玉米HD-ZIP I亚家族基因鉴定及表达分析

doi:10.3724/SP.J.1006.2020.93040

Abstract

Abstract:

Transcription factors (TFs) are indispensable regulators of plant response to abiotic stress and play an important role in the whole growth and development process. HD-ZIP proteins constitute a large family of transcription factors that are found only in plants and are divided into four subfamilies (HD-ZIP I-IV). HD-ZIP I subfamily genes mainly participate in response to extreme environments such as drought and osmotic stress and treatments of ABA and ethylene. Here, we identified 17 HD-ZIP I subfamily genes in the maize genome using the hidden Markov model (HMM), which distributed non-uniformly on six chromosomes of maize and were more closely related to rice than to Arabidopsis. Furthermore, these HD-ZIP I subfamily genes exhibited multiple expression patterns in seven tissues, showing strong tissues-specific expression. Moreover, maize HD-ZIP I subfamily genes showed different response patterns and degrees to different stresses, such as high salinity, waterlogging and cold stress. In addition, maize HD-ZIP I subfamily genes also showed a complex response pattern under treatment of five different hormones. These results provide valuable reference information for dissecting function and molecular mechanism of HD-ZIP I subfamily genes in maize.

Key words: HD-ZIP I subfamily, abiotic stress, expression analysis, maize

LIANG Si-Wei,JIANG Hao-Liang,ZHAI Li-Hong,WAN Xiao-Rong,LI Xiao-Qin,JIANG Feng,SUN Wei. Genome-wide identification and expression analysis of HD-ZIP I subfamily genes in maize[J].Acta Agronomica Sinica, 2020, 46(4): 532-543.

