Welcome to Acta Agronomica Sinica，

Acta Agronomica Sinica ›› 2024, Vol. 50 ›› Issue (12): 3013-3024.doi: 10.3724/SP.J.1006.2024.44060

• CROP GENETICS & BREEDING·GERMPLASM RESOURCES·MOLECULAR GENETICS • Previous Articles     Next Articles

Effect of allelic combinations of soybean maturity loci E1/E2/E3/E4 on latitude adaptation

FANG Ran1(), YUAN Li-Mei1, WANG Yu-Lin1, LU Si-Jia1,2, KONG Fan-Jiang1,2, LIU Bao-Hui1,2,*(), KONG Ling-Ping1,2,*()   

  1. 1College of Life Sciences, Guangzhou University / Innovative Research Center of Molecular Genetics and Evolution, Guangzhou 510006, Guangdong, China
    2Guangdong Key Laboratory of Plant Adaptation and Molecular Design, Guangzhou 510006, Guangdong, China
  • Received:2024-04-12 Accepted:2024-08-15 Online:2024-12-12 Published:2024-08-29
  • Contact: *E-mail: liubh@gzhu.edu.cn; E-mail: lpkong@gzhu.edu.cn
  • Supported by:
    Youth Found of National Natural Science Foundation of China(31901569)

RichHTML431

25

PDF

172

Abstract:

Soybean, as an important oil crop, is one of the main sources of high-quality protein and edible oil. Soybean yield and seed quality are closely related to growth-period traits, which are mainly controlled by a series of genes associated with the growth period. In this study, 16 near-isogenic lines (NILs) of E1-E4 were developed using Harosoy as the genetic background and were planted in experimental fields in Shijiazhuang and Hefei. The growth period, seed quality, and yield traits were investigated to understand the adaptability of different combinations of E1-E4 mutants to mid-latitude planting areas. The results showed that the 16 NILs had different photoperiod sensitivities and flowering times. WT and e4 NILs were unsuitable for planting in Shijiazhuang due to late flowering and low yield, while all NILs matured normally when planted in Hefei. Different allelic combinations of E1-E4 also affected plant height, node length, yield per plant, and seed quality. We found that e3 or e4 mutations could lead to early flowering under long-day conditions and simultaneously induce a shading response, resulting in taller plants and longer node lengths. We measured the protein, oil, and sucrose content of the seeds and found that the seeds of WT could not mature normally, exhibiting the lowest oil content and the highest sucrose content. Overall, seeds from the other NILs, when planted in Shijiazhuang, showed higher oil and sucrose content compared to those planted in Hefei but lower protein content. Therefore, to evaluate the latitude adaptability of soybean cultivars, it is necessary to comprehensively examine the effects of growth-period genes on photoperiod sensitivity, seed quality, and yield.

Key words: soybean, growth period, yield, seed quality, adaptability

Table 1

E1-E4 NILs with Harosoy as genetic background"

编号
Number		 基因型
Genotype		 类型
Type		 编号
Number		 基因型
Genotype		 类型
Type
1 E1, E2, E3, E4 野生型 Wild type (WT) 9 e1, E2, e3, E4 e1e3
2 E1, e2, E3, E4 e2 10 e1, E2, E3, e4 e1e4
3 E1, E2, e3, E4 e3 11 e1, e2, E3, E4 e1e2
4 E1, E2, E3, e4 e4 12 e1, e2, e3, E4 e1e2e3
5 e1, E2, E3, E4 e1 13 E1, e2, e3, e4 e2e3e4
6 E1, e2, e3, E4 e2e3 14 e1, e2, E3, e4 e1e2e4
7 E1, e2, E3, e4 e2e4 15 e1, E2, e3, e4 e1e3e4
8 E1, E2, e3, e4 e3e4 16 e1, e2, e3, e4 e1e2e3e4

Table 2

Primers for identification of E1-E4 genotypes in NILs"

