Welcome to Acta Agronomica Sinica,

Acta Agronomica Sinica ›› 2022, Vol. 48 ›› Issue (8): 2125-2133.doi: 10.3724/SP.J.1006.2022.12052

• RESEARCH NOTES • Previous Articles    

Identification and gene mapping of slender stem mutant sr10 in rice (Oryza sativa L.)

WEI Gang1(), CHEN Dan-Yang1(), REN De-Yong2(), YANG Hong-Xia1, WU Jing-Wen1, FENG Ping1, WANG Nan1,*()   

  1. 1Rice Research Institute, Southwest University / Academy of Agricultural Sciences, Southwest University, Chongqing 400715, China
    2State Key Laboratory of Rice Biology / Key Laboratory of Rice Biology and Breeding, Ministry of Agriculture and Rural Affairs / China National Rice Research Institute, Hangzhou 310006, Zhejiang, China
  • Received:2021-07-26 Accepted:2021-11-30 Online:2022-08-12 Published:2021-12-22
  • Contact: WANG Nan E-mail:1345433221@qq.com;cdyccdy@163.com;rendeyong616@163.com;wangnan_xndx@126.com
  • About author:First author contact:

    ** Contributed equally to this work

  • Supported by:
    National Natural Science Foundation of China(31771750)

Abstract:

The mutant sr10 (slender rice 10) reported in this study was obtained by ethyl methanesulfonate (EMS) from Xinong 1B, an indica maintainer line and it was slender stems and male sterility. Cytological observation indicated that the size of mutant cells became longer while the number of vascular bundles was less than wild type. The frozen section and chlorophyll content measurement manifested that the chlorophyll content of sr10 decreased greatly, resulting in the decreased photosynthetic rate, but the falling of stomatal conductance might improve its drought resistance. The levels of IAA and GA3 were significantly increased, while the content of ABA was sharply decreased in sr10. QRT-PCR analysis manifested that some genes involved in GAs pathway were down-regulated and some of IAA pathway related genes were abnormal. Genetic analysis suggested that the mutant phenotype of sr10 was controlled by a single recessive nuclear gene. The SR10 was located at a 175.7 kb interval between the molecular markers LIND12 and 28.5-4 on chromosome 3. These results laid a foundation for cloning and functional analysis of SR10.

Key words: rice (Oryza sativa L.), gene mapping, plant height, tillering, male sterility, hormone

Table S1

Molecular markers newly designed in this study"

标记
Marker
正向序列
Forward primer(5'→3')
反向序列
Reverse primer(5'→3')
ZTQ67 CATGTTCCAAGTATTCCTGGG CGAATGCTAGTGCCCTAGCT
LIND16 TGCGTGACAACAGATACAGGATACA TGAAATGTTAGCGATTCCTCTTTCG
LIND24 TTTGGGAGTCGCTGCACTACA GCGCAAGGGCAAATTTCTA
F41-54 CTGCTTCTGTCGCCACCG GATTCCTTGGTCGCCTGCC
LIND12 TAGGCCCTGCAAACTTGTTTAATAG CCTGCTCGTAGTTATGAGTGCTTG
28.5-4 GAGGATGAACTTCACTTACCCTCAAAG GCAGCGAGACTAGAAACTACTCCTCC
RM186 TCCTCCATCTCCTCCGCTCCCG GACGAAGAAGGCCACCACGCCC

Table S2

Primers used for qRT-PCR analysis"

引物
Primer
正向序列
Forward primer(5'→3')
反向序列
Reverse primer(5'→3')
OsActin ACCACTTCGACCGCCACTACT ACGCCTAAGCCTGCTGGTT
OsIAA3 GACGCAGCAGAAGGAGGAT GACGTCCCATTCGAGATGTT
OsIAA6 CCAATTCGATCCTTCAGGAG CACAGCAAGGTGCAGATGAC
OsIAA10 GGTTGCTGGATGGGTGAAGG CCAGCTCACCTACGAGGACAGG
OsIAA11 GCGCTGGTGAAGGTGAGCAT AGAGATGACCTGGAGTACGT
iaa21 GAAGGCACAGGTGGTAGGATG GGTGAATCAAATGGGAAGTCAGG
OsIAA23 GTACCTGCGCAAGGTGGAC GTTCGTCGAGTCCTGCAAG
OsSAUR39 TACAGCTGATGGAGAGCGATT TTGGATTCACAGGTGAGGAAA
OsPIN3t CGGCTCTACCACAAGGGATTG TGTACTACATCCTTCTTGGACTATGA
OsTIR1 ATTACATCCTCTCAGGCTGC CATGAACGATCCTGGAAGGT
GA2ox1 ACCACTACCCTCCATCATGCAACA AGGCTAGCAATGGTGGGAATCTGA
GA2ox4 CTGCAGGTGATGACGAACGG TGGAGCAGAGGATCGCGCCGCT
GA3ox2 CGCCTCTGGCCCAAGT GAGTTGCTGAGGTTGTTCTTGAG
GA20ox2 GCCAATGGGGAGGGTGT TGTCGCTGACGATCATGG
SLR1 TGCCCGCCATGCTTCCAC GCTGACCCGTCGGCTGCT