Figures/Tables 8

Supplementary table 1

Table 1

Fig. 1

Fig. 2

Fig. 3

Fig. 4

Fig. 5

Fig. 6

References 42

[1]	Verslues P E, Agarwal M, Katiyar-Agarwal S, Zhu J, Zhu J K . Methods and concepts in quantifying resistance to drought, salt and freezing, abiotic stresses that affect plant water status. Plant J, 2006,45:523-539.
[2]	Yamaguchi-Shinozaki K, Shinozaki K . Transcriptional regulatory networks in cellular responses and tolerance to dehydration and cold stresses. Annu Rev Plant Biol, 2006,57:781-803.
[3]	Zhu J K . Salt and drought stress signal transduction in plants. Annu Rev Plant Biol, 2002,53:247-273.
[4]	Kim S, Kang J Y, Cho D I, Park J H, Kim S Y . ABF2, an ABRE-binding bZIP factor, is an essential component of glucose signaling and its overexpression affects multiple stress tolerance. Plant J, 2004,40:75-87.
[5]	Dai X, Xu Y, Ma Q, Xu W, Wang T, Xue Y, Chong K . Overexpression of an R1R2R3 MYB gene, OsMYB3R-2, increases tolerance to freezing, drought, and salt stress in transgenic Arabidopsis. Plant Physiol, 2007,143:1739-1751.
[6]	Gao T, Wu Y, Zhang Y, Liu L, Ning Y, Wang D, Tong H, Chen S, Chu C, Xie Q . OsSDIR1 overexpression greatly improves drought tolerance in transgenic rice. Plant Mol Biol, 2011,76:145-156.
[7]	Hu T, Ye J, Tao P, Li H, Zhang J, Zhang Y, Ye Z . The tomato HD-Zip I transcription factor SlHZ24 modulates ascorbate accumulation through positive regulation of the D-mannose/L-galactose pathway. Plant J, 2016,85:16-29.
[8]	Gong S, Ding Y, Hu S, Ding L, Chen Z, Zhu C . The role of HD-Zip class I transcription factors in plant response to abiotic stresses. Physiol Plant, 2019, doi: 10.1111/ppl.12965.
[9]	Mukherjee K, Brocchieri L, Burglin T R . A comprehensive classification and evolutionary analysis of plant homeobox genes. Mol Biol Evol, 2009,26:2775-2794.
[10]	Agalou A, Purwantomo S, Overnas E, Johannesson H, Zhu X, Estiati A, de Kam R J, Engstrom P, Slamet-Loedin I H, Zhu Z, Wang M, Xiong L, Meijer A H, Ouwerkerk P B . A genome-wide survey of HD-Zip genes in rice and analysis of drought-responsive family members. Plant Mol Biol, 2008,66:87-103.
[11]	Ariel F, Diet A, Verdenaud M, Gruber V, Frugier F, Chan R, Crespi M . Environmental regulation of lateral root emergence in Medicago truncatula requires the HD-Zip I transcription factor HB1. Plant Cell, 2010,22:2171-2183.
[12]	Lin Z, Hong Y, Yin M, Li C, Zhang K, Grierson D . A tomato HD-Zip homeobox protein, LeHB-1, plays an important role in floral organogenesis and ripening. Plant J, 2008,55:301-310.
[13]	Johannesson H, Wang Y, Hanson J, Engstrom P . The Arabidopsis thaliana homeobox gene ATHB5 is a potential regulator of abscisic acid responsiveness in developing seedlings. Plant Mol Biol, 2003,51:719-729.
[14]	Manavella P A, Arce A L, Dezar C A, Bitton F, Renou J P, Crespi M, Chan R L . Cross-talk between ethylene and drought signalling pathways is mediated by the sunflower Hahb-4 transcription factor. Plant J, 2006,48:125-137.