基因
Gene		 变异类型
Variation type		 引物序列
Primer sequence (5°-3°)		 标记方法
Marker type		 限制性内切酶
Restriction enzyme		 参考文献
Reference
E1 e1 E1-NS: AACACTCAAAACACTCAAATTAAGCC
E1-RV: TCCGATCTCATCACCTTTCC		 dCAPS Hinf I [8]
E2 e2 E2-dcap-fw: GAAGCCCATCAGAGGCATGTCTTATT
E2-dcap-rv: GAGGCAGAGCCAAAGCCTAT		 dCAPS Dra I [10,31]
E3 e3 E3_08557FW: TGGAGGGTATTGGATGATGC
E3Ha_1000RV: CGGTCAAGAGCCAACATGAG
E3T_0716RV: GTCCTATACAATTCTTTACGACG		 FLP [32]
E4 e4 PhyA2-For (PhyATHF3): AGACGTAGTGCTAGGGCTAT
PhyA2-Rev/E4 (1260R): GCATCTCGCATCACCAGATCA
PhyA2-Rev/e4 (TSR): GCTCATCCCTTCGAATTCAG		 FLP [12]

Fig. 1

Results of E1-E4 genotypes identification in Harosoy NILs A-D represent the E1-E4 genotyping results of 16 NILs in Table 1, respectively; M: marker, 2000 bp DNA ladder."

Fig. 2

Statistics analysis of the R1 stage of all NILs A, B represent the statistical and analytical results of the R1 stage for NILs planted in Shijiazhuang and Hefei, respectively. In the chart, the variance analysis outcomes compared with the wild-type dataset are depicted, and *, **, and *** represent significant differences at the 0.05, 0.01, and 0.001 probability levels, respectively. DAE: days after emergence (d)."

Fig. 3

Statistical and analytical result of node number and plant height in NILs A, B represent the data and analysis of node number and plant height for field materials in Shijiazhuang; C, D is the result of Hefei experimental field. In the chart, the variance analysis outcomes compared with the wild-type dataset are depicted, and *, **, and *** represent significant differences at the 0.05, 0.01, and 0.001 probability levels, respectively."

Fig. 4

Comparison of seed weight per plant in NILs A, B represent the statistics and analysis results of seed weight per plant of NILs planted in Shijiazhuang and Hefei, respectively. In the chart, the variance analysis outcomes compared with the wild- type dataset are depicted, and *, **, and *** represent significant differences at the 0.05, 0.01, and 0.001 probability levels, respectively."

Fig. 5

Plant growth status of wild type and e1/e2/e3/e4 in NILs A, B: wild type (WT) and e1e2e3e4 in NILs were planted in Shijiazhuang experimental field, and the plant morphology was obtained at harvest, respectively; C, D: plant morphology of WT and e1e2e3e4 in NILs at harvest stage in Hefei experimental field, respectively. The bar is 5 cm."

Fig. 6

Yield related traits of e3/E4 and e3/e4 mutants planted under different photoperiod conditions A-C: the e3/E4 and e3/e4 mutants, created using CRISPR-Cas9 technology with Willams_82 as the genetic background, were planted in a 20 h light/4 h dark incubator. After maturity, plant height, node number, average node length, branch number, seed number, and seed weight per plant were statistically analyzed. Plant morphology at harvest stage were shown here; A represents the results of the variance analysis comparing e3/E4 and e3/e4, with the P-value obtained through a one-way analysis of variance (One-way ANOVA); D-E: Willams_82 and e3/e4 mutants were planted in a 16 h light/8 h dark incubator. After flowering, data related to plant height, node number, average node length, yield per plant were statistically analyzed, and plant morphology were shown; D denotes the outcomes of the variance analysis in comparison with the wild-type data, where the P-value is derived through a one-way analysis of variance (One-way ANOVA)."

Fig. 7

Comparison of seed quality traits in NILs A-C illustrate the statistical and analytical results of protein, oil and sucrose content seed quality traits of all NILs harvested in Shijiazhuang, respectively; D-F represent seed quality results of the NILs harvested in Hefei. In the chart, the variance analysis outcomes compared with the wild-type dataset are depicted, *, **, and *** represent significant differences at the 0.05, 0.01, and 0.001 probability levels, respectively."

