Welcome to Acta Agronomica Sinica，

Acta Agronomica Sinica ›› 2024, Vol. 50 ›› Issue (6): 1451-1466.doi: 10.3724/SP.J.1006.2024.34121

• CROP GENETICS & BREEDING·GERMPLASM RESOURCES·MOLECULAR GENETICS • Previous Articles     Next Articles

Genome-wide identification and expression analysis of ARM gene family in potato (Solanum tuberosum L.)

LIU Zhen1(), CHEN Li-Min2, LI Zhi-Tao2, ZHU Jin-Yong2, WANG Wei-Lu2, QI Zhe-Ying2, YAO Pan-Feng1, BI Zhen-Zhen2, SUN Chao2, BAI Jiang-Ping3, LIU Yu-Hui1,*()   

  1. 1State Key Laboratory of Aridland Crop Science, Gansu Agricultural University, Lanzhou 730070, Gansu, China
    2College of Agronomy, Gansu Agricultural University, Lanzhou 730070, Gansu, China
    3Department of Education of Gansu Province, Lanzhou 730030, Gansu, China
  • Received:2023-07-14 Accepted:2024-01-12 Online:2024-06-12 Published:2024-02-19
  • Contact: * E-mail: lyhui@gsau.edu.cn
  • Supported by:
    Science and Technology Program of Gansu Province(22JR5RA870);Science and Technology Program of Gansu Province(22JR5RA834);China Agriculture Research System of MOF and MARA(CARS-09-P14);Major S&T Special Projects of Gansu Province(22ZD6NA009);Central government guidance for local scientific and technological development projects(23ZYQJ304);State Key Laboratory of Aridland Crop Science of China(GSCS-2021-Z02);Fuxi Talent Project of Gansu Agricultural University(Gaufx-02Y04);Scientific Research Startup Funds for Openly-recruited Doctors Agricultural University(GAU-KYQD-2020-11)

RichHTML425

48

PDF

683

Abstract:

The armadillo repeats (Armadillo repeats) are widely distributed in higher plants and are involved in a variety of cellular processes such as signal transduction, nuclear transport, and the response to various biotic/abiotic stresses. In this study, 54 potato ARM gene family members (StARMs) were identified at the genome-wide level of potato (Solanum tuberosum L.), and they were unevenly distributed on 12 chromosomes. Based on their protein structure and phylogenetic characteristics, 54 StARMs were divided into three subfamilies. Segmental duplication events play a major role in the expansion of potato StARM gene family. Collinearity analysis showed that there were 51, 17, 25, 6, and 10 orthologous gene pairs between StARMs and tomato, Arabidopsis, cabbage, rice, and maize, respectively, which evolved under purification selection. RNA-seq data analysis showed that four StARMs genes were specifically expressed in the stolon, two StARMs were specifically expressed in the root and carpel, and one StARM gene was specifically expressed in the tuber. Some StARM genes were involved in potato response to biotic/abiotic stresses. In addition, we performed RNA-seq on three different colored potato tuber tissues (skin and flesh) and analyzed the relative expression pattern of 54 StARMs genes in different colored potato tuber tissues and the StARMs in potato flesh in three different colored potatoes by qPCR. Four candidate genes that may be involved in anthocyanin biosynthesis in potato tubers were screened. This study provides a theoretical basis for further understanding the characteristics of the StARM gene family and further analyzing the function of the StARM gene in potato resistance to biotic/abiotic stresses and regulation of anthocyanin biosynthesis in tubers.

Key words: potato, ARM gene family, biotic/abiotic stress, anthocyanin biosynthesis, the relative expression pattern

Fig. 1

Tuber phenotypes of three different colored potato cultivars Xindaping: white skin and white flesh; Lingtianhongmei: red skin and red flesh; Heimeiren: purple skin and purple flesh. S: potato skin, F: potato flesh. Different letters above bars denote significant difference at P < 0.05."

Fig. 2

Tuber phenotype of different colored potato hybrid progenies S1: tuber formation stage; S2: tuber maturity stage; Y: the yellow flesh variety; R: the red flesh variety; P: the purple flesh variety."