[15]	Li W, Dong J, Cao M, Gao X, Wang D, Liu B, Chen Q . Genome-wide identification and characterization of HD-ZIP genes in potato. Gene, 2019,697:103-117.
[16]	Li Y, Xiong H, Cuo D, Wu X, Duan R . Genome-wide characterization and expression profiling of the relation of the HD-Zip gene family to abiotic stress in barley ( Hordeum vulgare L.). Plant Physiol Biochem, 2019,141:250-258.
[17]	Yue H, Shu D, Wang M, Xing G, Zhan H, Du X, Song W, Nie X . Genome-wide identification and expression analysis of the HD-Zip gene family in wheat (Triticum aestivum L.). Genes(Basel), 2018,9(2), doi: 10.3390/genes9020070.
[18]	Ariel F D, Manavella P A, Dezar C A, Chan R L . The true story of the HD-Zip family. Trends Plant Sci, 2007, 12:419-426.
[19]	Henriksson E, Olsson A S, Johannesson H, Johansson H, Hanson J, Engstrom P, Soderman E . Homeodomain leucine zipper class I genes in Arabidopsis. Expression patterns and phylogenetic relationships. Plant Physiol, 2005,139:509-518.
[20]	Romani F, Ribone P A, Capella M, Miguel V N, Chan R L . A matter of quantity: common features in the drought response of transgenic plants overexpressing HD-Zip I transcription factors. Plant Sci, 2016,251:139-154.
[21]	Perotti M F, Ribone P A, Chan R L . Plant transcription factors from the homeodomain-leucine zipper family: I. Role in development and stress responses. IUBMB Life, 2017,69:280-289.
[22]	Hu J, Chen G, Yin W, Cui B, Yu X, Lu Y, Hu Z . Silencing of SlHB2 improves drought, salt stress tolerance, and induces stress-related gene expression in tomato. J Plant Growth Regul, 2017,36:578-589.
[23]	Ni Y, Wang X, Li D, Wu Y, Xu W, Li X . Novel cotton homeobox gene and its expression profiling in root development and in response to stresses and phytohormones. Acta Biochim Biophys Sin(Shanghai), 2008,40:78-84.
[24]	Zhang S, Haider I, Kohlen W, Jiang L, Bouwmeester H, Meijer A H, Schluepmann H, Liu C M, Ouwerkerk P B . Function of the HD-Zip I gene Oshox22 in ABA-mediated drought and salt tolerances in rice. Plant Mol Biol, 2012,80:571-585.
[25]	Dezar C A, Gago G M, Gonzalez D H, Chan R L . Hahb-4, a sunflower homeobox-leucine zipper gene, is a developmental regulator and confers drought tolerance to Arabidopsis thaliana plants. Transgenic Res, 2005,14:429-440.
[26]	Cabello J V, Giacomelli J I, Gomez M C, Chan R L . The sunflower transcription factor HaHB11 confers tolerance to water deficit and salinity to transgenic Arabidopsis and alfalfa plants. J Biotechnol, 2017,257:35-46.
[27]	Cabello J V, Arce A L, Chan R L . The homologous HD-Zip I transcription factors HaHB1 and AtHB13 confer cold tolerance via the induction of pathogenesis-related and glucanase proteins. Plant J, 2012,69:141-153.
