Welcome to Acta Agronomica Sinica，

Acta Agronomica Sinica ›› 2024, Vol. 50 ›› Issue (1): 76-88.doi: 10.3724/SP.J.1006.2024.33007

• CROP GENETICS & BREEDING·GERMPLASM RESOURCES·MOLECULAR GENETICS • Previous Articles     Next Articles

Functional identification of maize transcription factor ZmMYB12 to enhance drought resistance and low phosphorus tolerance in plants

WANG Li-Ping(), WANG Xiao-Yu, FU Jing-Ye, WANG Qiang*()   

  1. State Key Laboratory of Crop Gene Exploration and Utilization in Southwest China / College of Agronomy, Sichuan Agricultural University, Chengdu, 611130, Sichuan, China
  • Received:2023-02-12 Accepted:2023-06-29 Online:2024-01-12 Published:2023-07-20
  • Contact: *E-mail: qwang@sicau.edu.cn
  • Supported by:
    National Natural Science Foundation of China(31971825)

RichHTML419

77

PDF

360

Abstract:

Maize usually suffers from various abiotic stresses such as drought, high temperature, high salt, and deficiency of nutrient elements during growth and development period, which will eventually lead to the decline of yield and quality, resulting in serious agricultural yield reduction. MYB transcription factors are widely distributed in plants and involved in the whole process of plant growth and development and environmental response. Therefore, the screening and identification of MYB transcription factors conferring stress resistance can provide the theoretical basis and technical support for genetic improvement in maize. In this study, a R2R3-MYB family transcription factor gene, ZmMYB12, was cloned from maize materials under drought treatment. This gene showed inducible expression in response to drought, ABA, and PEG treatments. Maize plants with virus induced gene silencing (VIGS) of ZmMYB12 had higher sensitivity to drought and accumulated more reactive oxygen species (ROS), as well as smaller roots. The survival rate of ZmMYB12 silencing plants was lower after re-watering than the wild type plants (WT), indicating that ZmMYB12 was a positive regulator of drought response. Overexpression of ZmMYB12 in Arabidopsis thaliana resulted in less ROS accumulation and more lateral roots than WT, thus elevating drought resistance. After low phosphorus stress, ZmMYB12 overexpression Arabidopsis had more lateral roots and stronger root system, as well as higher contents of chlorophyll and anthocyanin. The content of inorganic phosphorus in ZmMYB12 overexpression Arabidopsis was also higher than WT. In conclusion, this study indicates that ZmMYB12 positively regulates drought response and increases the uptake and utilization of phosphorus in plants, providing an elite gene for maize breeding to increase abiotic resistance.

Key words: maize, MYB, drought stress, low phosphorus stress, root

Table 1

Primers used in this study"

引物名称
Primer name		 引物序列
Primer sequence (5'-3')		 引物用途
Primer usage
ZmMYB12-F ATGGGGAGAGCTCCGTGCTG 基因克隆
ZmMYB12-R CTAATTCATCCCAAGCTTTC Gene cloning
MYB12-VIGS-F TGTCCGAGTCTGAGGTACCAGTCGCGCAACAAGG 病毒诱导基因沉默
MYB12-VIGS-R GAAGGGGAGGTTCTAGACAGCTCCTCCCAGCT Virus induced gene silencing (VIGS)
p3301-ZmMYB12-F AAACCATGG ATGGGGAGAGCTCCGTGCTG 植物表达载体构建
p3301-ZmMYB12-R AAAAGATCT CTAATTCATCCCAAGCTTTC Plant expression vector construction
ZmMYB12-qPCR-F CTGCGACAAGGCTACTGTGA qRT-PCR检测
ZmMYB12-qPCR-R GTTTGGCCGGAGGTAGTTGA qRT-PCR detection
ZmEf1a-qPCR-F TGGTGTCATCAAGCCTGGTA 内参引物
ZmEf1a-qPCR-R AACATTGTCACCCGGAAGAG Control primer

Fig. 1

Relative expression pattern and evolutionary of ZmMYB12 genes A: the relative expression pattern of ZmMYB12 in maize in drought, PEG, or ABA treatment. The relative expression level is normalized to WT. Three biological replicates were conducted for each treatment, and the SPSS software was used for significant difference analysis (***: P < 0.001); B: phylogenetic tree of ZmMYB12 and other MYB family members. Accession number: ZmMYB12, Zm00001d013164; ZmMYB111, Zm00001d021296; ZmMYB148, Zm00001d026203; ZmMYB167, Zm00001d032032; ZmMYB48, Zm00001d030678; ZmMYB94, Zm00001d022227; ZmMYB134, Zm00001d024726; ZmMYB31, Zm00001d006236; ZmMYB3R, Zm0000d042910; ZmMYB119, Zm00001d037994; OsMYB48, LOC_Os01g74410; OsMYBS1, LOC_Os01g340 60; OsMYB91, LOC_Os12g38400."