Table S1

Primer information for qPCR used in this study"

基因名称
Gene name		 正向引物
Forward primer (5°-3°)		 反向引物
Reverse primer (5°-3°)
StEF-1α GGTCGTGTTGAGACTGGTGTGATC GCTTCGTGGTGCATCTCTACAGAC
Soltu01G035340 CCAGATATGATTTGTGGTCCTTTTG CAGGGTGTGGAATCAGTAATGTTCT
Soltu02G015230 ATGGCATCTGCTGCAATTTTCT CAACCCAACATCTGTCAGATCCAC
Soltu02G032560 TGTAACCTGGCAGCGAGTTCTG GCAGCAAGACAATTCTCACGAGTC
Soltu03G004990 ATGCTTCGTAATTCGCCGTCA GGCACCAGCATCTATGATACTTTTC
Soltu04G009290 TGGTTTCGCTAGAAAATTCTCATTC TGGTACAAATTGGACCGGATAGTG
Soltu04G032610 TGGAGACTGAAGTTCAATCGAATTT TATCACTGTTGCAATCGCTGAAA
Soltu06G031430 TGTGTTGCGGAGCCTCATAGC ACTACCTGGTCGTTTGGGTGATTC
Soltu07G016540 GTCTAAGGCACAAACCCTAGACCA CCTGCCAGCGAGAAGTAAAAGACT
Soltu08G026240 CAGCTTACAGAAACGGAACACTTCC GCGGTTTTTGATTTGAAAGAAGC
Soltu11G020370 CTCAAGTTGTTGACTCCAATGTTCG GAGCAATTCCTTAGCAGATTCAAGA

Table S2

Analysis of ARM gene family members and physicochemical properties in potato"