[28]	Capella M, Ribone P A, Arce A L, Chan R L . Arabidopsis thaliana HomeoBox 1 (AtHB1), a Homedomain-Leucine Zipper I (HD-Zip I) transcription factor, is regulated by PHYTOCHROME-INTERACTING FACTOR 1 to promote hypocotyl elongation. New Phytol, 2015,207:669-682.
[29]	Parveen S, Pandey A, Jameel N, Chakraborty S, Chakraborty N . Transcriptional regulation of chickpea ferritin CaFer1 influences its role in iron homeostasis and stress response. J Plant Physiol, 2018,222:9-16.
[30]	Ebrahimian-Motlagh S, Ribone P A, Thirumalaikumar V P, Allu A D, Chan R L, Mueller-Roeber B, Balazadeh S . JUNGBRUNNEN1 confers drought tolerance downstream of the HD-Zip I transcription factor AtHB13. Front Plant Sci, 2017,8:2118.
[31]	Dai M, Hu Y, Ma Q, Zhao Y, Zhou D X . Functional analysis of rice HOMEOBOX4(Oshox4) gene reveals a negative function in gibberellin responses. Plant Mol Biol, 2008, 66:289-301.
[32]	Zhou W, Malabanan P B, Abrigo E . OsHox4 regulates GA signaling by interacting with DELLA-like genes and GA oxidase genes in rice. Euphytica, 2015,201:97-107.
[33]	Zhao Y, Ma Q, Jin X, Peng X, Liu J, Deng L, Yan H, Sheng L, Jiang H, Cheng B . A novel maize homeodomain-leucine zipper (HD-Zip) I gene, Zmhdz10, positively regulates drought and salt tolerance in both rice and Arabidopsis. Plant Cell Physiol, 2014,55:1142-1156.
[34]	Wu J, Zhou W, Gong X, Cheng B . Expression of ZmHDZ4, a maize homeodomain-Leucine Zipper I gene, confers tolerance to drought stress in transgenic rice. Plant Mol Biol Rep, 2016,34:845-853.
[35]	Guo A Y, Zhu Q H, Chen X, Luo J C . GSDS: gene structure display server. Hereditas(Beijing), 2007,29:1023-1026.
[36]	Letunic I, Doerks T, Bork Bork P . SMART: recent updates, new developments and status in 2015, Nucleic Acids Res, 2015, 43(Database issue):D257-D260.
[37]	Larkin M A, Blackshields G, Brown N P, Chenna R, McGettigan P A, McWilliam H, Valentin F, Wallace I M, Wilm A, Lopez R, Thompson J D, Gibson T J, Higgins D G . Clustal W and Clustal X version 2.0. Bioinformatics, 2007,23:2947-2948.
[38]	Tamura K, Peterson D, Peterson N, Stecher G, Nei M, Kumar S . MEGA5: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol Biol Evol, 2011,28:2731-2739.
[39]	Livak K J, Schmittgen T D . Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods, 2001,25:402-408.
[40]	Gonzalez-Grandio E, Pajoro A, Franco-Zorrilla J M, Tarancon C, Immink R G, Cubas P . Abscisic acid signaling is controlled by a BRANCHED1/HD-ZIP I cascade in Arabidopsis axillary buds. Proc Natl Acad Sci USA, 2017,114:E245-E254.
[41]	Shao J, Haider I, Xiong L, Zhu X, Hussain R M F, Overnas E, Meijer A H, Zhang G, Wang M, Bouwmeester H J, Ouwerkerk P B F . Functional analysis of the HD-Zip transcription factor genes Oshox12 and Oshox14 in rice. PLoS One, 2018,13:e0199248.
[42]	Olsson A S, Engstrom P, Soderman E . The homeobox genes ATHB12 and ATHB7 encode potential regulators of growth in response to water deficit in Arabidopsis. Plant Mol Biol, 2004,55:663-677.