Fig. 1

Phenotype identification of sr10 a1-a6: phenotype observation of WT and sr10 in 4-60 days, Bars are 17.5, 41, 69.2, 102, 191, and 309 mm, respectively; b: plant height of WT and sr10in 4-60 days; c: root length of WT and sr10 in 4-60 days; d: leaf length of WT and sr10 at mature stage; e: leaf width of WT and sr10 at mature stage; f: tiller number of WT and sr10; First: the first leaf-blade; Second: the second leaf-blade; Third: the third leaf-blade; *: P < 0.05; **: P < 0.01."

Fig. 2

Cytological observation of sr10 a: WT upper epidermis of leaves, bar: 35 μm; b: upper epidermis of leaf of sr10, bar: 35 μm; c: WT lower epidermis of leaves, bar: 35 μm; d: lower epidermis of leaf of sr10, bar: 35 μm; e: WT sheath outer skin, bar: 35 μm; f: Outer sheath skin of sr10, bar: 35 μm; g: WT sheath inner epidermis, bar: 35 μm; h: Inner sheath epidermis of sr10, bar: 35 μm; i: the inverted intersegmental cross section of WT and sr10, bar: 1.1 mm; j: the vascular bundle number of WT and sr10. White arrow indicates guard cell, red arrow indicates cell length, and red ellipse indicates vascular bundles; **: P < 0.01."

Fig. 3

Fertility identification of sr10 a: spikes of WT and sr10, bar: 2.1 mm; b, c: anthers of WT and sr10, bar: 2.8 mm (b) and bar: 3.5 mm (c); d: pollen iodine staining of WT, bar: 115 μm; e: pollen iodine staining of sr10, bar: 115 μm; f: pollen fertility of WT and sr10; g: seed setting rate of WT and sr10; **: P < 0.01."

Fig. 4

Determination of chlorophyll content and photosynthetic index of sr10 a: frozen section and fluorescence observation of leaves of WT and sr10, bars: 26 μm; b: the content of chlorophyll a; c: the content of chlo-rophyll b; d: the content of the total chlorophyll; e: the content of Car; f: net photosynthetic rate (Pn); g: stomatal conductance (Gs); h: inter-cellular CO2 concentration (Ci); i: transpiration rate (Tr); First: the first leaf-blade; Second: the second leaf-blade; Third: the third leaf-blade; *: P < 0.05; **: P < 0.01."

Table S3

Genetic analysis of ssr1"

组合
Combinations
F1代表型
F1 phenotype
F2代表型
F2 population numbers
野生型数
WT numbers
突变体数
Mutant numbers
分离比
Separation ratio
J10/ sr10 正常normal 4005 3015 990 χ2=0.909<χ20.05,1=3.84

Fig. 5

Molecular mapping of SR10 on rice chromosome 3 N = 229: F2 recessive population used in primary mapping; n = 990: F2 recessive population used in fine mapping."

