Welcome to Acta Agronomica Sinica，

Acta Agronomica Sinica ›› 2020, Vol. 46 ›› Issue (6): 809-818.doi: 10.3724/SP.J.1006.2020.91067

• CROP GENETICS & BREEDING · GERMPLASM RESOURCES · MOLECULAR GENETICS •     Next Articles

Functional characteristics of TaPYR1, an abscisic acid receptor family gene in mediating wheat tolerance to drought stress

HAN Le,DU Ping-Ping,XIAO Kai()   

  1. College of Agronomy, Hebei Agricultural University, Baoding 071001, Hebei, China
  • Received:2019-11-09 Accepted:2020-01-15 Online:2020-06-12 Published:2020-02-14
  • Contact: Kai XIAO E-mail:xiaokai@hebau.edu.cn
  • Supported by:
    Natural Science Foundation of China(31872869);National Key Research and Development Program of China(2017YFD0300902)

RichHTML369

111

PDF

1262

Abstract:

ABA receptors are involved in the mediation of ABA signaling transduction through interaction with abscisic acid (ABA) molecules induced by osmotic stresses and play critical roles in regulating the drought stress tolerance in plants. In this study, TaPYR1, an ABA family gene in wheat that was shown to be differentially expressed in our previous transcriptome analysis was used to analyze its molecular property, expression patterns under drought stress condition, and functions in mediating plant adaptation to drought stress. TaPYR1 shares high similarities to its plant counterparts at amino acid level. TaPYR1 protein contains the conserved domains specified by the plant PYR proteins and was targeted onto the plasma membrane after endoplasmic reticulum (ER) assortment. The expression of TaPYR1 was induced in both roots and leaves under drought, with the highest expression levels at 48 h of drought treatment. Transgene analysis on TaPYR1 was performed to assess the gene function in mediating plant drought tolerance. Compared with wild type (WT), the tobacco lines overexpressing TaPYR1 enhanced growth vigor and increased fresh and dry weight under drought stress. In addition, the transgenic lines with TaPYR1 overexpression also increased photosynthetic function, enhanced activities of cellular antioxidant enzymes, and elevated the contents of osmolytes (i.e., proline and soluble sugar) under drought condition. Our investigation suggests that TaPYR1 transcriptively responds to drought stress signaling and plays an important role in regulating plant drought adaptation by improving the associated physiological processes.

Key words: Triticum aestivum, ABA receptor gene, expression, genetic transformation, functional characterization

Supplementary table 1

The specific primers for amplification of the NtSOD, NtCAT, and NtPOD family genes"

目的基因
Gene		 登录号
Accession number		 上游引物
Forward primer (5'-3')		 下游引物
Reverse primer (5'-3')
NtSOD1 KJ874395 GTGGACATGTCGTGTCAAGG TTCTCACCAACTCCTGCACTT
NtFeSOD KF724056 CATCACAGAGCTTATGTCGACA CTAGAACTGACTGCTTCCCA
NtSOD2 EU123521 ATGTCACGGGACCACATTAC AACCCTTCCACCAGCATTTC
NtMnSOD2 AB093097 GACGGACCTTAGCAACAGGG ACCAATGGGTCCTGATTAGCAG
NtCAT NTU07627 GTCTCAGGCTGACAAGTCTT ACGGAAGACAGAGTAGCAGC
NtCAT1 EF532799 CAAGGATCTCTACGACTCGATT CTTGAGGGCAAATAATCCACCT
NtCAT1;1 NTU93244 TCCTGCTAATGCTCCAAAGTGT AATGCATATGTATTAGGAATGCTC
NtCAT1;2 HF564632 GGTATCGACTTGGACCAAACTA GGTCTCACATTAAGCCTAGAAG
NtCAT1;3 HF564631 TTGCAGCCGGTGGGAAGATT GGTCTCACATTAAGCCTAGAAG
NtCAT3 HF564633 GTCTTGGGCCAAACTATCTGCA TCAGCTTCACATTGTGGGCC
NtPOD1;1 L02124 GGAATTTGTCCTCAAGGTGGAA CTTATTGGAATTGCCATTTCAGC
NtPOD1;2 AB044154 CTGACATGGTCTGTGCCTAC TCAGTTGATAGCAGAGCAAACTT
NtPOD1;3 AB044153 AAGATCTTGTCGCTCTTACTGG AATTGGATTTTCCAGCTTGCG
NtPOD1;4 D11396 TGCTGGTAGTCAAAGTCAGTTTT CCCATGTTGAACACGTTCTTACC
NtPOD1;5 AB178953 AACAGCAACAACGTTAACCCAGC TTAATTTTGGACCACATTCAGGA
NtPOD1;6 AB027753 TCAACTCCACTGGTGGCCCT AATTCGATTTTGCAGCTTGCGC
NtPOD1;7 AB027752 GCCCAAGAAGTTCAGGCTCA ATACAAATACAGTCCTTTACTCG
NtPOD2;1 AB178954 AGGGGAAAAGACCTCACCAC AGTTTCCCATCTTGATCATAGCA
NtPOD4 AY032675 AGACTCAAAGATAGCAAACCTCA CTTCCTGATGTCACCCTTGA
NtPOD9 AY032674 CACCACCTTCATTCAACGCTA ACATCTCAGACAAAACACTTGTC