基因ID
Gene ID		 染色体定位
Chromosome
localization
(bp)		 外显子
Exon		 内含子
Intron		 氨基酸长度
Amino acid length
(aa)		 相对分子量
Molecular weight
(kD)		 理论等电点Theoretical isoelectric point 亚家族
分类
Subfamily
cluster
Soltu01G020170 Chr.01 30,143,970-30,150,717 - 10 9 529 58.65 5.13 C2
Soltu01G040470 Chr.01 55,223,708-55,229,173 - 10 9 534 59.07 5.13 C2
Soltu01G031070 Chr.01 438,010-444,508 - 12 11 916 98.09 6.50 C3
Soltu01G010740 Chr.01 79,037,941-79,055,022 + 4 3 818 89.26 5.53 C3
Soltu01G032480 Chr.01 70,856,440-70,871,600 - 1 0 555 59.92 8.90 C2
Soltu01G035340 Chr.01 50,713,909-50,724,362 - 4 3 993 110.63 5.53 C3
Soltu01G050860 Chr.01 58,701,505-58,709,231 + 2 1 653 71.93 6.10 C1
Soltu01G032130 Chr.01 54,289,424-54,297,721 - 19 18 880 97.60 6.42 C1
Soltu01G035640 Chr.01 782,037-787,228 + 1 0 311 33.47 5.84 C3
Soltu02G032560 Chr.02 56,324,108-56,329,652 + 1 0 486 53.47 6.85 C3
Soltu02G015230 Chr.02 40,233,405-40,241,625 - 1 0 724 79.30 8.49 C3
Soltu02G018740 Chr.02 16,606,559-16,610,036 + 1 0 576 63.72 7.03 C2
Soltu02G023810 Chr.02 55,687,773-55,696,671 - 1 0 552 60.44 6.22 C1
Soltu02G026750 Chr.02 64,221,992-64,224,506 - 3 2 373 40.65 5.63 C2
Soltu02G010520 Chr.02 50,159,071-50,164,293 - 3 2 330 36.38 5.82 C2
Soltu02G005840 Chr.02 4,301,877-4,305,373 - 1 0 631 69.44 6.41 C1
Soltu02G007220 Chr.02 5,051,243-5,053,770 - 2 1 377 41.25 5.89 C2
Soltu03G003650 Chr.03 4,055,247-4,059,698 - 2 1 664 73.06 8.53 C1
Soltu03G027770 Chr.03 56,643,739-56,649,254 + 1 0 535 58.83 8.63 C3
Soltu03G026010 Chr.03 2,781,211-2,784,877 + 1 0 600 66.39 8.24 C1
Soltu03G004990 Chr.03 72,282,608-72,287,380 - 2 1 310 33.62 6.36 C2
Soltu04G022240 Chr.04 68,531,733-68,541,389 - 6 5 2120 226.50 5.27 C1
Soltu04G032610 Chr.04 44,072,182-44,075,864 + 2 1 356 37.96 5.92 C3
Soltu04G002630 Chr.04 9,543,436-9,546,506 + 4 3 647 69.90 8.44 C3
Soltu04G037650 Chr.04 721,136-723,844 + 8 7 959 107.06 6.63 C3
Soltu04G019300 Chr.04 46,654,769-46,658,455 + 4 3 488 52.67 6.17 C3
Soltu04G009290 Chr.04 44,283,632-44,286,388 + 2 1 451 48.78 5.65 C3
Soltu05G004720 Chr.05 9,441,561-9,453,160 + 4 3 650 70.58 7.85 C3
Soltu05G008330 Chr.05 29,865,050-29,868,218 + 1 0 685 76.06 8.07 C3
Soltu05G008150 Chr.05 30,635,738-30,637,944 + 1 0 685 76.25 7.45 C3
Soltu05G008220 Chr.05 3,610,488-3,613,859 + 3 2 588 65.09 6.03 C3
Soltu05G001590 Chr.05 3,872,355-3,875,948 + 5 4 1046 117.25 5.86 C3
Soltu06G000080 Chr.06 33,056,989-33,059,510 - 10 9 527 58.59 5.00 C2
Soltu06G034720 Chr.06 74,816,160-74,822,802 + 19 18 709 78.08 5.79 C3
Soltu06G031430 Chr.06 87,386,346-87,388,491 - 4 3 572 62.02 5.59 C3
Soltu06G010080 Chr.06 39,654,170-39,673,090 + 1 0 679 74.43 7.14 C3
Soltu07G016540 Chr.07 37,187,439-37,189,097 - 1 0 569 61.74 8.21 C2
Soltu07G014990 Chr.07 52,407,155-52,409,531 - 2 1 393 42.84 5.52 C2
Soltu07G011050 Chr.07 39,584,532-39,587,890 + 2 1 138 15.01 9.27 C2
Soltu08G010180 Chr.08 4,359,566-4,377,252 - 10 9 529 58.40 5.15 C2
Soltu08G026240 Chr.08 25,399,342-25,401,770 + 19 18 906 99.87 6.85 C1
Soltu09G019780 Chr.09 55,879,333-55,890,916 - 19 18 708 78.34 5.86 C3
Soltu09G021390 Chr.09 44,771,850-44,776,570 - 5 4 744 81.58 6.11 C3
Soltu10G023900 Chr.10 19,369,067-19,371,435 - 11 10 520 56.66 5.36 C2
Soltu11G020370 Chr.11 8,313,930-8,316,243 + 4 3 664 72.58 6.01 C3
Soltu11G004340 Chr.11 8,090,829-8,093,283 + 2 1 480 51.92 5.89 C3
Soltu11G000490 Chr.11 71,963,673-71,973,849 - 2 1 458 48.93 6.29 C3
Soltu11G009750 Chr.11 75,124,289-75,125,823 - 6 5 2133 229.40 5.37 C1
Soltu11G020000 Chr.11 8,222,752-8,224,810 - 9 8 704 75.78 7.73 C3
Soltu11G004370 Chr.11 50,992,861-50,995,959 + 22 21 1081 121.90 6.49 C1
Soltu12G000800 Chr.12 21,277,440-21,282,530 - 4 3 821 89.69 5.92 C3
Soltu12G021220 Chr.12 1,207,881-1,212,427 - 1 0 469 51.13 5.71 C2
Soltu12G006210 Chr.12 5,402,137-5,406,934 - 2 1 358 38.41 5.91 C3
Soltu12G004840 Chr.12 35,005,661-35,007,289 - 4 3 645 72.83 5.45 C3

Fig. 3

Evolutionary relationship, gene structure, and conserved motif of StARM gene family"

Fig. S1

Details of the 20 motifs"

Fig. 4

Gene duplication events in StARM gene family"

Fig. 5

Collinearity analysis of ARM genes in multiple species"

Fig. 6

StARM gene expressions in different tissues of DM potato"

Fig. 7

Expression profiles of StARM genes under biotic/abiotic stresses and hormone treatments in DM potato"

Fig. 8

Expression profiles of StARM genes in different colored tuber tissues"

Fig. 9

Relative expression pattern of StARM genes in potato flesh of three potato hybrids S1: tuber formation stage; S2: tuber maturity stage; Y: the yellow flesh variety; R: the red flesh variety; P: the purple flesh variety. Data are means±SEs with three independent biological replicates. Different letters above the bars denote significant differences at P < 0.05."