[1] Cao D, Takeshima R, Zhao C, Liu B H, Jun A, Kong F J. Molecular mechanisms of flowering under long days and stem growth habit in soybean. J Exp Bot, 2017, 68: 1873-1884.
doi: 10.1093/jxb/erw394 pmid: 28338712
[2] Lin X Y, Fang C, Liu B H, Kong F J. Natural variation and artificial selection of photoperiodic flowering genes and their applications in crop adaptation. aBIOTECH, 2021, 2: 156-169.
doi: 10.1007/s42994-021-00039-0 pmid: 36304754
[3] Destro D, Carpentieri-Pípolo V, Kiihl R A S, Almeida L A. Photoperiodism and genetic control of the long juvenile period in soybean: a review. Crop Breed Appl Biotechnol, 2001, 1: 72-92.
[4] Mourtzinis S, Conley S P. Delineating soybean maturity groups across the United States. Agron J, 2017, 109: 1397-1403.
[5] Jia H C, Jiang B J, Wu C X, Lu W C, Hou W S, Sun S, Yan H R, Han T F. Maturity group classification and maturity locus genotyping of early-maturing soybean varieties from high-latitude cold regions. PLoS One, 2014, 9: e94139.
[6] Li J C, Wang X B, Song W W, Huang X Y, Zhou J, Zeng H Y, Sun S, Jia H C, Li W B, Zhou X N, Li S Z, Chen P Y, Wu C X, Guo Y, Han T F, Qiu L J. Genetic variation of maturity groups and four E genes in the Chinese soybean mini core collection. PLoS One, 2017, 12: e0172106.
[7] Yang W Y, Wu T T, Zhang X Y, Song W W, Xu C L, Sun S, Hou W S, Jiang B J, Han T F, Wu C X. Critical photoperiod measurement of soybean genotypes in different maturity groups. Crop Sci, 2019, 59: 2055-2061.
[8] Xia Z J, Watanabe S, Yamada T, Tsubokura Y, Nakashima H, Zhai H, Anai T, Sato S, Yamazaki T, Lyu S X, Wu H Y, Tabata S, Harada K. Positional cloning and characterization reveal the molecular basis for soybean maturity locus E1 that regulates photoperiodic flowering. Proc Natl Acad Sci USA, 2012, 109: E2155-E2164.
[9] Xu M L, Yamagishi N, Zhao C, Takeshima R, Kasai M, Watanabe S, Kanazawa A, Yoshikawa N, Liu B H, Yamada T, Abe J. The soybean-specific maturity gene E1 family of floral repressors controls night-break responses through down-regulation of FLOWERING LOCUS T orthologs. Plant Physiol, 2015, 168: 1735-1746.
doi: 10.1104/pp.15.00763
[10] Watanabe S, Xia Z J, Hideshima R, Tsubokura Y, Sato S, Yamanaka N, Takahashi R, Anai T, Tabata S, Kitamura K, Harada K. A map-based cloning strategy employing a residual heterozygous line reveals that the GIGANTEA gene is involved in soybean maturity and flowering. Genetics, 2011, 188: 395-407.
doi: 10.1534/genetics.110.125062 pmid: 21406680
[11] Watanabe S, Hideshima R, Xia Z J, Tsubokura Y, Sato S, Nakamoto Y, Yamanaka N, Takahashi R, Ishimoto M, Anai T, Tabata S, Harada K. Map-based cloning of the gene associated with the soybean maturity locus E3. Genetics, 2009, 182: 1251-1262.
doi: 10.1534/genetics.108.098772 pmid: 19474204
[12] Liu B H, Kanazawa A, Matsumura H, Takahashi R, Harada K, Abe J. Genetic redundancy in soybean photoresponses associated with duplication of the phytochrome A gene. Genetics, 2008, 180: 995-1007.
doi: 10.1534/genetics.108.092742 pmid: 18780733