Fig. 1

Molecular characteristics of the TaPYR1 protein A: TaPYR1 protein structure predicted; B: alignment results among TaPYR1 protein and its homolougous proteins; C: phylogenetic relations among TaPYR1 and its counterparts in plant species. "

Fig. 2

Expression patterns of TaPYR1 in both roots and leaves under drought stress 0 h, control before treatment; 6, 12, 24, and 48 hours, time points under drought treatment; R24 h and R48 h, time points of recovery treatment after drought treatment. "

Fig. 3

Growth characteristics of the transgenic plants under drought stress A: Plant growth characteristics of transgenic lines overexpressing TaPYR1 under drought stress; B: Plant biomass of transgenic lines overexpressing TaPYR1 under drought stress. WT, wild type; Sen 1 and Sen 2, lines overexpressing TaPYR1; Anti 1 and Anti 2, lines with TaPYR1 knockdown expression. Error bars indicate SE and symbol * represents significant difference relative to WT (P < 0.05). "

Fig. 4

Photosynthetic characteristic of transgenic lines under drought stress A: Photosynthetic rate (Pn); B: Intercellular CO2 concentration (Ci); C: Photochemical quenching absorption of chloroplast (NPQ); D: Photochemical efficiency of photo system II (ФPSII). Error bars indicate SE and symbol * represents significant difference relative to WT (P < 0.05). "

Fig. 5

Stomatal closure properties and water retention capacities of transgenic lines under drought stress A: stomatal closure characteristic; B: water retention capacity of leaves. "

Fig. 6

Activities of the cellular protection enzymes and osmolyte contents in transgenic lines under drought stress A: SOD activities; B: POD activities; C: CAT activities; D: MDA contents; E: proline contents; D: soluble sugar contents. Error bars indicate SE and symbol * represents significant difference relative to WT (P < 0.05). "

Fig. 7

Expression patterns of protective enzyme genes in transformed lines under drought stress A: SOD family genes; B: CAT family genes; C: POD family genes. Error bars indicate SE and symbol * represents significant difference relative to WT (P < 0.05). "

