Welcome to Acta Agronomica Sinica,

Acta Agronomica Sinica ›› 2020, Vol. 46 ›› Issue (4): 532-543.doi: 10.3724/SP.J.1006.2020.93040

• CROP GENETICS & BREEDING · GERMPLASM RESOURCES · MOLECULAR GENETICS • Previous Articles     Next Articles

Genome-wide identification and expression analysis of HD-ZIP I subfamily genes in maize

LIANG Si-Wei1,JIANG Hao-Liang1,ZHAI Li-Hong2,WAN Xiao-Rong1,LI Xiao-Qin1,JIANG Feng1,*(),SUN Wei1,*()   

  1. 1 College of Agriculture and Biology, Zhongkai University of Agriculture and Engineering, Guangzhou 510225, Guangdong, China
    2 Medical College, Hubei University of Arts and Science, Xiangyang 441053, Hubei, China
  • Received:2019-07-13 Accepted:2019-12-26 Online:2020-04-12 Published:2020-01-15
  • Contact: Feng JIANG,Wei SUN E-mail:breakthrough@139.com;starking521@126.com
  • Supported by:
    This study was supported by the National Natural Science Foundation of China(31901565);the National Key Research and Development Program of Guangdong Province(2018B020202013);the Program of the Science and Technology Bureau of Guangdong Province(粤科产学研字[2016]176号)

Abstract:

Transcription factors (TFs) are indispensable regulators of plant response to abiotic stress and play an important role in the whole growth and development process. HD-ZIP proteins constitute a large family of transcription factors that are found only in plants and are divided into four subfamilies (HD-ZIP I-IV). HD-ZIP I subfamily genes mainly participate in response to extreme environments such as drought and osmotic stress and treatments of ABA and ethylene. Here, we identified 17 HD-ZIP I subfamily genes in the maize genome using the hidden Markov model (HMM), which distributed non-uniformly on six chromosomes of maize and were more closely related to rice than to Arabidopsis. Furthermore, these HD-ZIP I subfamily genes exhibited multiple expression patterns in seven tissues, showing strong tissues-specific expression. Moreover, maize HD-ZIP I subfamily genes showed different response patterns and degrees to different stresses, such as high salinity, waterlogging and cold stress. In addition, maize HD-ZIP I subfamily genes also showed a complex response pattern under treatment of five different hormones. These results provide valuable reference information for dissecting function and molecular mechanism of HD-ZIP I subfamily genes in maize.

Key words: HD-ZIP I subfamily, abiotic stress, expression analysis, maize

Supplementary table 1

List of primers used in the present study"

基因
Gene
基因编号
Gene accession number
正向引物
Forward primer (5′-3′)
反向引物
Reverse primer (5′-3′)
ZmActin1 GRMZM2G126010 GGCCAACTGCCGAAGCCAT GAGAGGGGGCCTCGGTCAGCA
ZmHB5 GRMZM2G132367 CTCGTCTCCCCCCGTTTTC CAGGCCTTGTACGAGTCGAAT
ZmHB7 GRMZM2G122076 CCAGGTAGCTGTTTGGTTCCA GGCGAGTGCGTCGTAAGC
ZmHB12 AC233899.1_FGP004 CGGCTCCTGCTTTTCCAA TCATCTGTGACCGGCACTTG
ZmHB22 GRMZM2G178741 GAGGGCCCCATGGACCA GTGCAGGAGTTGGTCCATACC
ZmHB34 GRMZM2G002915 AACTGAGAAACTGCAAACGAAAGA CAGAGCTTGTCTCCTTCCAAGAC
ZmHB41 GRMZM2G117164 GGCCCAGTTCATGCACCA ACCTGCTCCTCCGTGAACC
ZmHB49 GRMZM2G097349 ACAACAAGAAGCTACAGGCAGAGA TCTCTGACGTTGAGGTTGATGAG
ZmHB54 GRMZM2G041127 GGAATGCGTGCGGAATG GCCGAACGCCATCATCTC
ZmHB66 GRMZM2G351330 CTGCTCCGCGCCAAGTT TCCCTCAGCCTCTCGCTTAG
ZmHB68 GRMZM2G005624 GTTCTCGACGGTGACGCA CTGTTGTAGGCGTACTCGGTCA
基因
Gene
基因编号
Gene accession number
正向引物
Forward primer (5′-3′)
反向引物
Reverse primer (5′-3′)
ZmHB102 GRMZM2G139963 GATCATGAGCATCAAGAACAGCAT GCGAGGGGCATTGAGAAGA
ZmHB112 GRMZM2G003304 ATCCCTGTCGGCAACCATC ATGTCCAGTGCAACCGCAG
ZmHB115 GRMZM2G021339 GACCGATGCTTGGCCTTG AGCTGCTCGTCGTAGTACTCCTC
ZmHB120 GRMZM2G056600 GATGATGGTTACGGCGTGG GCACCTGCTCGGAGCTCA
ZmHB126 GRMZM2G034113 ACGGAGTGGATGATGCATGG GAACATGGACTCCAGCGACTT
ZmHB127 GRMZM2G119999 GCGTCGCCCTACCCTTACTC ACGTCAAGAAGGAGGTGAAACC
ZmHB128 GRMZM2G041462 CCCGGAGTGGATGATGGAG CGAACATGGACTCGAGAGACTT