Table S4

The annotated genes in the mapping region"

基因编号
Locus name
基因注释
Gene annotation
LOC_Os03g49830 expressed protein
LOC_Os03g49840 hypothetical protein
LOC_Os03g49850 hypothetical protein
LOC_Os03g49860 expressed protein
LOC_Os03g49870 transposon protein, putative, Mariner sub-class, expressed
LOC_Os03g49880 TCP family transcription factor
LOC_Os03g49890 hypothetical protein
LOC_Os03g49900 zinc finger, C3HC4 type domain containing protein, expressed
LOC_Os03g49910 retrotransposon protein, putative, Ty1-copia subclass, expressed
LOC_Os03g49920 expressed protein
LOC_Os03g49930 pentatricopeptide, putative, expressed
LOC_Os03g49940 integral membrane protein, putative, expressed
LOC_Os03g49960 expressed protein
LOC_Os03g49970 expressed protein
LOC_Os03g49980 retrotransposon protein, putative, unclassified, expressed
LOC_Os03g49990 slender rice 1, GRAS-domain protein
LOC_Os03g50010 toc64, putative, expressed
LOC_Os03g50020 retrotransposon, putative, centromere-specific
LOC_Os03g50030 phospholipase A2, putative, expressed
LOC_Os03g50040 phytanoyl-CoA dioxygenase, putative, expressed

Fig. 6

Determination of hormone contents and the relative expression of related genes in sr10 *: P < 0.05; **: P < 0.01."