Fig. 2

Phenotype of ZmMYB12-VIGS maize plants in drought treatment A: ZmMYB12 gene silencing efficiency; B: drought treatment of maize plants with VIGS of ZmMYB12; C: survival rate after re-watering; D: DAB staining of maize leaves after drought treatment; E: root morphology of GFP and maize plants with VIGS of ZmMYB12 in normal growth condition; F: root morphology of GFP and maize plants with VIGS of ZmMYB12 in drought treatment. GFP is the control and each treatment is conducted with three replicates. The SPSS software is used for statistic analysis (***: P < 0.001)."

Fig. 3

ZmMYB12 enhances Arabidopsis thaliana drought resistance by reducing ROS accumulation A: the relative expression level of ZmMYB12 in the over-expression lines (OE-1, 2, and 3). nd: no detection. B: the enhanced drought resistance in ZmMYB12 over-expression plants. C: survival rate after re-watering. D: DAB staining of Arabidopsisis leaves with 20% PEG treatment. E: MDA content and anti-oxidant enzyme activities under normal growth and drought stress. Three biological replicates are conducted for each treatment, and the SPSS software is used for statistic analysis (***: P < 0.001). Different lowercase letters indicate significant difference between different treatments at P < 0.05."

Fig. 4

ZmMYB12 responds to low phosphorus stress by regulating lateral root development in Arabidopsis A: root morphological development after low phosphorus treatment for 7 days and 21days; B: Arabidopsis seedlings with treatment of low phosphorus for 21 days; C: lateral root density after low phosphorus treatment for 21 days; D: lateral root morphology under normal (MS) and low phosphorus (LP) treatment; E: lateral root length under MS and LP conditions; F: root hair morphology under MS and LP treatments; G: root hair length under MS and LP conditions; H: root hair density under MS and LP conditions. Three biological replicates are conducted for each treatment, and the SPSS software is used for statistic analysis (Different lowercase letters indicate significant difference at P < 0.05)."

Fig. 5

Over-expression of ZmMYB12 enhances phosphorus uptake in Arabidopsis A: in situ staining of bromocresol purple in the roots of wild-type (WT) and ZmMYB12 over-expression plants (OE-1, 2, and 3) under normal and low phosphorus treatment; B: quantification of roots acidification in WT and ZmMYB12 over-expression plants under normal and low P treatments; C: the inorganic phosphorus content in wild-type (WT) and ZmMYB12 over-expressed leaves under normal and low P treatments; D: the inorganic phosphorus content in wild-type (WT) and ZmMYB12 over-expressed roots under normal and low P treatments; E: chlorophyll a content under normal and low phosphorus treatment; F: chlorophyll b content under normal and low phosphorus treatment; G: the anthocyanin content under normal and low phosphorus treatment. Three biological replicates are conducted for each treatment, and the SPSS software is used for statistic analysis (*: P < 0.05; Different lowercase letters indicate significant difference at P < 0.05)."

Fig. 6

Seed germination of Arabidopsis thaliana with over-expression of ZmMYB12 A: seed germination of wild-type and ZmMYB12 over-expression plants on the MS plates for one week; B: germination rate of on the MS plates; C: cotyledon greening rate on the MS plates; D: seed germination of wild-type and ZmMYB12 over-expression plants with GA treatment. E: germination rate under GA treatment; F: cotyledon greening rate under GA treatment; G: seed germination of wild-type and ZmMYB12 over-expression plants under ABA inhibitor treatment; H: germination rate under ABA inhibitor treatment. Three biological replicates were conducted for each treatment and the SPSS software was used for statistic analysis (*: P < 0.05; ***: P < 0.001; Different lowercase letters indicate significant difference between different treatments at P < 0.05)."