Table 1

Basic information of HD-ZIP I subfamily genes in maize"

基因
Gene
基因编号
Gene accession
Bin 基因组位置
Genome location
(RefG.v3)
编码区
Coding
sequence (bp)
蛋白长度
Protein (aa)
外显子数目
Exon number
ZmHB5 GRMZM2G132367 1.02 19250088:19252388 981 326 3
ZmHB7 GRMZM2G122076 4.05 77636576:77641035 819 272 3
ZmHB12 AC233899.1_FGP004 9.07 149912584:149914098 1134 377 3
ZmHB22 GRMZM2G178741 9.07 151525953:151528343 1035 344 3
ZmHB34 GRMZM2G002915 2.06 178781917:178784182 852 283 3
ZmHB41 GRMZM2G117164 5.05 190526953:190528628 708 235 2
ZmHB49 GRMZM2G097349 1.08 243185151:243187447 1092 363 2
ZmHB54 GRMZM2G041127 2.07 188712314:188714917 825 274 3
ZmHB66 GRMZM2G351330 2.03 22220873:22222180 786 261 2
ZmHB68 GRMZM2G005624 1.02 23240104:23243489 720 239 3
ZmHB102 GRMZM2G139963 1.02 14957965:14960921 1035 344 3
ZmHB112 GRMZM2G003304 1.07 218768608:218773418 813 270 3
ZmHB115 GRMZM2G021339 4.06 165861785:165863994 1020 339 4
ZmHB120 GRMZM2G056600 7.03 129296234:129298384 786 261 3
ZmHB126 GRMZM2G034113 2.07 195705583:195707271 735 244 2
ZmHB127 GRMZM2G119999 1.05 139960481:139962631 885 294 3
ZmHB128 GRMZM2G041462 7.03 142432248:142434060 720 239 2

Fig. 1

Chromosomal location of maize HD-ZIP I subfamily genes"

Fig. 2

Diagram of structure of HD-ZIP I subfamily genes and functional domains in maize The line indicates intron, wide black rectangle indicates exon, and narrow black rectangle indicates untranslated region (UTR) in left figure; the black round corner rectangle indicates HD domain and black hexagon indicates ZIP domain in right figure."

Fig. 3

Phylogenetic tree of HD-ZIP I proteins in maize, rice, and Arabidopsis The HD-ZIP I subfamily protein sequences of maize, rice, and Arabidopsis were obtained from the MaizeGDB (http://maizegdb.org/), TIGR (http://www.tigr.org/), and TAIR (http://www.arabidopsis.org/) databases, respectively. Multiple alignment of amino acid sequences was carried out by ClustalX 2.0 software and Neighbor-Joining evolutionary tree was constructed by MEGA 5.1 (1000 replications of bootstrap test). Arabidopsis genes are highlighted in yellow background, rice genes are highlighted in green background, and maize genes are highlighted in purple background."

Fig. 4

Expression profile of HD-ZIP I subfamily genes of maize Leaves: fully expended leaves; Tassels: immature tassels; Ears: immature ears; Seedling_shoots: the shoots of maize seedlings; Seedling_roots: the roots of maize seedlings; Seeds_5DAP: the seeds at 5 days after pollination; Seeds_10DAP: the seeds at 10 days after pollination. Colors in square represent the logarithm of the HD-Zip I subfamily gene expression level (ln (RPKM))."