[1] 居辉, 熊伟, 许吟隆, 林而达 . 气候变化对我国小麦产量的影响. 作物学报, 2005,31:98-101.
Ju H, Xiong W, Xu Y L, Lin L D . Effects of climate change on wheat yield in China. Acta Agron Sin, 2005,31:98-101 (in Chinese with English abstract).
[2] Bi H, Kovalchuk N, Langridge P, Tricker P J, Lopato S, Borisjuk N . The impact of drought on wheat leaf cuticle properties. BMC Plant Biol, 2017,17:85.
[3] Arbona V, Zandalinas S I, Manzi M, González-Guzmán M, Rodriguez P L, Gómez-Cadenas A . Depletion of abscisic acid levels in roots of flooded Carrizo citrange (Poncirus trifoliata L. Raf. × Citrus sinensis L. Osb.) plants is a stress-specific response associated to the differential expression of PYR/PYL/RCAR receptors. Plant Mol Biol, 2017,93:623-640.
[4] Ha Y M, Shang Y, Yang D, Nam K H . Brassinosteroid reduces ABA accumulation leading to the inhibition of ABA-induced stomatal closure. Biochem Biophys Res Commun, 2018,504:143-148.
doi: 10.1016/j.bbrc.2018.08.146
[5] Huang X, Shi H, Hu Z, Liu A, Amombo E, Chen L, Fu J . ABA is involved in regulation of cold stress response in Bermudagrass. Front Plant Sci, 2017,8:1613.
doi: 10.3389/fpls.2017.01613
[6] Li W, De Ollas C, Dodd I C . Long-distance ABA transport can mediate distal tissue responses by affecting local ABA concentrations. J Integr Plant Biol, 2018,60:16-33.
doi: 10.1111/jipb.12605
[7] Park E J, Kim T H . Production of ABA responses requires both the nuclear and cytoplasmic functional involvement of PYR1. Biochem Biophysic Res Commun, 2017,484:34-39.
[8] Liu S, Lü Z, Liu Y, Li L, Zhang L . Network analysis of ABA-dependent and ABA-independent drought responsive genes in Arabidopsis thaliana. Genet Mol Biol, 2018,41:624-637.
[9] Sussmilch F C, Atallah N M, Brodribb T J, Banks J A, Mcadam S A M . Abscisic acid (ABA) and key proteins in its perception and signaling pathways are ancient, but their roles have changed through time. Plant Sig Behav, 2017,12:e1365210.
[10] Han S, Min M K, Lee S Y, Lim C W, Bhatnagar N, Lee Y, Shin D, Chung K Y, Lee S C, Kim B G, Lee S . modulation of ABA signaling by altering VxGPhiL motif of PP2Cs in Oryza sativa. Mol Plant, 2017,10:1190-1205.
doi: 10.1016/j.molp.2017.08.003
[11] Nakashima K, Yamaguchi-Shinozaki K . ABA signaling in stress- response and seed development. Plant Cell Rep, 2013,32:959-970.
doi: 10.1007/s00299-013-1418-1
[12] Verslues P E . ABA and cytokinins: challenge and opportunity for plant stress research. Plant Mol Biol, 2016,91:629-640.
[13] Dittrich M, Mueller H M . The role of Arabidopsis ABA receptors from the PYR/PYL/RCAR family in stomatal acclimation and closure signal integration. Nat Plants, 2019,5:1002-1011.
[14] Huang A X, She X P, Zhao J L, Zhang Y Y . Inhibition of ABA-induced stomatal closure by fusicoccin is associated with cytosolic acidification-mediated hydrogen peroxide removal. Bot Stud, 2010,55:33.
[15] Guo C, Zhao X, Liu X, Zhang L, Gu J, Li X, Lu W, Xiao K . Function of wheat phosphate transporter gene TaPHT2;1 in Pi translocation and plant growth regulation under replete and limited Pi supply conditions. Planta, 2013,237:1163-1178.
[16] Sun Z H, Ding C H, Li X J, Xiao K . Molecular characterization and expression analysis of TaZFP15, a C2H2-type zinc finger transcription factor gene in wheat ( Triticum aestivum L.). J Integr Agric, 2012,1:35-46.