[1] Campos H, Cooper M, Habben J E, Edmeades G O, Schussler J R. Improving drought tolerance in maize: a view from industry. Field Crops Res, 2004, 90: 19-34.
doi: 10.1016/j.fcr.2004.07.003
[2] Esfahanian E, Nejadhashemi A P, Abouali M, Adhikari U, Zhang Z, Daneshvar F, Herman M R. Development and evaluation of a comprehensive drought index. J Environ Manage, 2017, 185: 31-43.
doi: S0301-4797(16)30840-4 pmid: 28029478
[3] Gupta A, Rico-Medina A, Caño-Delgado A I. The physiology of plant responses to drought. Science, 2020, 368: 266-269.
doi: 10.1126/science.aaz7614 pmid: 32299946
[4] Liu H, Wang X, Wang D, Zou Z, Liang Z. Effect of drought stress on growth and accumulation of active constituents in Salvia miltiorrhiza Bunge. Ind Crop Prod, 2011, 33: 84-88.
doi: 10.1016/j.indcrop.2010.09.006
[5] Allen R G, Tresini M, Allen R G, Tresini M. Oxidative stress and gene regulation. Free Radic Biol Med, 2000, 28: 463-499.
doi: 10.1016/S0891-5849(99)00242-7
[6] Gong F, Yang L, Tai F, Hu X, Wang W. “Omics” of maize stress response for sustainable food production: opportunities and challenges. OMICS: A J Integr Biol, 2014, 18: 714-732.
doi: 10.1089/omi.2014.0125
[7] Pan R, Buitrago S, Feng Z, Abou-Elwafa S F, Xu L, Li C, Zhang W. HvbZIP21, a novel transcription factor from wild barley confers drought tolerance by modulating ROS scavenging. Front Plant Sci, 2022, 13: 878459.
doi: 10.3389/fpls.2022.878459
[8] Newton J R. Linked gene ontology categories are novel and differ from associated gene ontology categories for the bipolar disorders. Psychiat Genet, 2007, 17: 29-34.
doi: 10.1097/YPG.0b013e328010f28c
[9] Ma H Z, Liu C, Li Z X, Ran Q J, Xie G N, Wang B M, Fang S, Chu J F, Zhang J R. ZmbZIP4 contributes to stress resistance in maize by regulating ABA synthesis and root development. Plant Physiol, 2018, 178: 753-770.
doi: 10.1104/pp.18.00436
[10] Wang B X, Li L Q, Liu M L, Peng D, Wei A S, Hou B Y, Lei Y H, Li X J. TaFDL2-1A confers drought stress tolerance by promoting ABA biosynthesis, ABA responses, and ROS scavenging in transgenic wheat. Plant J, 2022, 112: 722-737.
doi: 10.1111/tpj.v112.3
[11] Zhu J K. Abiotic stress signaling and responses in plants. Cell, 2016, 167: 313-324.
doi: 10.1016/j.cell.2016.08.029
[12] Calderón-Vázquez C, Sawers R J, Herrera-Estrella L. Phosphate deprivation in maize: genetics and genomics. Plant Physiol, 2011, 156: 1067-1077.
doi: 10.1104/pp.111.174987 pmid: 21617030
[13] Vance C P, Uhde-Stone C, Allan D L. Phosphorus acquisition and use: critical adaptations by plants for securing a nonrenewable resource. New Phytol, 2003, 157: 423-447.
doi: 10.1046/j.1469-8137.2003.00695.x pmid: 33873400
[14] Bieleski R L. Phosphate pools, phosphate transport, and phosphate availability. Annu Rev Plant Physiol, 2003, 24: 225-252.
doi: 10.1146/arplant.1973.24.issue-1
[15] Usuda H. Phosphate deficiency in maize: V. Mobilization of nitrogen and phosphorus within shoots of young plants and its relationship to senescence. Plant Cell Physiol, 1995, 36: 1041-1049.
doi: 10.1093/oxfordjournals.pcp.a078846
[16] Siddiqui M H, Alamri S, Nasir Khan M, Corpas F J, Al-Amri A A, Alsubaie Q D, Ali H M, Kalaji H M, Ahmad P. Melatonin and calcium function synergistically to promote the resilience through ROS metabolism under arsenic-induced stress. J Haz Mat, 2020, 398: 122882.
doi: 10.1016/j.jhazmat.2020.122882