Fig. 5

Expression pattern of maize HD-ZIP I genes under abiotic stresses NT: non-treatment; NaCl: NaCl treatment; WL: waterlogging stress; CT: chilling stress; RCT: recuperative treatment after chilling stress. The ordinate indicates the relative expression of genes, using the expression of the non-treatment group (NT) as 1. The significance of difference was evaluated using analysis of variance. *P < 0.05, **P < 0.01, and ***P < 0.001."

Fig. 6

Expression profiling of maize HD-ZIP I genes in response to hormones MOCK: control; ABA: Abscisic Acid; Eth: Ethylene; GA3: Gibberellin; KT: Kinetin; NAA: 1-naphthylacetic acid. The ordinate represents the relative expression of genes, using the expression of the non-treatment group (MOCK) as 1. The significance of difference was evaluated using analysis of variance. *P < 0.05, **P < 0.01, and ***P < 0.001."

[1] Verslues P E, Agarwal M, Katiyar-Agarwal S, Zhu J, Zhu J K . Methods and concepts in quantifying resistance to drought, salt and freezing, abiotic stresses that affect plant water status. Plant J, 2006,45:523-539.
[2] Yamaguchi-Shinozaki K, Shinozaki K . Transcriptional regulatory networks in cellular responses and tolerance to dehydration and cold stresses. Annu Rev Plant Biol, 2006,57:781-803.
[3] Zhu J K . Salt and drought stress signal transduction in plants. Annu Rev Plant Biol, 2002,53:247-273.
[4] Kim S, Kang J Y, Cho D I, Park J H, Kim S Y . ABF2, an ABRE-binding bZIP factor, is an essential component of glucose signaling and its overexpression affects multiple stress tolerance. Plant J, 2004,40:75-87.
[5] Dai X, Xu Y, Ma Q, Xu W, Wang T, Xue Y, Chong K . Overexpression of an R1R2R3 MYB gene, OsMYB3R-2, increases tolerance to freezing, drought, and salt stress in transgenic Arabidopsis. Plant Physiol, 2007,143:1739-1751.
[6] Gao T, Wu Y, Zhang Y, Liu L, Ning Y, Wang D, Tong H, Chen S, Chu C, Xie Q . OsSDIR1 overexpression greatly improves drought tolerance in transgenic rice. Plant Mol Biol, 2011,76:145-156.
[7] Hu T, Ye J, Tao P, Li H, Zhang J, Zhang Y, Ye Z . The tomato HD-Zip I transcription factor SlHZ24 modulates ascorbate accumulation through positive regulation of the D-mannose/L-galactose pathway. Plant J, 2016,85:16-29.
[8] Gong S, Ding Y, Hu S, Ding L, Chen Z, Zhu C . The role of HD-Zip class I transcription factors in plant response to abiotic stresses. Physiol Plant, 2019, doi: 10.1111/ppl.12965.
[9] Mukherjee K, Brocchieri L, Burglin T R . A comprehensive classification and evolutionary analysis of plant homeobox genes. Mol Biol Evol, 2009,26:2775-2794.
[10] Agalou A, Purwantomo S, Overnas E, Johannesson H, Zhu X, Estiati A, de Kam R J, Engstrom P, Slamet-Loedin I H, Zhu Z, Wang M, Xiong L, Meijer A H, Ouwerkerk P B . A genome-wide survey of HD-Zip genes in rice and analysis of drought-responsive family members. Plant Mol Biol, 2008,66:87-103.
[11] Ariel F, Diet A, Verdenaud M, Gruber V, Frugier F, Chan R, Crespi M . Environmental regulation of lateral root emergence in Medicago truncatula requires the HD-Zip I transcription factor HB1. Plant Cell, 2010,22:2171-2183.
[12] Lin Z, Hong Y, Yin M, Li C, Zhang K, Grierson D . A tomato HD-Zip homeobox protein, LeHB-1, plays an important role in floral organogenesis and ripening. Plant J, 2008,55:301-310.
[13] Johannesson H, Wang Y, Hanson J, Engstrom P . The Arabidopsis thaliana homeobox gene ATHB5 is a potential regulator of abscisic acid responsiveness in developing seedlings. Plant Mol Biol, 2003,51:719-729.