[13] Cober E R. Long juvenile soybean flowering responses under very short photoperiods. Crop Sci, 2011, 51: 140-145.
[14] Cober E R, Voldeng H D. Low R: FR light quality delays flowering of E7E7 soybean lines. Crop Sci, 2001, 41: 1823-1826.
[15] Cober E R, Molnar S J, Charette M, Voldeng H D. A new locus for early maturity in soybean. Crop Sci, 2010, 50: 524-527.
[16] Kong F J, Nan H Y, Cao D, Li Y, Wu F F, Wang J L, Lu S J, Yuan X H, Cober E R, Abe J, Liu B H. A new dominant gene E9 conditions early flowering and maturity in soybean. Crop Sci, 2014, 54: 2529-2535.
[17] Kong F J, Liu B H, Xia Z J, Sato S, Kim B M, Watanabe S, Yamada T, Tabata S, Kanazawa A, Harada K, Abe J. Two coordinately regulated homologs of FLOWERING LOCUS T are involved in the control of photoperiodic flowering in soybean. Plant Physiol, 2010, 154: 1220-1231.
[18] Samanfar B, Molnar S J, Charette M, Schoenrock A, Dehne F, Golshani A, Belzile F, Cober E R. Mapping and identification of a potential candidate gene for a novel maturity locus, E10, in soybean. Theor Appl Genet, 2017, 130: 377-390.
doi: 10.1007/s00122-016-2819-7 pmid: 27832313
[19] Lu S J, Dong L D, Fang C, Liu S L, Kong L P, Cheng Q, Chen L Y, Su T, Nan H Y, Zhang D, Zhang L, Wang Z J, Yang Y Q, Yu D Y, Liu X L, Yang Q Y, Lin X Y, Tang Y, Zhao X H, Yang X Q, Tian C G, Xie Q G, Li X, Yuan X H, Tian Z X, Liu B H, Weller J L, Kong F J. Stepwise selection on homeologous PRR genes controlling flowering and maturity during soybean domestication. Nat Genet, 2020, 52: 428-436.
[20] 侯智红. 大豆高纬度适应性相关位点Tof5的克隆与功能研究. 黑龙江八一农垦大学博士学位论文,黑龙江大庆, 2022.
Hou Z H. Cloning and Functional Analysis of Tof5, a Locus of Soybean Adaptated to High Latitude. PhD Dissertation of Heilongjiang Bayi Agricultural University, Daqing, Heilongjiang, China, 2022 (in Chinese with English abstract).
[21] Lu S J, Zhao X H, Hu Y L, Liu S L, Nan H Y, Li X M, Fang C, Cao D, Shi X Y, Kong L P, Su T, Zhang F G, Li S C, Wang Z, Yuan X H, Cober E R, Weller J L, Liu B H, Hou X L, Tian Z X, Kong F J. Natural variation at the soybean J locus improves adaptation to the tropics and enhances yield. Nat Genet, 2017, 49: 773-779.
doi: 10.1038/ng.3819
[22] Lu S J, Li Y, Wang J L, Srinives P, Nan H Y, Cao D, Wang Y P, Li J L, Li X M, Fang C, Shi X Y, Yuan X H, Watanabe S, Feng X Z, Liu B H, Abe J, Kong F J. QTL mapping for flowering time in different latitude in soybean. Euphytica, 2015, 206: 725-736.
[23] Lin X Y, Dong L D, Tang Y, Li H Y, Cheng Q, Li H, Zhang T, Ma L X, Xiang H L, Chen L N, Nan H Y, Fang C, Lu S J, Li J G, Liu B H, Kong F J. Novel and multifaceted regulations of photoperiodic flowering by phytochrome A in soybean. Proc Natl Acad Sci USA, 2022, 119: e2208708119.
[24] Li H Y, Du H P, He M L, Wang J H, Wang F, Yuan W J, Huang Z R, Cheng Q, Gou C J, Chen Z, Liu B H, Kong F J, Fang C, Zhao X H, Yu D Y. Natural variation of FKF1 controls flowering and adaptation during soybean domestication and improvement. New Phytol, 2023, 238: 1671-1684.