[1] Sharma M, Pandey A, Pandey G K. β-catenin in plants and animals: common players but different pathways. Front Plant Sci, 2014, 5: 00143.
[2] Xu C, Min J. Structure and function of WD40 domain proteins. Protein Cell, 2011, 2: 202-214.
doi: 10.1007/s13238-011-1018-1 pmid: 21468892
[3] Zhang R, Kennedy M A. Current understanding of the structure and Function of pentapeptide pepeat proteins. Biomolecules, 2021, 11: 638.
[4] Das A K, Cohen P T W, Barford D. The structure of the tetratricopeptide repeats of protein phosphatase 5: implications for TPR-mediated protein-protein interactions. EMBO J, 1998, 17: 1192-1199.
doi: 10.1093/emboj/17.5.1192 pmid: 9482716
[5] Sharma M, Pandey G K. Expansion and function of repeat domain proteins during stress and development in plants. Front Plant Sci, 2016, 6: 1218.
[6] Huber A H, Nelson W J, Weis W I. Three-dimensional structure of the armadillo repeat region of beta-catenin. Cell, 1997, 90: 871-882.
pmid: 9298899
[7] Hatzfeld M. The armadillo family of structural proteins. Int Rev Cytol, 1998, 186: 179-224.
[8] Amador V, Monte E, Garcı́a-Martı́nez J L, Prat S. Gibberellins signal nuclear import of PHOR1, a photoperiod-responsive protein with homology to drosophila armadillo. Cell, 2001, 106: 343-354.
pmid: 11509183
[9] Bergler J, Hoth S. Plant U-box armadillo repeat proteins AtPUB18 and AtPUB19 are involved in salt inhibition of germination in Arabidopsis. Plant Biol, 2011, 13: 725-730.
[10] Stone S L, Anderson E M, Mullen R T, Goring D R. ARC1 is an E3 ubiquitin ligase and promotes the ubiquitination of proteins during the rejection of self-incompatible Brassica pollen. Plant Cell, 2003, 15: 885-898.
doi: 10.1105/tpc.009845 pmid: 12671085
[11] Kirsch C, Logemann E, Lippok B, Schmelzer E, Hahlbrock K. A highly specific pathogen-responsive promoter element from the immediate-early activated CMPG1 gene in Petroselinum crispum. Plant J, 2001, 26: 217-227.
pmid: 11389762
[12] Sharma M, Pandey G K. OsPUB75, an Armadillo/U-box protein interacts with GSK3 kinase and functions as negative regulator of abiotic stress responses. Environ Exp Bot, 2019, 161: 388-398.
[13] Zhang J X, Wang C, Yang C Y, Wang J Y, Chen L, Bao X M, Zhao Y X, Zhang H, Liu J. The role of Arabidopsis AtFes1A in cytosolic Hsp70 stability and abiotic stress tolerance. Plant J, 2010, 62: 539-548.
[14] Mandal A, Mishra A K, Dulani P, Muthamilarasan M, Shweta S, Prasad M. Identification, characterization, expression profiling, and virus-induced gene silencing of armadillo repeat-containing proteins in tomato suggest their involvement in tomato leaf curl New Delhi virus resistance. Funct Integr Genomic, 2018, 18: 101-111.
[15] Kim S, Choi H, Ryu H J, Park J H, Kim M D, Kim S Y. ARIA, an Arabidopsis ARM repeat protein interacting with a transcriptional regulator of abscisic acid-responsive gene expression, is a novel abscisic acid signaling component. Plant Physiol, 2004, 136: 3639-3648.
[16] Samuel M A, Salt J N, Shiu S H, Goring D R. Multifunctional ARM repeat domains in plants. Int Rev Cytol, 2006, 253: 1-26.
pmid: 17098053
[17] Trujillo M. News from the PUB: plant U-box type E3 ubiquitin ligases. J Exp Bot, 2018, 69: 371-384.
doi: 10.1093/jxb/erx411 pmid: 29237060