[14] Manavella P A, Arce A L, Dezar C A, Bitton F, Renou J P, Crespi M, Chan R L . Cross-talk between ethylene and drought signalling pathways is mediated by the sunflower Hahb-4 transcription factor. Plant J, 2006,48:125-137.
[15] Li W, Dong J, Cao M, Gao X, Wang D, Liu B, Chen Q . Genome-wide identification and characterization of HD-ZIP genes in potato. Gene, 2019,697:103-117.
[16] Li Y, Xiong H, Cuo D, Wu X, Duan R . Genome-wide characterization and expression profiling of the relation of the HD-Zip gene family to abiotic stress in barley ( Hordeum vulgare L.). Plant Physiol Biochem, 2019,141:250-258.
[17] Yue H, Shu D, Wang M, Xing G, Zhan H, Du X, Song W, Nie X . Genome-wide identification and expression analysis of the HD-Zip gene family in wheat (Triticum aestivum L.). Genes(Basel), 2018,9(2), doi: 10.3390/genes9020070.
[18] Ariel F D, Manavella P A, Dezar C A, Chan R L . The true story of the HD-Zip family. Trends Plant Sci, 2007, 12:419-426.
[19] Henriksson E, Olsson A S, Johannesson H, Johansson H, Hanson J, Engstrom P, Soderman E . Homeodomain leucine zipper class I genes in Arabidopsis. Expression patterns and phylogenetic relationships. Plant Physiol, 2005,139:509-518.
[20] Romani F, Ribone P A, Capella M, Miguel V N, Chan R L . A matter of quantity: common features in the drought response of transgenic plants overexpressing HD-Zip I transcription factors. Plant Sci, 2016,251:139-154.
[21] Perotti M F, Ribone P A, Chan R L . Plant transcription factors from the homeodomain-leucine zipper family: I. Role in development and stress responses. IUBMB Life, 2017,69:280-289.
[22] Hu J, Chen G, Yin W, Cui B, Yu X, Lu Y, Hu Z . Silencing of SlHB2 improves drought, salt stress tolerance, and induces stress-related gene expression in tomato. J Plant Growth Regul, 2017,36:578-589.
[23] Ni Y, Wang X, Li D, Wu Y, Xu W, Li X . Novel cotton homeobox gene and its expression profiling in root development and in response to stresses and phytohormones. Acta Biochim Biophys Sin(Shanghai), 2008,40:78-84.
[24] Zhang S, Haider I, Kohlen W, Jiang L, Bouwmeester H, Meijer A H, Schluepmann H, Liu C M, Ouwerkerk P B . Function of the HD-Zip I gene Oshox22 in ABA-mediated drought and salt tolerances in rice. Plant Mol Biol, 2012,80:571-585.
[25] Dezar C A, Gago G M, Gonzalez D H, Chan R L . Hahb-4, a sunflower homeobox-leucine zipper gene, is a developmental regulator and confers drought tolerance to Arabidopsis thaliana plants. Transgenic Res, 2005,14:429-440.
[26] Cabello J V, Giacomelli J I, Gomez M C, Chan R L . The sunflower transcription factor HaHB11 confers tolerance to water deficit and salinity to transgenic Arabidopsis and alfalfa plants. J Biotechnol, 2017,257:35-46.
[27] Cabello J V, Arce A L, Chan R L . The homologous HD-Zip I transcription factors HaHB1 and AtHB13 confer cold tolerance via the induction of pathogenesis-related and glucanase proteins. Plant J, 2012,69:141-153.
[28] Capella M, Ribone P A, Arce A L, Chan R L . Arabidopsis thaliana HomeoBox 1 (AtHB1), a Homedomain-Leucine Zipper I (HD-Zip I) transcription factor, is regulated by PHYTOCHROME-INTERACTING FACTOR 1 to promote hypocotyl elongation. New Phytol, 2015,207:669-682.
[29] Parveen S, Pandey A, Jameel N, Chakraborty S, Chakraborty N . Transcriptional regulation of chickpea ferritin CaFer1 influences its role in iron homeostasis and stress response. J Plant Physiol, 2018,222:9-16.