[1] Liu X B, Wei X J, Sheng Z H, Jiao G A, Tang S Q, Luo L, Hu P S, Wang T. Polycomb protein OsFIE2 affects plant height and grain yield in rice. PLoS One, 2016, 11: e0164748.
doi: 10.1371/journal.pone.0164748
[2] Liu J, Shen J, Xu Y, Li X, Xiong L. Ghd2, a CONSTANS-like gene, confers drought sensitivity through regulation of senescence in rice. J Exp Bot, 2016, 67: 5785-5798.
doi: 10.1093/jxb/erw344
[3] Xue W, Xing Y, Weng X, Zhao Y, Tang W, Wang L, Zhou H, Yu S, Xu C, Li X. Natural variation in Ghd7 is an important regulator of heading date and yield potential in rice. Nat Genet, 2009, 40: 761-767.
doi: 10.1038/ng.143
[4] Na J K, Huh S M, Yoon I S, Byun M O, Lee Y H, Lee K O, Kim D Y. Rice LIM protein OsPLIM2a is involved in rice seed and tiller development. Mol Breed, 2014, 34: 569-581.
doi: 10.1007/s11032-014-0058-7
[5] Liao Z, Yu H, Duan J, Yuan K, Li J. SLR1 inhibits MOC1 degradation to coordinate tiller number and plant height in rice. Nat Commun, 2019, 10: 2738.
doi: 10.1038/s41467-019-10667-2
[6] Wang Y J, Zhao J, Lu W J, Deng D X. Gibberellin in plant height control: old player, new story. Plant Cell Rep, 2017, 36: 391-398.
doi: 10.1007/s00299-017-2104-5
[7] Wu T, Shen Y, Zheng M, Yang C, Chen Y, Feng Z, Liu X, Liu S, Chen Z, Lei C. Gene SGL, encoding a kinesin-like protein with transactivation activity, is involved in grain length and plant height in rice. Plant Cell Rep, 2014, 33: 235-244.
doi: 10.1007/s00299-013-1524-0
[8] Jiang L, Guo L, Jiang H, Zeng D, Hu J, Wu L, Liu J, Gao Z, Qian Q. Genetic analysis and fine-mapping of a dwarfing with withered leaf-tip mutant in rice. J Genet Genomics, 2008, 35: 715-721.
doi: 10.1016/S1673-8527(08)60226-X
[9] Piao R, Chu S H, Jiang W, Yu Y, Jin Y, Woo M O, Lee J, Kim S, Koh H J. Isolation and characterization of a dominant dwarf gene, D-h, in rice. PLoS One, 2014, 9: e86210.
doi: 10.1371/journal.pone.0086210
[10] Wang W, Li G, Zhao J, Chu H, Lin W, Zhang D, Wang Z, Liang W. DWARF TILLER1, a WUSCHEL-related homeobox transcription factor, is required for tiller growth in rice. PLoS Genet, 2014, 10: e1004154.
doi: 10.1371/journal.pgen.1004154
[11] 汤日圣, 梅传生, 张金渝, 蔡小宁, 吴光南. TO3诱导水稻雄性不育与内源激素的关系. 江苏农业学报, 1996, 12(2): 6-10.
Tang R S, Meng C S, Zhang J Y, Cai X N, Wu G N. Relationship between rice male sterility induction by TO3 and level of endogenous hormones. Jiangsu J Agric, 1996, 12(2): 6-10. (in Chinese with English abstract)
[12] Ren D, Cui Y, Hu H, Xu Q, Qian Q. AH2 encodes a MYB domain protein that determines hull fate and affects grain yield and quality in rice. Plant J, 2019, 100: 813-824.
doi: 10.1111/tpj.14481
[13] Zhu M, Chen X L, Zhu X Y, Xing Y D, Zhang T Q. Identification and gene mapping of the starch accumulation and premature leaf senescence mutant ossac4 in rice. J Integr Agric, 2020, 19: 2150-2164.
doi: 10.1016/S2095-3119(19)62814-5
[14] Wellburn A R. The spectral determination of chlorophylls a and b, as well as total carotenoids, using various solvents with spectrophotometers of different resolution. J Plant Physiol, 1994, 144: 307-313.
doi: 10.1016/S0176-1617(11)81192-2
[15] Rogers S, Bendich A. Extraction of DNA from milligram amounts of fresh, herbarium and mummified plant tissues. Plant Mol Biol, 1985, 5: 69-76.
doi: 10.1007/BF00020088 pmid: 24306565
[16] Ren D, Rao Y, Huang L, Leng Y, Hu J, Lu M, Zhang G, Zhu L, Gao Z, Dong G. Fine mapping identifies a new QTL for brown rice rate in rice (Oryza sativa L.). Rice, 2016, 9: 4.
doi: 10.1186/s12284-016-0076-7
[17] Michelmore R, Paran I, Kesseli R. Identification of markers linked to disease-resistance genes by bulked segregant analysis: a rapid method to detect markers in specific genomic regions by using segregating populations. Proc Natl Acad Sci USA, 1991, 88: 9828-9832.
doi: 10.1073/pnas.88.21.9828