[18] Mudgil Y, Shiu S H, Stone S L, Salt J N, Goring D R. A large complement of the predicted Arabidopsis ARM repeat proteins are members of the U-box E3 ubiquitin ligase family. Plant Physiol, 2004, 134: 59-66.
[19] Sharma M, Singh A, Shankar A, Pandey A, Baranwal V, Kapoor S, Tyagi A K, Pandey G K. Comprehensive expression analysis of rice armadillo gene family during abiotic stress and development. DNA Res, 2014, 21: 267-283.
doi: 10.1093/dnares/dst056 pmid: 24398598
[20] Visser R G F, Bachem C W B, Boer J M, Bryan G J, Chakrabati S K, Feingold S, Gromadka R, Ham R C H J, Huang S, Jacobs J M E, Kuznetsov B, Melo P E, Milbourne D, Orjeda G, Sagredo B, and Tang X. Sequencing the potato genome: outline and first results to come from the elucidation of the sequence of the world’s third most important food crop. Am J Potato Res, 2009, 86: 417.
[21] Fossen T, Andersen Ø M. Anthocyanins from tubers and shoots of the purple potato, Solanum tuberosum. J Hortic Sci Biotechnol, 2000, 7: 360-363.
[22] Igwe E O, Charlton K E, Roodenrys S, Kent K, Fanning K, Netzel M E. Anthocyanin-rich plum juice reduces ambulatory blood pressure but not acute cognitive function in younger and older adults: a pilot crossover dose-timing study. Nutr Res, 2017, 47: 28-43.
doi: S0271-5317(17)30482-7 pmid: 29241576
[23] Castellarin S D, Pfeiffer A, Sivilotti P, Degan M, Peterlunger E, Gaspero G. Transcriptional regulation of anthocyanin biosynthesis in ripening fruits of grapevine under seasonal water deficit. Plant Cell Environ, 2007, 30: 1381-1399.
doi: 10.1111/j.1365-3040.2007.01716.x pmid: 17897409
[24] Liu Z, Li Y, Zhu J, Ma W, Li Z, Bi Z, Sun C, Bai J, Zhang J, Liu Y. Genome-wide identification and analysis of the NF-Y gene family in potato (Solanum tuberosum L.). Front Genet, 2021, 12: 739989.
[25] Gasteiger E, Hoogland C, Gattiker A, Duvaud S, Wilkins M R, Appel R D, Bairoch A. Protein identification and analysis tools on the expasy server. Proteomics Protocols Handbook, 2005, 53: 571-607.
[26] Hu B, Jin J, Guo A Y, Zhang H, Luo J, Gao G. GSDS 2.0: an upgraded gene feature visualization server. Bioinformatics, 2014, 31: 1296-1297.
[27] Bailey T L, Boden M, Buske F A, Frith M, Grant C E, Clementi L, Ren J, Li W W, Noble W S. MEME SUITE: tools for motif discovery and searching. Nucleic Acids Res, 2009, 37: 202-208.
doi: 10.1093/nar/gkp335 pmid: 19458158
[28] Wang Y, Tang H, Debarry D, Tan X, Li J, Wang X, Lee T H, Jin H, Marler B, Guo H. MCScanX: a toolkit for detection and evolutionary analysis of gene synteny and collinearity. Nucleic Acids Res, 2012, 40: e49.
[29] Krzywinski M, Schein J, Birol I, Connors J, Gascoyne R, Horsman D, Jones S J, Marra M A. Circos: an information aesthetic for comparative genomics. Genome Res, 2009, 19: 1639-1645.
doi: 10.1101/gr.092759.109 pmid: 19541911
[30] Wang D, Zhang Y, Zhang Z, Zhu J, Yu J. KaKs_Calculator 2.0: a toolkit incorporating gamma-series methods and sliding window strategies. Genom Proteom Bioinf, 2010, 8: 77-80.
doi: 10.1016/S1672-0229(10)60008-3 pmid: 20451164
[31] Tang X, Zhang N, Si H, Calderón-Urrea A. Selection and validation of reference genes for RT-qPCR analysis in potato under abiotic stress. Plant Methods, 2017, 13: 85.
doi: 10.1186/s13007-017-0238-7 pmid: 29075311