[25] Dong L D, Cheng Q, Fang C, Kong L P, Yang H, Hou Z H, Li Y L, Nan H Y, Zhang Y H, Chen Q S, Zhang C B, Kou K, Su T, Wang L S, Li S C, Li H Y, Lin X Y, Tang Y, Zhao X H, Lu S J, Liu B H, Kong F J. Parallel selection of distinct Tof5 alleles drove the adaptation of cultivated and wild soybean to high latitudes. Mol Plant, 2022, 15: 308-321.
[26] Bonato E R, Vello N A. E6, a dominant gene conditioning early flowering and maturity in soybeans. Genet Mol Biol, 1999, 22: 229-232.
[27] Ray J D, Hinson K, Mankono J E B, Malo M F. Genetic control of a long-juvenile trait in soybean. Crop Sci, 1995, 35: 1001-1006.
[28] Fang C, Liu J, Zhang T, Su T, Li S C, Cheng Q, Kong L P, Li X M, Bu T T, Li H Y, Dong L D, Lu S J, Kong F J, Liu B H. A recent retrotransposon insertion of J caused E6 locus facilitating soybean adaptation into low latitude. J Integr Plant Biol, 2021, 63: 995-1003.
[29] Dong L D, Fang C, Cheng Q, Su T, Kou K, Kong L P, Zhang C B, Li H Y, Hou Z H, Zhang Y H, Chen L Y, Yue L, Wang L S, Wang K, Li Y L, Gan Z R, Yuan X H, Weller J L, Lu S J, Kong F J, Liu B H. Genetic basis and adaptation trajectory of soybean from its temperate origin to tropics. Nat Commun, 2021, 12: 5445.
doi: 10.1038/s41467-021-25800-3 pmid: 34521854
[30] Fehr W R, Caviness C E, Burmood D T, Pennington J S. Stage of development descriptions for soybeans, Glycine max (L.) Merrill. Crop Sci, 1971, 11: 929-931.
[31] Tsubokura Y, Watanabe S, Xia Z J, Kanamori H, Yamagata H, Kaga A, Katayose Y, Abe J, Ishimoto M, Harada K. Natural variation in the genes responsible for maturity loci E1, E2, E3 and E4 in soybean. Ann Bot, 2014, 113: 429-441.
[32] Krezhova D. Soybean - Genetics and Novel Techniques for Yield Enhancement. Internet: InTechOpen, 2011. pp 51-76.
[33] Xu M L, Xu Z H, Liu B H, Kong F J, Tsubokura Y, Watanabe S, Xia Z J, Harada K, Kanazawa A, Yamada T, Abe J. Genetic variation in four maturity genes affects photoperiod insensitivity and PHYA-regulated post-flowering responses of soybean. BMC Plant Biol, 2013, 13: 91.
doi: 10.1186/1471-2229-13-91 pmid: 23799885
[34] Tsubokura Y, Matsumura H, Xu M L, Liu B H, Nakashima H, Anai T, Kong F J, Yuan X H, Kanamori H, Katayose Y, Takahashi R, Harada K, Abe J. Genetic variation in soybean at the maturity locus E4 Is involved in adaptation to long days at high latitudes. Agronomy, 2013, 3: 117-134.
[35] Abe J, Xu D H, Miyano A, Komatsu K, Kanazawa A, Shimamoto Y. Photoperiod-insensitive Japanese soybean landraces differ at two maturity loci. Crop Sci, 2003, 43: 1300-1304.
[36] Liu B H, Abe J. QTL mapping for photoperiod insensitivity of a Japanese soybean landrace Sakamotowase. J Hered, 2010, 101: 251-256.
doi: 10.1093/jhered/esp113 pmid: 19959597
[37] Cober E R, Tanner J W, Voldeng H D. Genetic control of photoperiod response in early-maturing, near-isogenic soybean lines. Crop Sci, 1996, 36: 601-605.
[38] Cober E R, Morrison M J. Regulation of seed yield and agronomic characters by photoperiod sensitivity and growth habit genes in soybean. Theor Appl Genet, 2010, 120: 1005-1012.
doi: 10.1007/s00122-009-1228-6 pmid: 20012856