[17] Bechtold U, Penfold C A, Jenkins D J, Legaie R, Moore J D, Lawson T, Matthews J S, Vialet-Chabrand S R, Baxter L, Subramaniam S, Hickman R, Florance H, Sambles C, Salmon D L, Feil R, Bowden L, Hill C, Baker N R, Lunn J E, Finkenstädt B, Mead A, Buchanan-Wollaston V, Beynon J, Rand D A, Wild D L, Denby K J, Ott S, Smirnoff N, Mullineaux P M. Time-series transcriptomics reveals that AGAMOUS-LIKE22 affects primary metabolism and developmental processes in drought-stressed Arabidopsis. Plant Cell, 2016, 28: 345.
[18] Bates T R, Lynch J P. Root hairs confer a competitive advantage under low phosphorus availability. Plant Soil, 2001, 236: 243-250.
doi: 10.1023/A:1012791706800
[19] Devaiah B N, Madhuvanthi R, Karthikeyan A S, Raghothama K G. Phosphate starvation responses and gibberellic acid biosynthesis are regulated by the MYB62 transcription factor in Arabidopsis. Mol Plant, 2009, 2: 43-58.
[20] Jain A, Poling M D, Smith A P, Nagarajan V K, Lahner B, Meagher R B, Raghothama K G. Variations in the composition of gelling agents affect morphophysiological and molecular responses to deficiencies of phosphate and other nutrients. Plant Physiol, 2009, 150: 1033-1049.
doi: 10.1104/pp.109.136184 pmid: 19386810
[21] Wang L S, Li Z, Qian W Q, Guo W L, Gao X, Huang L L, Wang H, Zhu H F, Wu J W, Wang D W, Liu D. The Arabidopsis purple acid phosphatase AtPAP10 is predominantly associated with the root surface and plays an important role in plant tolerance to phosphate limitation. Plant Physiol, 2011, 157: 1283-1299.
doi: 10.1104/pp.111.183723
[22] Zhang J Y, Zhou X, Xu Y, Yao M L, Xie F B, Gai J Y, Li Y, Yang S P. Soybean SPX1 is an important component of the response to phosphate deficiency for phosphorus homeostasis. Plant Sci, 2016, 248: 82-91.
doi: 10.1016/j.plantsci.2016.04.010 pmid: 27181950
[23] Martin C, Paz-Ares J. MYB transcription factors in plants. Trends Genet, 1997, 13: 67-73.
doi: 10.1016/s0168-9525(96)10049-4 pmid: 9055608
[24] Fang Q, Wang X Q, Wang H Y, Tang X W, Liu C, Yin H, Ye S L, Jiang Y Z, Duan Y J, Luo K M. The poplar R2R3 MYB transcription factor PtrMYB94 coordinates with abscisic acid signaling to improve drought tolerance in plants. Tree Physiol, 2020, 40: 46-59.
doi: 10.1093/treephys/tpz113 pmid: 31728530
[25] Gao F, Zhou J, Deng R Y, Zhao H X, Li C L, Chen H, Suzuki T, Park S U, Wu Q.Overexpression of a tartary buckwheat R2R3-MYB transcription factor gene, FtMYB9, enhances tolerance to drought and salt stresses in transgenic Arabidopsis. Plant Physiol, 2017, 214: 81-90.
[26] Shukla P S, Gupta K, Agarwal P, Jha B, Agarwal P K. Overexpression of a novel SbMYB15 from Salicornia brachiata confers salinity and dehydration tolerance by reduced oxidative damage and improved photosynthesis in transgenic tobacco. Planta, 2015, 242: 1291-308.
doi: 10.1007/s00425-015-2366-5 pmid: 26202734
[27] Zheng X W, Liu C, Qiao L, Zhao J J, Han R, Wang X L, Ge C, Zhang W Y, Zhang S W, Qiao L Y, Zheng J, Hao C Y. The MYB transcription factor TaPHR3-A1 is involved in phosphate signaling and governs yield-related traits in bread wheat. J Exp Bot, 2020, 71: 5808-5822.
doi: 10.1093/jxb/eraa355 pmid: 32725154
[28] Gulzar F, Fu J Y, Zhu C Y, Yan J, Li X L, Meraj T A, Shen Q Q, Hassan B, Wang Q. Maize WRKY transcription factor ZmWRKY79 positively regulates drought tolerance through elevating ABA biosynthesis. Int J Mol Sci, 2021, 22: 10080.
doi: 10.3390/ijms221810080
[29] Pu Q Y, Liang J, Shen Q Q, Fu J Y, Pu Z E, Liu J, Wang X G, Wang Q. A wheat β-patchoulene synthase confers resistance against herbivory in transgenic Arabidopsis. Genes, 2019, 10: 441.
