meng-Ping, SONG Ji-Ling, WANG Lei, YANG Xing-Yong, QIU Li-Juan. Fine mapping of yellow-green leaf gene (ygl2) in soybean (Glycine max L.) [J]. Acta Agronomica Sinica, 2022, 48(4): 791-800.
[10] LI Rui-Dong, YIN Yang-Yang, SONG Wen-Wen, WU Ting-Ting, SUN Shi, HAN Tian-Fu, XU Cai-Long, WU Cun-Xiang, HU Shui-Xiu. Effects of close planting densities on assimilate accumulation and yield of soybean with different plant branching types [J]. Acta Agronomica Sinica, 2022, 48(4): 942-951.
[11] DU Hao, CHENG Yu-Han, LI Tai, HOU Zhi-Hong, LI Yong-Li, NAN Hai-Yang, DONG Li-Dong, LIU Bao-Hui, CHENG Qun. Improving seed number per pod of soybean by molecular breeding based on Ln locus [J]. Acta Agronomica Sinica, 2022, 48(3): 565-571.
[12] ZHOU Yue, ZHAO Zhi-Hua, ZHANG Hong-Ning, KONG You-Bin. Cloning and functional analysis of the promoter of purple acid phosphatase gene GmPAP14 in soybean [J]. Acta Agronomica Sinica, 2022, 48(3): 590-596.
[13] WANG Juan, ZHANG Yan-Wei, JIAO Zhu-Jin, LIU Pan-Pan, CHANG Wei. Identification of QTLs and candidate genes for 100-seed weight trait using PyBSASeq algorithm in soybean [J]. Acta Agronomica Sinica, 2022, 48(3): 635-643.
[14] ZHANG Guo-Wei, LI Kai, LI Si-Jia, WANG Xiao-Jing, YANG Chang-Qin, LIU Rui-Xian. Effects of sink-limiting treatments on leaf carbon metabolism in soybean [J]. Acta Agronomica Sinica, 2022, 48(2): 529-537.
[15] GE Tian-Li, TIAN Yu, ZHANG Hao, LIU Zhang-Xiong, LI Ying-Hui, QIU Li-Juan. QTL mapping and candidate gene prediction of soybean 100-seed weight based on high-density bin map [J]. Acta Agronomica Sinica, 2022, 48(12): 2978-2986.
Viewed
Full text


Abstract

Cited
  Shared   
  Discussed   
[1] WANG Li-Yan;ZHAO Ke-Fu. Some Physiological Response of Zea mays under Salt-stress[J]. Acta Agron Sin, 2005, 31(02): 264 -268 .
[2] Qi Zhixiang;Yang Youming;Zhang Cunhua;Xu Chunian;Zhai Zhixi. Cloning and Analysis of cDNA Related to the Genes of Secondary Wall Thickening of Cotton (Gossypium hirsutum L.) Fiber[J]. Acta Agron Sin, 2003, 29(06): 860 -866 .
[3] NI Da-Hu;YI Cheng-Xin;LI Li;WANG Xiu-Feng;ZHANG Yi;ZHAO Kai-Jun;WANG Chun-Lian;ZHANG Qi;WANG Wen-Xiang;YANG Jian-Bo. Developing Rice Lines Resistant to Bacterial Blight and Blast with Molecular Marker-Assisted Selection[J]. Acta Agron Sin, 2008, 34(01): 100 -105 .
[4] DAI Xiao-Jun;LIANG Man-Zhong;CHEN Liang-Bi. Comparison of rDNA Internal Transcribed Spacer Sequences in Oryza sativa L.[J]. Acta Agron Sin, 2007, 33(11): 1874 -1878 .
[5] WANG Bao-Hua;WU Yao-Ting;HUANG Nai-Tai;GUO Wang-Zhen;ZHU Xie-Fei;ZHANG Tian-Zhen. QTL Analysis of Epistatic Effects on Yield and Yield Component Traits for Elite Hybrid Derived-RILs in Upland Cotton[J]. Acta Agron Sin, 2007, 33(11): 1755 -1762 .
[6] WANG Chun-Mei;FENG Yi-Gao;ZHUANG Li-Fang;CAO Ya-Ping;QI Zeng-Jun;BIE Tong-De;CAO Ai-Zhong;CHEN Pei-Du. Screening of Chromosome-Specific Markers for Chromosome 1R of Secale cereale, 1V of Haynaldia villosa and 1Rk#1 of Roegneria kamoji[J]. Acta Agron Sin, 2007, 33(11): 1741 -1747 .
[7] Zhao Qinghua;Huang Jianhua;Yan Changjing. A STUDY ON THE POLLEN GERMINATION OF BRASSICA NAPUS L.[J]. Acta Agron Sin, 1986, (01): 15 -20 .
[8] ZHOU Lu-Ying;LI Xiang-Dong;WANG Li-Li;TANG Xiao;LIN Ying-Jie. Effects of Different Ca Applications on Physiological Characteristics, Yield and Quality in Peanut[J]. Acta Agron Sin, 2008, 34(05): 879 -885 .
[9] WANG Li-Xin; LI Yun-Fu; CHANG Li-Fang; HUANG Lan ;; LI Hong-Bo ; GE Ling-Ling; Liu Li-Hua ;; YAO Ji ;; ZHAO Chang-Ping ;. Method of ID Constitution for Wheat Cultivars[J]. Acta Agron Sin, 2007, 33(10): 1738 -1740 .
[10] ZHENG Tian-Qing;XU Jian-Long;FU Bing-Ying;GAO Yong-Ming;Satish VERUKA;Renee LAFITTE;ZHAI Hu-Qu;WAN Jian-Min;ZHU Ling-Hua;LI Zhi-Kang. Preliminary Identification of Genetic Overlaps between Sheath Blight Resistance and Drought Tolerance in the Introgression Lines from Directional Selection[J]. Acta Agron Sin, 2007, 33(08): 1380 -1384 .
Add: No. 80 Xueyuan South Rd, Beijing 100081, P. R. China E-mail: zwxb301@caas.cn
Supported by Beijing Magtech Co.Ltd