Related Articles 15

[1]	Zuo Tong-Hong, Zhang He-Cui, Zeng Jing, Zhu Li-Quan. Molecular cloning and expression analysis of BoPUB3L associated with self-incompatibility in Brasscia oleracea [J]. Acta Agronomica Sinica, 2026, 52(6): 1698-1710.
[2]	Liang Jin-Yu, Yin Jia-De, Wang Hong-Li, Zhang Guo-Ping, Hou Hui-Zhi, Dong Bo, Ma Ming-Sheng. Estimation of leaf nitrogen content in dryland forage maize using UAV-based hyperspectral imaging and machine learning [J]. Acta Agronomica Sinica, 2026, 52(6): 1788-1801.
[3]	Hu Zhao, Qian Run, Xie Feng-Pu, Ying Su-Ping. Genome-wide identification and expression analysis of the SPX gene family in rice under phosphorus treatment [J]. Acta Agronomica Sinica, 2026, 52(6): 1902-1912.
[4]	Sun Shu-Feng, Xu Zhen-Nan, Huang Jia-Xin, Weng Jian-Feng, Li Xin-Hai. Genome-wide identification of the maize MAPK gene family and its response to Fusarium verticillioides infection [J]. Acta Agronomica Sinica, 2026, 52(5): 1291-1308.
[5]	Zhang Ning-Ning, Teng Yu-Fei, Ren Na-Na, Wei Xing-Zhuo, Yan Shu-Hao, Fan Ke-Xin, Wang Yong-Hong, Chen Wen-Kang, Zhang Xing-Hua, Zhu Wan-Chao, Xu Shu-Tu, Xue Ji-Quan. Phenotypic evaluation and plasticity analysis of drought resistance in 201 maize inbred lines [J]. Acta Agronomica Sinica, 2026, 52(5): 1309-1325.
[6]	Yang Xin-Yu, Cui Wen-Tao, Dilinigeer Alimu, Wang Kai-Xiang, Wu Peng-Hao, Ren Jiao-Jiao. Genome-wide association and genomic selection analysis of the number of leaves above the ear in maize [J]. Acta Agronomica Sinica, 2026, 52(5): 1573-1590.
[7]	Han Ya-Xin, He Guan-Hua, Zhang Xiao-Qiong, Zhang Deng-Feng, Li Yong-Xiang, Liu Xu-Yang, Wang Tian-Yu, Li Yu, Zou Hua-Wen, Li Chun-Hui. Identification of maize lateral root density genes resources through integrated RNA-seq and BSA-seq analyses [J]. Acta Agronomica Sinica, 2026, 52(5): 1341-1352.
[8]	Zhang Hong-Rong, Wang Fei-Er, Li Pan, Qiu Hai-Long, Zhu Jing, Zhao Lian-Hao, Nan Yun-You, He Wei, Fan Zhi-Long, Hu Fa-Long, Chai Qiang, Yin Wen. Photosynthetic characteristics of 20% reduced irrigation combined with 25% organic substitution for chemical fertilizer in increasing silage maize yield [J]. Acta Agronomica Sinica, 2026, 52(5): 1487-1500.
[9]	Yang Yang, Chang Shi-Hui, Tian Hong-Li, Yi Hong-Mei, Wang Lu, Ren Jie, Fan Ya-Ming, Liu Ya-Wei, Wang Feng-Ge, Zhao Jiu-Ran. Genetic diversity analysis of nationally approved maize varieties in different ecological regions [J]. Acta Agronomica Sinica, 2026, 52(5): 1352-1364.
[10]	Cai Hong-Wei, Yu Ai-Zhong, Jiang Ke-Qiang, Wang Peng-Fei, Wang Yu-Long, Huo Jian-Zhe, Pang Xiao-Neng, Yin Bo, Shang Yong-Pan. Key mechanisms underlying the enhancement of sweet maize yield through partial substitution of chemical fertilizers with organic manure in arid irrigation districts [J]. Acta Agronomica Sinica, 2026, 52(4): 1166-1180.
[11]	Tian Hong-Li, Yang Yang, Fan Ya-Ming, Yi Hong-Mei, Guo Dan-Dan, Wang Feng-Ge, Zhao Jiu-Ran. A novel set of tri-allelic variant SNP loci suitable for maize variety identification [J]. Acta Agronomica Sinica, 2026, 52(4): 993-1005.
[12]	Tian Li-Tao, Ding Ning, Wang Shu-Lin, Qi En-Fang, Zhang Rong, Wang Rui-Rui, Ma Li-Wen, Li Jian-Wu, Yang Jiang-Wei. Genome-wide identification of the Argonaute gene family and its induction by late blight in potato (Solanum tuberosum L.) [J]. Acta Agronomica Sinica, 2026, 52(4): 1116-1126.
[13]	Guo Xiang-Yang, Tu Liang, Wang Dong, Liu Peng-Fei, Wang An-Gui, Yi Qiang, Ren Hong, Li Gang, Zhu Yun-Fang, Wu Xun, Jiang Yu-Lin, Tian Feng, Chen Ze-Hui. Application and prospects of Suwan germplasm in maize breeding in China [J]. Acta Agronomica Sinica, 2026, 52(3): 655-664.
[14]	Ma Liang, Ma Lu, Zhang Shu-Yu, Zhang Hui-Min, Wang Ren-Ming, Song Xu-Dong, Zhang Zhen-Liang, Mao Yu-Xiang, Lu Hu-Hua, Chen Guo-Qing, Hao De-Rong, Zhou Guang-Fei. Transcriptome analysis and identification of candidate genes associated with husk number in maize [J]. Acta Agronomica Sinica, 2026, 52(3): 790-801.
[15]	Yang Zong-Tao, Yang Ting, Wang Yu-Tong, Ai Jing, Li Yan-Ye, Liu Jia-Yong, Deng Jun, Zhao Yong, Zhang Yue-Bin. Identification and expression analysis of the CLC gene family in sugarcane [J]. Acta Agronomica Sinica, 2026, 52(3): 722-734.

Metrics

Viewed

Full text

Abstract

Cited

Shared

Discussed

Comments

Recommended 0

No Suggested Reading articles found!