[32] Livak K J, Schmittgen T D. Analysis of relative gene expression data using real-time quantitative PCR and the 2-ΔΔCT method. Methods, 2001, 25: 402-408.
doi: 10.1006/meth.2001.1262 pmid: 11846609
[33] Chen C, Xia R, Chen H, He Y. TBtools, a toolkit for biologists integrating various HTS-data handling tools with a user-friendly interface. BioRxiv, 2018, 6: 289660.
[34] Cannon S B, Mitra A, Baumgarten A, Young N D, May G. The roles of segmental and tandem gene duplication in the evolution of large gene families in Arabidopsis thaliana. BMC Plant Biol, 2004, 4: 10.
[35] Wang H, Lu Y, Jiang T, Berg H, Li C, Xia Y. The Arabidopsis U-box/ARM repeat E3 ligase AtPUB4 influences growth and degeneration of tapetal cells, and its mutation leads to conditional male sterility. Plant J, 2013, 74: 511-523.
[36] Gebert M, Dresselhaus T, Sprunck S. F-actin organization and pollen tube tip growth in Arabidopsis are dependent on the gametophyte-specific armadillo repeat protein ARO1. Plant Cell, 2008, 20: 2798-2814.
[37] Wang H, Lu Y, Jiang T, Berg H, Li C, Xia Y. The Arabidopsis U-box/ARM repeat E3 ligase AtPUB4 influences growth and degeneration of tapetal cells, and its mutation leads to conditional male sterility. Plant J, 2013, 74: 511-523.
[38] Li W, Ahn I P, Ning Y, Park C H, Zeng L, Whitehill J G A, Lu H, Zhao Q, Ding B, Xie Q, Zhou J, Dai L. The U-Box/ARM E3 ligase PUB13 regulates cell death, defense, and flowering time in Arabidopsis. Plant Physiol, 2012, 15: 239-250.
[39] Zhou J, Lu D, Xu G, Finlayson S A, He P, Shan L. The dominant negative ARM domain uncovers multiple functions of PUB13 in Arabidopsis immunity, flowering, and senescence. J Exp Bot, 2015, 66: 3353-3366.
[40] Dias A P, Braun E L, McMullen M D, Grotewold E. Recently duplicated maize R2R3 Myb genes provide evidence for distinct mechanisms of evolutionary divergence after duplication. Plant Physiol, 2003, 131: 610-620.
[41] Kim E J, Lee S H, Park C H, Kim S H, Hsu C C, Xu S, Wang Z Y, Kim S K, Kim T W. Plant U-Box40 mediates degradation of the brassinosteroid-responsive transcription factor BZR1 in Arabidopsis roots. Plant Cell, 2019, 3: 791-808.
[42] Feng W, Liu Y, Cao Y, Zhao Y, Zhang H, Sun F, Yang Q, Li W, Lu Y, Zhang X, Fu F, and Yu H. Maize ZmBES1/BZR1-3 and -9 transcription factors negatively regulate drought tolerance in transgenic Arabidopsis. Int J Mol Sci, 2022, 23: 6025.
[43] Wang Y, Zhu Y, Jiang H, Mao Z, Zhang J, Fang H, Liu W, Zhang Z, Chen X, Wang N. The regulatory module MdBZR1-MdCOL6 mediates brassinosteroid- and light-regulated anthocyanin synthesis in apple. New Phytol, 2023, 238: 1516-1533.
[1] Chen Guo-Huan, Zhang Rui, Li Yan-Di, Zhao Jia-Qi, Ren Yong-Tao, Zhang Tian-Ci, Guo Hua-Chun, Li Jun, Yang Fang. Effects of foliar application of exogenous selenium on anthocyanin biosynthesis in tubers of light purple-fleshed potatoes [J]. Acta Agronomica Sinica, 2026, 52(6): 1876-1890.
[2] Wang Yi-Han, Li Fu-Chang, Liu Yi, Zhu Guo-Peng. Cloning of the IbOPR2 gene promoter and identification of regulatory factors in sweetpotato [J]. Acta Agronomica Sinica, 2026, 52(4): 1268-1276.
[3] Tian Li-Tao, Ding Ning, Wang Shu-Lin, Qi En-Fang, Zhang Rong, Wang Rui-Rui, Ma Li-Wen, Li Jian-Wu, Yang Jiang-Wei. Genome-wide identification of the Argonaute gene family and its induction by late blight in potato (Solanum tuberosum L.) [J]. Acta Agronomica Sinica, 2026, 52(4): 1116-1126.