[30] Wu J D, Jiang Y L, Liang Y N, Chen L, Chen W J, Cheng B J. Expression of the maize MYB transcription factor ZmMYB3R enhances drought and salt stress tolerance in transgenic plants. Plant Physiol Bioch, 2019, 137: 179-188.
doi: 10.1016/j.plaphy.2019.02.010
[31] Du H, Feng B R, Yang S S, Huang Y B, Tang Y X, Wu K. The R2R3-MYB transcription factor gene family in Maize. PLoS One, 2012, 7: e37463.
doi: 10.1371/journal.pone.0037463
[32] Castorina G, Domergue F, Chiara M, Zilio M, Persico M, Ricciardi V, Horner D S, Consonni G. ZmFDL1/MYB94 drought- responsive regulates cuticle biosynthesis and cuticle-dependent leaf permeability. Plant Physiol, 2020, 184: 266-282.
doi: 10.1104/pp.20.00322 pmid: 32665334
[33] Ogawa M, Hanada A, Yamauchi Y, Kuwahara A, Kamiya Y, Yamaguchi S. Gibberellin biosynthesis and response during Arabidopsis seed germination. Plant Cell, 2003, 15: 1591-1604.
doi: 10.1105/tpc.011650
[34] Zhong C M, Patra B, Tang Y, Li X K, Yuan L, Wang X J. A transcriptional hub integrating gibberellin-brassinosteroid signals to promote seed germination in Arabidopsis. J Exp Bot, 2021, 72: 4708-4720.
[35] Sano N, Marion-Poll A. ABA metabolism and homeostasis in seed dormancy and germination. Int J Mol Sci, 2021, 22: 5069.
doi: 10.3390/ijms22105069
[36] Wang X P, Niu Y L, Zheng Y. Multiple Functions of MYB transcription factors in abiotic stress responses. Int J Mol Sci, 2021, 22: 6125.
doi: 10.3390/ijms22116125
[37] Chen K, Li G J, A Bressan R, Song C P, Zhu J K. Abscisic acid dynamics, signaling, and functions in plants. J Integr Plant Biol, 2020, 62: 27-56.
[38] Xu W, Tang W, Wang C, Ge L, Sun J, Qi X, He Z, Zhou Y, Chen J, Xu Z, Ma Y Z, Chen M. SiMYB56 confers drought stress tolerance in transgenic rice by regulating lignin biosynthesis and ABA signaling pathway. Front Plant Sci, 2020, 11: 785.
doi: 10.3389/fpls.2020.00785 pmid: 32625221
[39] Valdés-López O, Arenas-Huertero C, Ramírez M, Girard L, Sánchez F, Vance C P, Luis Reyes J, Hernández G. Essential role of MYB transcription factor: PvPHR1 and microRNA: PvmiR399 in phosphorus-deficiency signalling in common bean roots. Plant Cell Environ, 2008, 31: 1834-1843.
doi: 10.1111/pce.2008.31.issue-12
[40] Val-Torregrosa B, Bundó M, Martín-Cardoso H, Bach-Pages M, Chiou T J, Flors V, Segundo B S. Phosphate-induced resistance to pathogen infection in Arabidopsis. Plant J, 2022, 110: 452-469.
doi: 10.1111/tpj.v110.2
[41] Tariq A, Pan K, Olatunji O A, Graciano C, Li Z, Sun F Sun X, Song D, Chen W, Zhang A, Wu X, Zhang L, Mingrui D, Xiong Q, Liu C. Phosphorous application improves drought tolerance of Phoebe zhennan. Front Plant Sci, 2017, 8: 1561.
doi: 10.3389/fpls.2017.01561 pmid: 28955356
[42] Begum N, Ahanger M A, Zhang L X. AMF inoculation and phosphorus supplementation alleviates drought induced growth and photosynthetic decline in Nicotiana tabacum by up-regulating antioxidant metabolism and osmolyte accumulation. Environ Exp Bot, 2020, 176: 104088.
doi: 10.1016/j.envexpbot.2020.104088
[43] Hansel F D, Amado T J C, Ruiz Diaz D A, Rosso L H M, Schorr M. Phosphorus fertilizer placement and tillage affect soybean root growth and drought tolerance. Agron J, 2017, 109: 2936-2944.
doi: 10.2134/agronj2017.04.0202
[1] WU Hao, ZHANG Ying, WANG Chen, GU Han-Zhu, ZHOU Tian-Yang, ZHANG Wei-Yang, GU Jun-Fei, LIU Li-Jun, YANG Jian-Chang, ZHANG Hao. Effects of cultivation optimization on root characteristics and starch properties of rice at grain filling stage in the lower reaches of the Yangtze River [J]. Acta Agronomica Sinica, 2024, 50(2): 478-492.