基因 Gene	基因编号 Gene accession number	正向引物 Forward primer (5′-3′)	反向引物 Reverse primer (5′-3′)
ZmActin1	GRMZM2G126010	GGCCAACTGCCGAAGCCAT	GAGAGGGGGCCTCGGTCAGCA
ZmHB5	GRMZM2G132367	CTCGTCTCCCCCCGTTTTC	CAGGCCTTGTACGAGTCGAAT
ZmHB7	GRMZM2G122076	CCAGGTAGCTGTTTGGTTCCA	GGCGAGTGCGTCGTAAGC
ZmHB12	AC233899.1_FGP004	CGGCTCCTGCTTTTCCAA	TCATCTGTGACCGGCACTTG
ZmHB22	GRMZM2G178741	GAGGGCCCCATGGACCA	GTGCAGGAGTTGGTCCATACC
ZmHB34	GRMZM2G002915	AACTGAGAAACTGCAAACGAAAGA	CAGAGCTTGTCTCCTTCCAAGAC
ZmHB41	GRMZM2G117164	GGCCCAGTTCATGCACCA	ACCTGCTCCTCCGTGAACC
ZmHB49	GRMZM2G097349	ACAACAAGAAGCTACAGGCAGAGA	TCTCTGACGTTGAGGTTGATGAG
ZmHB54	GRMZM2G041127	GGAATGCGTGCGGAATG	GCCGAACGCCATCATCTC
ZmHB66	GRMZM2G351330	CTGCTCCGCGCCAAGTT	TCCCTCAGCCTCTCGCTTAG
ZmHB68	GRMZM2G005624	GTTCTCGACGGTGACGCA	CTGTTGTAGGCGTACTCGGTCA
基因 Gene	基因编号 Gene accession number	正向引物 Forward primer (5′-3′)	反向引物 Reverse primer (5′-3′)
ZmHB102	GRMZM2G139963	GATCATGAGCATCAAGAACAGCAT	GCGAGGGGCATTGAGAAGA
ZmHB112	GRMZM2G003304	ATCCCTGTCGGCAACCATC	ATGTCCAGTGCAACCGCAG
ZmHB115	GRMZM2G021339	GACCGATGCTTGGCCTTG	AGCTGCTCGTCGTAGTACTCCTC
ZmHB120	GRMZM2G056600	GATGATGGTTACGGCGTGG	GCACCTGCTCGGAGCTCA
ZmHB126	GRMZM2G034113	ACGGAGTGGATGATGCATGG	GAACATGGACTCCAGCGACTT
ZmHB127	GRMZM2G119999	GCGTCGCCCTACCCTTACTC	ACGTCAAGAAGGAGGTGAAACC
ZmHB128	GRMZM2G041462	CCCGGAGTGGATGATGGAG	CGAACATGGACTCGAGAGACTT

基因 Gene	基因编号 Gene accession	Bin	基因组位置 Genome location (RefG.v3)	编码区 Coding sequence (bp)	蛋白长度 Protein (aa)	外显子数目 Exon number
ZmHB5	GRMZM2G132367	1.02	19250088:19252388	981	326	3
ZmHB7	GRMZM2G122076	4.05	77636576:77641035	819	272	3
ZmHB12	AC233899.1_FGP004	9.07	149912584:149914098	1134	377	3
ZmHB22	GRMZM2G178741	9.07	151525953:151528343	1035	344	3
ZmHB34	GRMZM2G002915	2.06	178781917:178784182	852	283	3
ZmHB41	GRMZM2G117164	5.05	190526953:190528628	708	235	2
ZmHB49	GRMZM2G097349	1.08	243185151:243187447	1092	363	2
ZmHB54	GRMZM2G041127	2.07	188712314:188714917	825	274	3
ZmHB66	GRMZM2G351330	2.03	22220873:22222180	786	261	2
ZmHB68	GRMZM2G005624	1.02	23240104:23243489	720	239	3
ZmHB102	GRMZM2G139963	1.02	14957965:14960921	1035	344	3
ZmHB112	GRMZM2G003304	1.07	218768608:218773418	813	270	3
ZmHB115	GRMZM2G021339	4.06	165861785:165863994	1020	339	4
ZmHB120	GRMZM2G056600	7.03	129296234:129298384	786	261	3
ZmHB126	GRMZM2G034113	2.07	195705583:195707271	735	244	2
ZmHB127	GRMZM2G119999	1.05	139960481:139962631	885	294	3
ZmHB128	GRMZM2G041462	7.03	142432248:142434060	720	239	2

Genome-wide identification and expression analysis of HD-ZIP I subfamily genes in maize

RichHTML367

PDF