[18] Xing Y D, Du D, Xiao Y, Zhang T, Chen X, Ping F, Sang X C, Nan W, He G. Fine mapping of a new lesion mimic and Early Senescence 2 (lmes2) mutant in rice. Crop Sci, 2016, 56: 1550-1560.
doi: 10.2135/cropsci2015.09.0541
[19] Livak K J, Schmittgen T D. Analysis of relative gene expression data using real-time quantitative PCR. Methods, 2002, 25: 402-408.
doi: 10.1006/meth.2001.1262
[20] Liu W, Zhang D, Tang M, Li D, Zhu Y, Zhu L, Chen C. THIS 1 is a putative lipase that regulates tillering, plant height, and spikelet fertility in rice. J Exp Bot, 2013, 64: 4389-4402.
doi: 10.1093/jxb/ert256
[21] Lisa M, Noriyuki K, Rika Y, Junko S, Haruka M, Yumiko M, Masao T, Mizuho S, Shinobu N, Yuzo M. Positional cloning of rice semidwarfing gene, sd-1: rice “green revolution gene” encodes a mutant enzyme involved in gibberellin synthesis. DNA Res, 2002, 9: 11-17.
doi: 10.1093/dnares/9.1.11
[22] Li S, Gao J, Li J, Wang Y. Advances in regulating rice tillers by strigolactones. Chin Sci Bull, 2015, 50: 539-548.
[23] Ding Z, Lin Z, Li Q, Wu H, Xiang C, Wang J. DNL1, encodes cellulose synthase-like D4, is a major QTL for plant height and leaf width in rice (Oryza sativa L.). Biochem Biophys Res Commun, 2015, 457: 133-140.
doi: 10.1016/j.bbrc.2014.12.034
[24] Zhang P P, Zhang Y X, Sun L P, Sinumporn S, Yang Z F, Sun B, Xuan D D, Li Z H, Yu P, Wu W X, Wang K J, Cao L Y, Cheng S H. The rice AAA-ATPase OsFIGNL1 is essential for male meiosis. Front Plant Sci, 2017, 8: 1639.
doi: 10.3389/fpls.2017.01639
[25] Tadashi S, Susumu O, Yuta T, Hikaru S, Makiko K K. Reduction of gibberellin by low temperature disrupts pollen development in rice. Plant Physiol, 2014, 164: 2011-2019.
doi: 10.1104/pp.113.234401 pmid: 24569847
[26] Wang L, Wang Z, Xu Y, Joo S H, Kang C. OsGSR1 is involved in crosstalk between gibberellins and brassinosteroids in rice. Plant J, 2008, 57: 498-510.
doi: 10.1111/j.1365-313X.2008.03707.x
[27] Kensuke K, Shoko H, Toshiharu K, Koh I. Increased leaf photosynthesis caused by elevated stomatal conductance in a rice mutant deficient in SLAC1, a guard cell anion channel protein. J Exp Bot, 2012, 63: 5635-5644.
doi: 10.1093/jxb/ers216 pmid: 22915747
[28] Micol J L. Leaf development: time to turn over a new leaf? Curr Opin Plant Biol, 2009, 12: 9-16.
doi: 10.1016/j.pbi.2008.11.001 pmid: 19109050
[29] Wang Y F, Zhang J H, Shi X L, Peng Y, Li P, Lin D Z, Dong Y J, Teng S. Temperature-sensitive albino gene TCD5, encoding a monooxygenase, affects chloroplast development at low temperatures. J Exp Bot, 2016, 67: 5187-5202.
doi: 10.1093/jxb/erw287
[30] Zhang Y, Wang X, Luo Y, Zhang L, Li Y. OsABA8ox2, an ABA catabolic gene, suppresses root elongation of rice seedlings and contributes to drought response. Crop J, 2019, 8: 480-491.
doi: 10.1016/j.cj.2019.08.006
[31] Jain M, Kaur N, Garg R, Thakur J K, Tyagi A K, Khurana J P. Structure and expression analysis of early auxin-responsive Aux/IAA gene family in rice (Oryza sativa L.). Funct Integr Genomics, 2006, 6: 47-59.
doi: 10.1007/s10142-005-0005-0
[32] Nakamura A, Umemura I, Gomi K, Hasegawa Y, Kitano H, Sazuka T, Matsuoka M. Production and characterization of auxin-insensitive rice by overexpression of a mutagenized rice IAA protein. Plant J, 2010, 46: 297-306.
doi: 10.1111/j.1365-313X.2006.02693.x
[33] Ni J, Wang G, Zhu Z, Zhang H, Wu Y, Ping W. OsIAA23- mediated auxin signaling defines postembryonic maintenance of QC in rice. Plant J Cell Mol Biol, 2011, 68: 433-442.
doi: 10.1111/j.1365-313X.2011.04698.x
[34] Kant S, Bi Y M, Tong Z. SAUR39, a Small Auxin-Up RNA Gene, acts as a negative regulator of auxin synthesis and transport in rice. Plant Signal Behav, 2009, 151: 691-701.
[35] Zhang Q, Li J, Zhang W, Yan S, Wang R, Zhao J, Li Y, Qi Z, Sun Z, Zhu Z. The putative auxin efflux carrier OsPIN3t is involved in the drought stress response and drought tolerance. Plant J, 2012, 72: 805-816.