[4] Jiang Jia-Hui, Jiang Bing-Zhi, Liu Guan-Ming, Wang Zhang-Ying, Tang Chao-Chen. Establishment and optimization of near-infrared spectroscopy models for quality traits of purple-fleshed sweet potato [J]. Acta Agronomica Sinica, 2026, 52(4): 1088-1102.
[5] Zhang Yu, Liu Fang, Cai Cheng-Cheng, Yang Xiao-Hua, Jia MO-Shi-Zha, Yang Yuan-Jun, Wang Xi-Yao. Preliminary investigation on the mechanism of potato tuber dormancy release induced by combined treatment of bromoethane and gibberellin [J]. Acta Agronomica Sinica, 2026, 52(3): 825-838.
[6] Yu Yong-Chao, Liu Ming, Jin Rong, Zhao Peng, Zhang Qiang-Qiang, Wang Jing, Zhu Xiao-Ya, Tang Zhong-Hou. Physiological mechanism and transcriptome analysis of sweet potato overgrowth under high-nitrogen conditions [J]. Acta Agronomica Sinica, 2026, 52(3): 813-824.
[7] Wang Ling, Hu Hao, Song Jia-Feng, Cheng Jie-Lan, Chen Ying, Zheng Ting-Ting, Lyu Zhao-Yan, Zhu Xiao-Biao, Hou Hua-Lan. Cloning and functional validation of UDP-glycosyltransferase gene StUGT52 in potato [J]. Acta Agronomica Sinica, 2026, 52(3): 665-676.
[8] Xu Qiang, Xie Kui-Zhong, Hu Xin-Yuan, Yue Yun, Dong Bo, Luo Ai-Hua. Effects of continuous cropping on the structure and function of soil nematode communities in potato [J]. Acta Agronomica Sinica, 2026, 52(2): 527-538.
[9] Yang Xuan, Li Jian-Kang, He Wan-Jie, Li You-Jun, Cheng Xiang-Han, Hou Wen-Bang. Effects of selenium fertilization on fresh-cut browning in sweet potatoes and its mechanism analysis [J]. Acta Agronomica Sinica, 2026, 52(2): 578-589.
[10] Yang Biao, Du Shuai-Kang, Zhang Ji-Wang, Shi Ying, Zhang Li-Li. Genome-wide identification of class III POD gene family in potato and its expression profile analysis [J]. Acta Agronomica Sinica, 2026, 52(2): 405-420.
[11] Wang Ya-Zhi, Yang Biao, Ji Xiang-Lin, Shi Ying, Zhang Li-Li. Identification of drought-resistant resources and preliminary screening of drought resistant genes in diploid potatoes [J]. Acta Agronomica Sinica, 2026, 52(1): 72-84.
[12] Tian Jia-Chun, Ge Xia, Li Shou-Qiang, Li Mei, Tian Shi-Long, Zhang Ya-Qian, Cheng Jian-Xin, Li Yu-Mei. Mechanism of low O2 and high CO2 storage environment delaying aging of potato tuber [J]. Acta Agronomica Sinica, 2026, 52(1): 262-278.
[13] Ji Xuan-Tong, Bian Chun-Song, Jin Li-Ping, Li Sen, Qin Jun-Hong, Li Guang-Cun. Responses of root-associated microorganisms of different drought-tolerant potato varieties to drought conditions [J]. Acta Agronomica Sinica, 2026, 52(1): 165-177.
[14] ZHUO Feng-Qi, TANG Zhen-San, LEI Yu-Jun, CHENG Li-Xiang, ZHAO Tian-Tian, LYU Tai, YANG Chen, ZHANG Feng. Screening of low glycemic potato varieties (lines) based on cooking methods and regeneration temperature [J]. Acta Agronomica Sinica, 2025, 51(9): 2538-2546.
[15] ZHU Jin-Cheng, YANG Qiu-Hua, CHENG Li-Xiang, LI Wen-Li, SHI Ming-Ming, LI Hui-Xia, ZHANG Feng. Screening of potato germplasm for resistance to Meloidogyne incognita and analysis of related physiological responses [J]. Acta Agronomica Sinica, 2025, 51(9): 2307-2317.
Viewed
Full text


Abstract

Cited
  Shared   
  Discussed   
No Suggested Reading articles found!
Add: No. 80 Xueyuan South Rd, Beijing 100081, P. R. China E-mail: zwxb301@caas.cn
Supported by Beijing Magtech Co.Ltd