[39] Fang C, Ma Y M, Wu S W, Liu Z, Wang Z, Yang R, Hu G H, Zhou Z K, Yu H, Zhang M, Pan Y, Zhou G A, Ren H X, Du W G, Yan H R, Wang Y P, Han D Z, Shen Y T, Liu S L, Liu T F, Zhang J X, Qin H, Yuan J, Yuan X H, Kong F J, Liu B H, Li J Y, Zhang Z W, Wang G D, Zhu B G, Tian Z X. Genome-wide association studies dissect the genetic networks underlying agronomical traits in soybean. Genome Biol, 2017, 18: 161.
doi: 10.1186/s13059-017-1289-9 pmid: 28838319
[40] Wan Z, Liu Y X, Guo D D, Fan R, Liu Y, Xu K, Zhu J L, Quan L, Lu W T, Bai X, Zhai H. CRISPR/Cas9-mediated targeted mutation of the E1 decreases photoperiod sensitivity, alters stem growth habits, and decreases branch number in soybean. Front Plant Sci, 2022, 13: 1066820.
[41] Carrera C, Martínez M J, Dardanelli J, Balzarini M. Environmental variation and correlation of seed components in nontransgenic soybeans: protein, oil, unsaturated fatty acids, tocopherols, and isoflavones. Crop Sci, 2011, 51: 800-809.
[42] Song W W, Yang R P, Wu T T, Wu C X, Sun S, Zhang S W, Jiang B J, Tian S Y, Liu X B, Han T F. Analyzing the effects of climate factors on soybean protein, oil contents, and composition by extensive and high-density sampling in China. J Agric Food Chem, 2016, 64: 4121-4130.
[43] Song W W, Yang R P, Yang X S, Sun S, Mentreddy S R, Jiang B J, Wu T T, Tian S Y, Sapey E, Wu C X, Hou W S, Ren G X, Han T F. Spatial differences in soybean bioactive components across China and their influence by weather factors. Crop J, 2018, 6: 659-668.
doi: 10.1016/j.cj.2018.05.001
[1] Hu Chuan, Zhao Kai-Nan, Huang Xiu-Li, Wu Jin-Zhi, Ren Kai-Ming, Wang He-Zheng, Fu Guo-Zhan, Huang Ming, Li You-Jun. Effects of tillage methods and nitrogen rates on yield and quality of dryland wheat under one-off irrigation [J]. Acta Agronomica Sinica, 2026, 52(6): 1830-1846.
[2] Ma Sheng-Qian, Wang Zhi-Ping, Chen Hao-Tian, Dou Shu-Xian, Zhang Yan, Deng Ai-Xing, Zhang Wei-Jian, Yuan Xiang-Yang, Song Zhen-Wei. Effects of tillage methods and nitrogen application rate on maize yield and soil aggregates in northeastern China under straw returning [J]. Acta Agronomica Sinica, 2026, 52(6): 1802-1816.
[3] Tang Kuan-Qiang, Li Gong-Yun, Song Mei-Yi, Zhao Xue, Chang Chun-Ling. Genome-wide association analysis and prediction model construction for soybean plant height [J]. Acta Agronomica Sinica, 2026, 52(6): 1743-1756.
[4] Wang Yu-Cheng, Zhang Lu, Liu A-Kang, Huang Jian-Liang, Peng Shao-Bing, Yuan Shen. Strategies and prospects for large-scale crop yield improvement based on yield gap [J]. Acta Agronomica Sinica, 2026, 52(5): 1279-1290.
[5] Zhang Si-Si, Zhao Xiang-Hui, Zhou Yang, Yao Yun-Feng, Zhu Rong-Yu, Dong Yuan-Jie, Hu Guo-Qing, Xu Tong, Liu Zhao-Xin. Effects of plowing and green manure returning in winter fallow period on soil physicochemical properties and yield in continuously cropped peanut [J]. Acta Agronomica Sinica, 2026, 52(5): 1472-1486.
[6] Yao Shu, Guo Kai-Yue, Zhai Hui-Hui, Yao Jia-Hui, Deng Wen-Qi, Yan Ling, Huang Chi, Gao Yang, Yu Yan-Ran, Zhao Zhen-Bang, Li Ying-Hui, Wang Xiao-Bo, Li Jia-Jia. Comprehensive evaluation of low-iron tolerance and screening of elite germplasm at the soybean seedling stage [J]. Acta Agronomica Sinica, 2026, 52(5): 1373-1387.