doi: 10.1111/j.1365-313X.2012.05121.x
[36] Zhang L, Feng P, Deng Y, Yin W, Wang N. Decreased Vascular Bundle 1 affects mitochondrial and plant development in rice. Rice, 2021, 14: 13.
doi: 10.1186/s12284-021-00454-3
[37] Jing H, Yang X, Zhang J, Liu X, Zheng H, Dong G, Nian J, Feng J, Xia B, Qian Q. Peptidyl-prolyl isomerization targets rice Aux/IAAs for proteasomal degradation during auxin signalling. Nat Commun, 2015, 6: 7395.
doi: 10.1038/ncomms8395
[38] Jin L, Qin Q, Wang Y, Pu Y, Liu L, Wen X, Ji S, Wu J, Wei C, Ding B. Rice dwarf virus P2 protein hijacks auxin signaling by directly targeting the rice OsIAA10 protein, enhancing viral infection and disease development. PLoS Pathog, 2016, 12: e1005847.
doi: 10.1371/journal.ppat.1005847
[39] Bian H, Xie Y, Guo F, Ning H, Zhu M. Distinctive expression patterns and roles of the miRNA393/TIR1 homolog module in regulating flag leaf inclination and primary and crown root growth in rice. New Phytol, 2012, 196: 149-161.
doi: 10.1111/j.1469-8137.2012.04248.x
[40] Xia K F, Wang R, Ou X J, Fang Z M, Tian C G, Duan J, Wang Y Q, Zhang M Y. OsTIR1 and OsAFB2 downregulation via OsmiR393 overexpression leads to more tillers, early flowering and less tolerance to salt and drought in rice. PLoS One, 2012, 7: e30039.
doi: 10.1371/journal.pone.0030039
[41] Li X, Xia K, Liang Z, Chen K, Gao C, Zhang M. MicroRNA 393 is involved in nitrogen-promoted rice tillering through regulation of auxin signal transduction in axillary buds. Sci Rep, 2016, 6: 32158.
doi: 10.1038/srep32158
[42] Lo S F, Yang S Y, Chen K T, Hsing Y I, Zeevaart J, Chen L J, Yu S M. A novel class of Gibberellin 2-Oxidases control semidwarfism, tillering, and root development in rice. Plant Cell, 2008, 20: 2603-2618.
doi: 10.1105/tpc.108.060913
[43] Sakamoto T. Expression of a gibberellin 2-oxidase gene around the shoot apex is related to phase transition in rice. Plant Physiol, 2001, 125: 1508-1516.
pmid: 11244129
[44] Itoh H, Ueguchi-Tanaka M, Sentoku N, Kitano H, Matsuoka M, Kobayashi M. Cloning and functional analysis of two gibberellin 3β-hydroxylase genes that are differently expressed during the growth of rice. Proc Natl Acad Sci USA, 2001, 98: 8909-8914.
doi: 10.1073/pnas.141239398
[45] Takeshi K, Keisuke N, Rico G, Diane R W, Tomoyuki F, Masanari N, Takuya K, Keita A, Anzu M, Yoshinao M, Kiyoshi M, Yoshiya S, Shinjiro Y, Mikiko K, Hitoshi S, Wu J Z, Kaworu E, Nobutaka M, Masaru O T, Shuichi Y, Masanori Y, Ryusuke Y, Kazuhiko N, Toshihiro M, Gen T, Susan R M, Ashikari M. Ethylene-gibberellin signaling underlies adaptation of rice to periodic flooding. Science, 2018, 361: 181-186.
doi: 10.1126/science.aat1577 pmid: 30002253
[46] Takeda T, Suwa Y, Suzuki M, Kitano H, Ueguchi C. The OsTB1 gene negatively regulates lateral branching in rice. Plant J, 2010, 33: 513-520.
doi: 10.1046/j.1365-313X.2003.01648.x
[47] Ikeda A, Ueguchi-Tanaka M, Sonoda Y, Kitano H, Koshioka M, Futsuhara Y, Yamaguchi M J. Slender rice, a constitutive gibberellin response mutant, is caused by a null mutation of the SLR1 gene, an ortholog of the height-regulating gene GAI/RGA/RHT/ D8. Plant Cell, 2001, 13: 999-1010.
pmid: 11340177
[48] Akira I, Yutaka S, Paolo V, Pierdomenico P, Hirohiko H. The slender rice mutant, with constitutively activated gibberellin signal transduction, has enhanced capacity for abscisic acid level. Plant Cell Physiol, 2002, 43: 974-979.
pmid: 12354914
[1] Gao Pei-Yang, Li Jin-Xuan, Dong Yu-Kui, Shi Yu, Zhang Zhen, Zhang Yong-Li. Response of wheat tillering and spike formation to nitrogen rate under supplementary irrigation based on soil moisture content [J]. Acta Agronomica Sinica, 2026, 52(6): 1847-1858.