[17] Huang X S, Liu J H, Chen X J . Overexpression of PtrABF gene, a bZIP transcription factor isolated from Poncirus trifoliata, enhances dehydration and drought tolerance in tobacco via scavenging ROS and modulating expression of stress-responsive genes. BMC Plant Biol, 2010,10:230.
doi: 10.1186/1471-2229-10-230
[18] Wang X H, Xu K Z, Li D Y, Zhang Z A, Wu Z H . Changes of soluble sugar content and specific leaf weight in soybean genetic improvement. Soybean Sci, 2007,26:879-884
[19] Joo H, Lim C W, Lee S C . Identification and functional expression of the pepper RING type E3 ligase, CaDTR1, involved in drought stress tolerance via ABA-mediated signalling. Sci Rep, 2016,6:30097.
[20] Lim C W, Lee S C . Pepper protein phosphatase type 2C, CaADIP1 and its interacting partner CaRLP1 antagonistically regulate ABA signalling and drought response. Plant Cell Environ, 2016,39:1559-1575.
[21] Park C, Lim C W, Baek W, Kim J H, Lim S, Kim S H, Kim K N, Lee S C . The pepper WPP domain P protein, CaWDP1, acts as a novel negative regulator of drought stress via ABA signaling. Plant Cell Physiol, 2017,58:779-788.
[22] Fujita Y, Yoshida T, Yamaguchi-Shinozaki K . Pivotal role of the AREB/ABF-SnRK2 pathway in ABRE-mediated transcription in response to osmotic stress in plants. Physiol Plant, 2013,147:15-27.
[23] Han S, Lee Y, Park E J, Min M K, Lee Y, Kim T H, Kim B G, Lee S . Structural determinants for pyrabactin recognition in ABA receptors in Oryza sativa. Plant Mol Biol, 2019,100:319-333.
doi: 10.1007/s11103-019-00862-6
[24] Tischer S V, Wunschel C, Papacek M, Kleigrewe K, Hofmann T, Christmann A, Grill E . Combinatorial interaction network of abscisic acid receptors and coreceptors from Arabidopsis thaliana. Proc Natl Acad Sci USA, 2017,114:10280-10285.
doi: 10.1073/pnas.1706593114
[25] Yang J, Zhao S, Zhao B, Li C . Overexpression of TaLEA3 induces rapid stomatal closure under drought stress in Phellodendron amurense Rupr. Plant Sci, 2018,277:100-109.
[26] Jin J, Lauricella D, Armstrong R, Sale P, Tang C . Phosphorus application and elevated CO2 enhance drought tolerance in field pea grown in a phosphorus-deficient vertisol. Ann Bot, 2015,116:975-985.
[27] Shi G C, Fu J Y, Rong L J, Zhang P Y, Xiao K . TaMIR1119, a miRNA family member of wheat ( Triticum aestivum), is essential in the regulation of plant drought tolerance. J Integr Agric, 2018,17:2369-2378.
doi: 10.1016/S2095-3119(17)61879-3
[1] Zuo Tong-Hong, Zhang He-Cui, Zeng Jing, Zhu Li-Quan. Molecular cloning and expression analysis of BoPUB3L associated with self-incompatibility in Brasscia oleracea [J]. Acta Agronomica Sinica, 2026, 52(6): 1698-1710.
[2] Wang Wen-Yuan, Yan Xue-Jia, Liu Yu-Lin, Sun Xiao-Tong, Li Ya-Nan, Tang Xin-Hua, Shi Ying. Screening of low-light-tolerant potato varieties and cloning and functional analysis of the transcription factor gene StPIF3 [J]. Acta Agronomica Sinica, 2026, 52(6): 1631-1645.
[3] Hu Zhao, Qian Run, Xie Feng-Pu, Ying Su-Ping. Genome-wide identification and expression analysis of the SPX gene family in rice under phosphorus treatment [J]. Acta Agronomica Sinica, 2026, 52(6): 1902-1912.