[30] Ebrahimian-Motlagh S, Ribone P A, Thirumalaikumar V P, Allu A D, Chan R L, Mueller-Roeber B, Balazadeh S . JUNGBRUNNEN1 confers drought tolerance downstream of the HD-Zip I transcription factor AtHB13. Front Plant Sci, 2017,8:2118.
[31] Dai M, Hu Y, Ma Q, Zhao Y, Zhou D X . Functional analysis of rice HOMEOBOX4(Oshox4) gene reveals a negative function in gibberellin responses. Plant Mol Biol, 2008, 66:289-301.
[32] Zhou W, Malabanan P B, Abrigo E . OsHox4 regulates GA signaling by interacting with DELLA-like genes and GA oxidase genes in rice. Euphytica, 2015,201:97-107.
[33] Zhao Y, Ma Q, Jin X, Peng X, Liu J, Deng L, Yan H, Sheng L, Jiang H, Cheng B . A novel maize homeodomain-leucine zipper (HD-Zip) I gene, Zmhdz10, positively regulates drought and salt tolerance in both rice and Arabidopsis. Plant Cell Physiol, 2014,55:1142-1156.
[34] Wu J, Zhou W, Gong X, Cheng B . Expression of ZmHDZ4, a maize homeodomain-Leucine Zipper I gene, confers tolerance to drought stress in transgenic rice. Plant Mol Biol Rep, 2016,34:845-853.
[35] Guo A Y, Zhu Q H, Chen X, Luo J C . GSDS: gene structure display server. Hereditas(Beijing), 2007,29:1023-1026.
[36] Letunic I, Doerks T, Bork Bork P . SMART: recent updates, new developments and status in 2015, Nucleic Acids Res, 2015, 43(Database issue):D257-D260.
[37] Larkin M A, Blackshields G, Brown N P, Chenna R, McGettigan P A, McWilliam H, Valentin F, Wallace I M, Wilm A, Lopez R, Thompson J D, Gibson T J, Higgins D G . Clustal W and Clustal X version 2.0. Bioinformatics, 2007,23:2947-2948.
[38] Tamura K, Peterson D, Peterson N, Stecher G, Nei M, Kumar S . MEGA5: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol Biol Evol, 2011,28:2731-2739.
[39] Livak K J, Schmittgen T D . Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods, 2001,25:402-408.
[40] Gonzalez-Grandio E, Pajoro A, Franco-Zorrilla J M, Tarancon C, Immink R G, Cubas P . Abscisic acid signaling is controlled by a BRANCHED1/HD-ZIP I cascade in Arabidopsis axillary buds. Proc Natl Acad Sci USA, 2017,114:E245-E254.
[41] Shao J, Haider I, Xiong L, Zhu X, Hussain R M F, Overnas E, Meijer A H, Zhang G, Wang M, Bouwmeester H J, Ouwerkerk P B F . Functional analysis of the HD-Zip transcription factor genes Oshox12 and Oshox14 in rice. PLoS One, 2018,13:e0199248.
[42] Olsson A S, Engstrom P, Soderman E . The homeobox genes ATHB12 and ATHB7 encode potential regulators of growth in response to water deficit in Arabidopsis. Plant Mol Biol, 2004,55:663-677.
[1] Zuo Tong-Hong, Zhang He-Cui, Zeng Jing, Zhu Li-Quan. Molecular cloning and expression analysis of BoPUB3L associated with self-incompatibility in Brasscia oleracea [J]. Acta Agronomica Sinica, 2026, 52(6): 1698-1710.
[2] Liang Jin-Yu, Yin Jia-De, Wang Hong-Li, Zhang Guo-Ping, Hou Hui-Zhi, Dong Bo, Ma Ming-Sheng. Estimation of leaf nitrogen content in dryland forage maize using UAV-based hyperspectral imaging and machine learning [J]. Acta Agronomica Sinica, 2026, 52(6): 1788-1801.
[3] Hu Zhao, Qian Run, Xie Feng-Pu, Ying Su-Ping. Genome-wide identification and expression analysis of the SPX gene family in rice under phosphorus treatment [J]. Acta Agronomica Sinica, 2026, 52(6): 1902-1912.
[4] Sun Shu-Feng, Xu Zhen-Nan, Huang Jia-Xin, Weng Jian-Feng, Li Xin-Hai. Genome-wide identification of the maize MAPK gene family and its response to Fusarium verticillioides infection [J]. Acta Agronomica Sinica, 2026, 52(5): 1291-1308.