[2] Jin Yu-He, Wang Xue-Fei, Xu Zhang-Yi-Wa, Miao Yi-Ning, Jiang Yun-Jie, Yi Ying, Miao De-Lin, Zhu Jing-Yi, Zhong Yi-Fan, Chen Ming-Heng, Fang Fang, Liu Peng. Effects of exogenous hormones on chlorophyll fluorescence parameters and the antioxidant enzyme system in soybean leaves under low-temperature stress [J]. Acta Agronomica Sinica, 2026, 52(6): 1817-1829.
[3] Tang Kuan-Qiang, Li Gong-Yun, Song Mei-Yi, Zhao Xue, Chang Chun-Ling. Genome-wide association analysis and prediction model construction for soybean plant height [J]. Acta Agronomica Sinica, 2026, 52(6): 1743-1756.
[4] Cai Zhao-Qin, He Guan-Yong, He Wen, Ruan Li-Xia, Liang Zhen-Hua, Li Yong-Zhen, Li Heng-Rui, Chen Hui-Xian. Dynamic transcriptome analysis and key gene discovery during cassava branching development [J]. Acta Agronomica Sinica, 2026, 52(5): 1430-1441.
[5] Liu Xin-Meng, Ren Hao, Zhang Ji-Bo, Zhang Ji-Wang, Zhao Bin, Ren Bai-Zhao, Liu Peng, Wang Hong-Zhang. Physiological mechanisms of methyl jasmonate (MeJA) alleviating the effects of heat stress on ear differentiation in maize [J]. Acta Agronomica Sinica, 2026, 52(5): 1561-1572.
[6] Ma Liang, Ma Lu, Zhang Shu-Yu, Zhang Hui-Min, Wang Ren-Ming, Song Xu-Dong, Zhang Zhen-Liang, Mao Yu-Xiang, Lu Hu-Hua, Chen Guo-Qing, Hao De-Rong, Zhou Guang-Fei. Transcriptome analysis and identification of candidate genes associated with husk number in maize [J]. Acta Agronomica Sinica, 2026, 52(3): 790-801.
[7] Zhang Yu, Liu Fang, Cai Cheng-Cheng, Yang Xiao-Hua, Jia MO-Shi-Zha, Yang Yuan-Jun, Wang Xi-Yao. Preliminary investigation on the mechanism of potato tuber dormancy release induced by combined treatment of bromoethane and gibberellin [J]. Acta Agronomica Sinica, 2026, 52(3): 825-838.
[8] Ye Fan, Li Shuai, Li Si-Yu, Chen Yun, Dou Chao-Yin, Liu Li-Jun. Effects of water-saving irrigation on rice yield and population quality in Northeast China [J]. Acta Agronomica Sinica, 2026, 52(3): 895-907.
[9] KONG De-Zhen, SANG Wei, NIE Ying-Bin, LI Wei, XU Hong-Jun, LI Jiang-Bo, LIU Peng-Peng, TIAN Xiao-Ming. Comparative analysis of metabolite changes during young panicle development in wheat AL type cytoplasmic male serile line and homologous maintainers [J]. Acta Agronomica Sinica, 2025, 51(9): 2454-2466.
[10] SHEN Ao, LIU Min, NI Di-An, LIU Wei. Promoter characterization and expression pattern analysis of the m6A methyltransferase gene SiMTA1 in foxtail millet [J]. Acta Agronomica Sinica, 2025, 51(7): 1969-1978.
[11] YANG Si-Jie, DU Qi-Di, CHAI Shou-Xi, XIONG Hong-Chun, XIE Yong-Dun, ZHAO Lin-Shu, GU Jia-Yu, GUO Hui-Jun, LIU Lu-Xiang. Genetic mapping of mutant genes on flag leaf length and width in wheat [J]. Acta Agronomica Sinica, 2025, 51(6): 1548-1557.
[12] YUAN Xin, ZHAO Zhuo-Fan, ZHAO Rui-Qing, LIU Xiao-Wei, ZHENG Ming-Min, LIU Yu-Sheng, DONG Hao-Sheng, DENG Li-Juan, CAO Mo-Ju, HUANG Qiang. Genetic analysis and molecular identification of a small kernel mutant mn-like1 in maize [J]. Acta Agronomica Sinica, 2025, 51(6): 1569-1581.
[13] SONG Song-Quan, TANG Cui-Fang, CHENG Hong-Yan, WANG Cheng-Liang, YUAN Liang-Bing, ZUO Sheng. Endosperm development of cereal crops and its role in seed dormancy and germination [J]. Acta Agronomica Sinica, 2025, 51(5): 1133-1155.
[14] ZHAO Xi-Juan, ZHANG Fan, LIU Sheng-Xuan, QIN Jun, CHEN Hui-Lan, LIN Yuan, LUO Hong-Bing, LIU Yi, SONG Bo-Tao, HU Xin-Xi, WANG En-Shuang. Optimization of extraction methods for four endogenous hormones in potatoes and analysis of their content during the process of releasing dormancy in tubers [J]. Acta Agronomica Sinica, 2025, 51(4): 1050-1060.
[15] GUO Xu-Hu, LI Ling-Zhi, LI Feng, MA Bo-Yan, JIA Xiao-Yu. Functional study on the regulation of plant architecture by tomato type I MADS-box gene SlMADS79 [J]. Acta Agronomica Sinica, 2025, 51(4): 982-991.
Viewed
Full text


Abstract

Cited

  Shared   
  Discussed   
No Suggested Reading articles found!