[7] Zhang Ning-Ning, Teng Yu-Fei, Ren Na-Na, Wei Xing-Zhuo, Yan Shu-Hao, Fan Ke-Xin, Wang Yong-Hong, Chen Wen-Kang, Zhang Xing-Hua, Zhu Wan-Chao, Xu Shu-Tu, Xue Ji-Quan. Phenotypic evaluation and plasticity analysis of drought resistance in 201 maize inbred lines [J]. Acta Agronomica Sinica, 2026, 52(5): 1309-1325.
[8] Zhang Hong-Rong, Wang Fei-Er, Li Pan, Qiu Hai-Long, Zhu Jing, Zhao Lian-Hao, Nan Yun-You, He Wei, Fan Zhi-Long, Hu Fa-Long, Chai Qiang, Yin Wen. Photosynthetic characteristics of 20% reduced irrigation combined with 25% organic substitution for chemical fertilizer in increasing silage maize yield [J]. Acta Agronomica Sinica, 2026, 52(5): 1487-1500.
[9] Zhao Jia-Xue, Zhou Long-Hao, Guo Qi-Yuan, Shang Lun-Xiao, Wang Han, Liu Zhi-Tao, Chen Xi, Zhang Xiao-Pei, Song Xian-Liang, Ahmedov Miraziz Baltaevich, Mao Li-Li. Long-term stubble return and subsoiling enhance cotton yields in coastal saline-alkali soils by improving soil conditions and photosynthetic characteristics [J]. Acta Agronomica Sinica, 2026, 52(5): 1548-1560.
[10] Guo Xing-Yu, Hu Dan, Lin Su-Qi, Wang Meng-Kai, Tan Wen-Feng, Huang Chuan-Qin. Biochar combined with chemical fertilizer increases maize yield and soil ecosystem multifunctionality in an intercropped maize-soybean [J]. Acta Agronomica Sinica, 2026, 52(5): 1536-1547.
[11] Zhang Zhen, Feng Lian-Jie, Shi Yu, Yu Zhen-Wen, Zhang Yong-Li. Yield formation of wheat with different ear types under water-saving supplementary irrigation conditions [J]. Acta Agronomica Sinica, 2026, 52(5): 1522-1535.
[12] Yan An, Jiang Kun-Wei, Wang Rong-Yuan, Tian Lin, Zhang Lu, Wang Yun, Xu Jian-Long. Identification and cloning of SVN7 controlling small vascular bundle number in the rice flag leaf [J]. Acta Agronomica Sinica, 2026, 52(5): 1364-1372.
[13] Liu Xin-Meng, Ren Hao, Zhang Ji-Bo, Zhang Ji-Wang, Zhao Bin, Ren Bai-Zhao, Liu Peng, Wang Hong-Zhang. Physiological mechanisms of methyl jasmonate (MeJA) alleviating the effects of heat stress on ear differentiation in maize [J]. Acta Agronomica Sinica, 2026, 52(5): 1561-1572.
[14] Wang Zhuang-Zhuang, Wu Zi-Jun, Zhang Yong-Xin, Zhang Xin-Yuan, Yuan Li-Xue, Chen Ru-Xue, Liu Shi-Ju, Duan Jian-Zhao, Feng Wei, Wang Tong-Chao, Wang Yong-Hua. Optimized water-nitrogen synergy enhances winter wheat yield and nitrogen use efficiency in clay-loam fluvo-aquic soils of southeastern Henan, China [J]. Acta Agronomica Sinica, 2026, 52(5): 1501-1521.
[15] Cai Hong-Wei, Yu Ai-Zhong, Jiang Ke-Qiang, Wang Peng-Fei, Wang Yu-Long, Huo Jian-Zhe, Pang Xiao-Neng, Yin Bo, Shang Yong-Pan. Key mechanisms underlying the enhancement of sweet maize yield through partial substitution of chemical fertilizers with organic manure in arid irrigation districts [J]. Acta Agronomica Sinica, 2026, 52(4): 1166-1180.
Viewed
Full text


Abstract

Cited
  Shared   
  Discussed   
No Suggested Reading articles found!
Add: No. 80 Xueyuan South Rd, Beijing 100081, P. R. China E-mail: zwxb301@caas.cn
Supported by Beijing Magtech Co.Ltd