[5] Zhang Ning-Ning, Teng Yu-Fei, Ren Na-Na, Wei Xing-Zhuo, Yan Shu-Hao, Fan Ke-Xin, Wang Yong-Hong, Chen Wen-Kang, Zhang Xing-Hua, Zhu Wan-Chao, Xu Shu-Tu, Xue Ji-Quan. Phenotypic evaluation and plasticity analysis of drought resistance in 201 maize inbred lines [J]. Acta Agronomica Sinica, 2026, 52(5): 1309-1325.
[6] Yang Xin-Yu, Cui Wen-Tao, Dilinigeer Alimu, Wang Kai-Xiang, Wu Peng-Hao, Ren Jiao-Jiao. Genome-wide association and genomic selection analysis of the number of leaves above the ear in maize [J]. Acta Agronomica Sinica, 2026, 52(5): 1573-1590.
[7] Han Ya-Xin, He Guan-Hua, Zhang Xiao-Qiong, Zhang Deng-Feng, Li Yong-Xiang, Liu Xu-Yang, Wang Tian-Yu, Li Yu, Zou Hua-Wen, Li Chun-Hui. Identification of maize lateral root density genes resources through integrated RNA-seq and BSA-seq analyses [J]. Acta Agronomica Sinica, 2026, 52(5): 1341-1352.
[8] Zhang Hong-Rong, Wang Fei-Er, Li Pan, Qiu Hai-Long, Zhu Jing, Zhao Lian-Hao, Nan Yun-You, He Wei, Fan Zhi-Long, Hu Fa-Long, Chai Qiang, Yin Wen. Photosynthetic characteristics of 20% reduced irrigation combined with 25% organic substitution for chemical fertilizer in increasing silage maize yield [J]. Acta Agronomica Sinica, 2026, 52(5): 1487-1500.
[9] Yang Yang, Chang Shi-Hui, Tian Hong-Li, Yi Hong-Mei, Wang Lu, Ren Jie, Fan Ya-Ming, Liu Ya-Wei, Wang Feng-Ge, Zhao Jiu-Ran. Genetic diversity analysis of nationally approved maize varieties in different ecological regions [J]. Acta Agronomica Sinica, 2026, 52(5): 1352-1364.
[10] Cai Hong-Wei, Yu Ai-Zhong, Jiang Ke-Qiang, Wang Peng-Fei, Wang Yu-Long, Huo Jian-Zhe, Pang Xiao-Neng, Yin Bo, Shang Yong-Pan. Key mechanisms underlying the enhancement of sweet maize yield through partial substitution of chemical fertilizers with organic manure in arid irrigation districts [J]. Acta Agronomica Sinica, 2026, 52(4): 1166-1180.
[11] Tian Hong-Li, Yang Yang, Fan Ya-Ming, Yi Hong-Mei, Guo Dan-Dan, Wang Feng-Ge, Zhao Jiu-Ran. A novel set of tri-allelic variant SNP loci suitable for maize variety identification [J]. Acta Agronomica Sinica, 2026, 52(4): 993-1005.
[12] Tian Li-Tao, Ding Ning, Wang Shu-Lin, Qi En-Fang, Zhang Rong, Wang Rui-Rui, Ma Li-Wen, Li Jian-Wu, Yang Jiang-Wei. Genome-wide identification of the Argonaute gene family and its induction by late blight in potato (Solanum tuberosum L.) [J]. Acta Agronomica Sinica, 2026, 52(4): 1116-1126.
[13] Guo Xiang-Yang, Tu Liang, Wang Dong, Liu Peng-Fei, Wang An-Gui, Yi Qiang, Ren Hong, Li Gang, Zhu Yun-Fang, Wu Xun, Jiang Yu-Lin, Tian Feng, Chen Ze-Hui. Application and prospects of Suwan germplasm in maize breeding in China [J]. Acta Agronomica Sinica, 2026, 52(3): 655-664.
[14] Ma Liang, Ma Lu, Zhang Shu-Yu, Zhang Hui-Min, Wang Ren-Ming, Song Xu-Dong, Zhang Zhen-Liang, Mao Yu-Xiang, Lu Hu-Hua, Chen Guo-Qing, Hao De-Rong, Zhou Guang-Fei. Transcriptome analysis and identification of candidate genes associated with husk number in maize [J]. Acta Agronomica Sinica, 2026, 52(3): 790-801.
[15] Yang Zong-Tao, Yang Ting, Wang Yu-Tong, Ai Jing, Li Yan-Ye, Liu Jia-Yong, Deng Jun, Zhao Yong, Zhang Yue-Bin. Identification and expression analysis of the CLC gene family in sugarcane [J]. Acta Agronomica Sinica, 2026, 52(3): 722-734.
Viewed
Full text


Abstract

Cited

  Shared   
  Discussed   
No Suggested Reading articles found!