[4] Sun Shu-Feng, Xu Zhen-Nan, Huang Jia-Xin, Weng Jian-Feng, Li Xin-Hai. Genome-wide identification of the maize MAPK gene family and its response to Fusarium verticillioides infection [J]. Acta Agronomica Sinica, 2026, 52(5): 1291-1308.
[5] Han Ya-Xin, He Guan-Hua, Zhang Xiao-Qiong, Zhang Deng-Feng, Li Yong-Xiang, Liu Xu-Yang, Wang Tian-Yu, Li Yu, Zou Hua-Wen, Li Chun-Hui. Identification of maize lateral root density genes resources through integrated RNA-seq and BSA-seq analyses [J]. Acta Agronomica Sinica, 2026, 52(5): 1341-1352.
[6] Tian Li-Tao, Ding Ning, Wang Shu-Lin, Qi En-Fang, Zhang Rong, Wang Rui-Rui, Ma Li-Wen, Li Jian-Wu, Yang Jiang-Wei. Genome-wide identification of the Argonaute gene family and its induction by late blight in potato (Solanum tuberosum L.) [J]. Acta Agronomica Sinica, 2026, 52(4): 1116-1126.
[7] Wang Ling, Hu Hao, Song Jia-Feng, Cheng Jie-Lan, Chen Ying, Zheng Ting-Ting, Lyu Zhao-Yan, Zhu Xiao-Biao, Hou Hua-Lan. Cloning and functional validation of UDP-glycosyltransferase gene StUGT52 in potato [J]. Acta Agronomica Sinica, 2026, 52(3): 665-676.
[8] Yang Zong-Tao, Yang Ting, Wang Yu-Tong, Ai Jing, Li Yan-Ye, Liu Jia-Yong, Deng Jun, Zhao Yong, Zhang Yue-Bin. Identification and expression analysis of the CLC gene family in sugarcane [J]. Acta Agronomica Sinica, 2026, 52(3): 722-734.
[9] Meng Cheng, Wang Zhe. Genome-wide identification and expression analysis of the ZmPFK gene family under biotic and abiotic stresses in maize [J]. Acta Agronomica Sinica, 2026, 52(3): 764-779.
[10] Zhang Li-Lan, Yang Jun, Wang Rang-Jian. Identification of candidate genes related to glycoside aroma precursor content in tea plant using WGCNA [J]. Acta Agronomica Sinica, 2026, 52(2): 494-513.
[11] Yang Biao, Du Shuai-Kang, Zhang Ji-Wang, Shi Ying, Zhang Li-Li. Genome-wide identification of class III POD gene family in potato and its expression profile analysis [J]. Acta Agronomica Sinica, 2026, 52(2): 405-420.
[12] Yu Kai-Hang, Zhou Hong-Bin, Luo Liang-Zha, Wang Mei-Li, Jiang Rui-Mei, Dong-Chen Wen-Hua, Li Shi-Jin, Mao Xiao-Qiang, Chen Sheng-Wei. Cloning and expression analysis of the HvLRR-RLK-510 gene encoding a leucine-rich repeat receptor-like kinase in barley [J]. Acta Agronomica Sinica, 2026, 52(2): 421-432.
[13] Zhan Ge-Rui, Yu Wen, Li Feng, Wu Ming-Zhu, Xu Xin, Luo Zhao-Peng, Wu Sheng-Xin, Yang Jun, Zhang Zhi-Qiang, Wang Zhong. Functional study of NtWRKY6 in response to ABA expression and regulation of polyphenol synthesis [J]. Acta Agronomica Sinica, 2026, 52(2): 446-458.
[14] Hu Cheng-Zhen, Gao Wei-Dong, Kong Bin-Xue, Wang Jian-Fei, Che Zhuo, Yang De-Long, Chen Tao. Genome-wide identification of the TaAPC11 gene family in wheat and functional characterization of TaAPC11-5B in drought stress responses [J]. Acta Agronomica Sinica, 2026, 52(1): 148-164.
[15] Liu Di, Li Rui-Yuan, Shi Mao-Zhu, Li Hong-You, Chen Qing-Fu, Shi Tao-Xiong. Phenotypic characterization and transcriptomic analysis of the semi-dwarf mutant sd3 in Tartary buckwheat [J]. Acta Agronomica Sinica, 2026, 52(1): 316-328.
Viewed
Full text


Abstract

Cited
  Shared   
  Discussed   
No Suggested Reading articles found!
Add: No. 80 Xueyuan South Rd, Beijing 100081, P. R. China E-mail: zwxb301@caas.cn
Supported by Beijing Magtech Co.Ltd