[2] MAO Yan, ZHENG Ming-Min, MOU Cheng-Xiang, XIE Wu-Bing, TANG Qi. Function analysis of the promoter of natural antisense transcript cis-NATZmNAC48 in maize under osmotic stress [J]. Acta Agronomica Sinica, 2024, 50(2): 354-362.
[3] MA Juan, CAO Yan-Yong. Genome-wide association study of yield traits and special combining ability in maize hybrid population [J]. Acta Agronomica Sinica, 2024, 50(2): 363-372.
[4] YANG Jing-Lei, WU Bing-Jie, WANG An-Zhou, XIAO Ying-Jie. Genomic prediction of maize agronomic and quality traits using multi-omics data [J]. Acta Agronomica Sinica, 2024, 50(2): 373-382.
[5] WU Yu, LIU Lei, CUI Ke-Hui, QI Xiao-Li, HUANG Jian-Liang, PENG Shao-Bing. Changes of root characteristics of super hybrid rice variety contributing to high nitrogen accumulation under low nitrogen application at seedling stage [J]. Acta Agronomica Sinica, 2024, 50(2): 414-424.
[6] XU Ran, YANG Wen-Ye, ZHU Jun-Lin, CHEN Song, XU Chun-Mei, LIU Yuan-Hui, ZHANG Xiu-Fu, WANG Dan-Ying, CHU Guang. Effects of different irrigation regimes on grain yield and water use efficiency in japonica-indica hybrid rice cultivar Yongyou 1540 [J]. Acta Agronomica Sinica, 2024, 50(2): 425-439.
[7] LI Yan, FANG Yu-Hui, WANG Yong-Xia, PENG Chao-Jun, HUA Xia, QI Xue-Li, HU Lin, XU Wei-Gang. Transcriptomics profile of transgenic OsPHR2 wheat under different phosphorus stress [J]. Acta Agronomica Sinica, 2024, 50(2): 340-353.
[8] XIE Wei, HE Peng, MA Hong-Liang, LEI Fang, HUANG Xiu-Lan, FAN Gao-Qiong, YANG Hong-Kun. Effects of straw mulching from autumn fallow and phosphorus application on nitrogen uptake and utilization of winter wheat [J]. Acta Agronomica Sinica, 2024, 50(2): 440-450.
[9] SONG Xu-Dong, ZHU Guang-Long, ZHANG Shu-Yu, ZHANG Hui-Min, ZHOU Guang-Fei, ZHANG Zhen-Liang, MAO Yu-Xiang, LU Hu-Hua, CHEN Guo-Qing, SHI Ming-Liang, XUE Lin, ZHOU Gui-Sheng, HAO De-Rong. Identification of heat tolerance of waxy maizes at flowering stage and screening of evaluation indexes in the middle and lower reaches of Yangtze River region [J]. Acta Agronomica Sinica, 2024, 50(1): 172-186.
[10] YANG Li-Da, REN Jun-Bo, PENG Xin-Yue, YANG Xue-Li, LUO Kai, CHEN Ping, YUAN Xiao-Ting, PU Tian, YONG Tai-Wen, YANG Wen-Yu. Crop growth characteristics and its effects on yield formation through nitrogen application and interspecific distance in soybean/maize strip relay intercropping [J]. Acta Agronomica Sinica, 2024, 50(1): 251-264.
[11] TAN Zhi-Xin, XIE Liu-Wei, LI Hong-Ge, LI Fang-Jun, TIAN Xiao-Li, LI Zhao-Hu. Identification of cotton low potassium tolerance based on AHP-membership function method at cotyledonary stage [J]. Acta Agronomica Sinica, 2024, 50(1): 199-208.
[12] YANG Chen-Xi, ZHOU Wen-Qi, ZHOU Xiang-Yan, LIU Zhong-Xiang, ZHOU Yu-Qian, LIU Jie-Shan, YANG Yan-Zhong, HE Hai-Jun, WANG Xiao-Juan, LIAN Xiao-Rong, LI Yong-Sheng. Mapping and cloning of plant height gene PHR1 in maize [J]. Acta Agronomica Sinica, 2024, 50(1): 55-66.
[13] YUE Run-Qing, LI Wen-Lan, MENG Zhao-Dong. Acquisition and resistance analysis of transgenic Maize Inbred Line LG11 with insect and herbicide resistance [J]. Acta Agronomica Sinica, 2024, 50(1): 89-99.
[14] AI Rong, ZHANG Chun, YUE Man-Fang, ZOU Hua-Wen, WU Zhong-Yi. Response of maize transcriptional factor ZmEREB211 to abiotic stress [J]. Acta Agronomica Sinica, 2023, 49(9): 2433-2445.
[15] HUANG Yu-Jie, ZHANG Xiao-Tian, CHEN Hui-Li, WANG Hong-Wei, DING Shuang-Cheng. Identification of ZmC2s gene family and functional analysis of ZmC2-15 under heat tolerance in maize [J]. Acta Agronomica Sinica, 2023, 49(9): 2331-2343.
Viewed
Full text


Abstract

Cited
  Shared   
  Discussed   
[1] Li Shaoqing, Li Yangsheng, Wu Fushun, Liao Jianglin, Li Damo. Optimum Fertilization and Its Corresponding Mechanism under Complete Submergence at Booting Stage in Rice[J]. Acta Agronomica Sinica, 2002, 28(01): 115 -120 .
[2] Wang Lanzhen;Mi Guohua;Chen Fanjun;Zhang Fusuo. Response to Phosphorus Deficiency of Two Winter Wheat Cultivars with Different Yield Components[J]. Acta Agron Sin, 2003, 29(06): 867 -870 .
[3] YANG Jian-Chang;ZHANG Jian-Hua;WANG Zhi-Qin;ZH0U Qing-Sen. Changes in Contents of Polyamines in the Flag Leaf and Their Relationship with Drought-resistance of Rice Cultivars under Water Deficiency Stress[J]. Acta Agron Sin, 2004, 30(11): 1069 -1075 .
[4] Yan Mei;Yang Guangsheng;Fu Tingdong;Yan Hongyan. Studies on the Ecotypical Male Sterile-fertile Line of Brassica napus L.Ⅲ. Sensitivity to Temperature of 8-8112AB and Its Inheritance[J]. Acta Agron Sin, 2003, 29(03): 330 -335 .
[5] Wang Yongsheng;Wang Jing;Duan Jingya;Wang Jinfa;Liu Liangshi. Isolation and Genetic Research of a Dwarf Tiilering Mutant Rice[J]. Acta Agron Sin, 2002, 28(02): 235 -239 .
[6] WANG Li-Yan;ZHAO Ke-Fu. Some Physiological Response of Zea mays under Salt-stress[J]. Acta Agron Sin, 2005, 31(02): 264 -268 .
[7] TIAN Meng-Liang;HUNAG Yu-Bi;TAN Gong-Xie;LIU Yong-Jian;RONG Ting-Zhao. Sequence Polymorphism of waxy Genes in Landraces of Waxy Maize from Southwest China[J]. Acta Agron Sin, 2008, 34(05): 729 -736 .
[8] HU Xi-Yuan;LI Jian-Ping;SONG Xi-Fang. Efficiency of Spatial Statistical Analysis in Superior Genotype Selection of Plant Breeding[J]. Acta Agron Sin, 2008, 34(03): 412 -417 .
[9] WANG Yan;QIU Li-Ming;XIE Wen-Juan;HUANG Wei;YE Feng;ZHANG Fu-Chun;MA Ji. Cold Tolerance of Transgenic Tobacco Carrying Gene Encoding Insect Antifreeze Protein[J]. Acta Agron Sin, 2008, 34(03): 397 -402 .
[10] ZHENG Xi;WU Jian-Guo;LOU Xiang-Yang;XU Hai-Ming;SHI Chun-Hai. Mapping and Analysis of QTLs on Maternal and Endosperm Genomes for Histidine and Arginine in Rice (Oryza sativa L.) across Environments[J]. Acta Agron Sin, 2008, 34(03): 369 -375 .
Add: No. 80 Xueyuan South Rd, Beijing 100081, P. R. China E-mail: zwxb301@caas.cn
Supported by Beijing Magtech Co.Ltd