Welcome to Acta Agronomica Sinica,

Acta Agronomica Sinica ›› 2020, Vol. 46 ›› Issue (12): 1831-1838.doi: 10.3724/SP.J.1006.2020.03017

• CROP GENETICS & BREEDING · GERMPLASM RESOURCES · MOLECULAR GENETICS • Previous Articles     Next Articles

Phenotypic analysis and fine mapping of dek101 in maize

Xin-Ran SONG1(), Shu-Ting HU2(), Kai ZHANG2, Ze-Jin CUI2, Jian-Sheng LI2, Xiao-Hong YANG2, Guang-Hong BAI1,*()   

  1. 1Xinjiang Agricultural University, Urumqi 830052, Xinjiang, China
    2National Maize Improvement Center of China / Key Laboratory of Maize Biology of Ministry of Agriculture and Rural Affairs / China Agricultural University, Beijing 100193, China
  • Received:2020-03-17 Accepted:2020-07-02 Online:2020-12-12 Published:2020-11-25
  • Contact: Guang-Hong BAI E-mail:songxinran916@163.com;hushutingcau@163.com;bgh601@126.com
  • Supported by:
    National Natural Science Foundation of China(31421005)

Abstract:

As the storage organ of maize, kernel development and accumulation of storage production directly determines maize yield and quality. In this study, a stable defective kernel mutant, named as defective kernel 101 (dek101), was identified during the development of double haploid (DH) lines in maize. The dek101 kernels displayed severely shrunk kernel appearance, significantly reduced kernel weight, lethal embryo, defective endosperm and were incapable of germinating. The dek101 showed obvious developmental abnormalities at 12 days after pollination (DAP). The fresh weight, dry weight and volume of the kernels were no longer increased after 21 DAP. Scanning electron microscopy (SEM) observation revealed that the starch granules of dek101 were significantly smaller compared with wild-type kernels. Genetic analysis demonstrated that the mutant trait was controlled by a recessive single gene. Using 441 F2 individuals and 1648 F3 individuals, dek101 was narrowed down to a genomic region of about 300 kb between the InDel marker IDP2182 and IDP4600 on chromosome 1, which contains five predicted genes. These results laid the foundation for mining functional genes related to maize kernel development and deciphering the mechanism of grain development.

Key words: maize, defective-kernel mutant, fine mapping

Table 1

Polymorphic primers between parents"

引物
Primer
位置
Location (Mb)
序列
Primer sequence (5′-3′)
产物
Product (bp)
IDP112 42.1 F: AGGAAGCTGTATCCCACACG; R: TCATGGGTTTCTTCTTTGCG 624
IDP8266 43.3 F: GTTGTTGTGCTCCAGAGAAGG; R: TACGTTGCCTATCATTGCCC 369
IDP101 45.1 F: CTATCCCGTTCGTGTTCA; R: CCCTGCGTTGTCTTTCTC 261
IDP643 46.2 F: ACCCTCATCTTCAGCAGTCG; R: GGTGAAACGGCAGTACAAGG 838
IDP2182 47.1 F: GGAATGTGTACACGGCAGGT; R: ACAGCAATCGGAGCAGTGTT 225
IDP4600 47.4 F: CACTTCGACGAGGGGTTCAT; R: GTAACCACCTACCCACAA 263
IDP8401 49.3 F: TAGGCACTGTTTGTTTCA; R: CTAGGGTTATGTGGCATT 324
IDP78 49.3 F: CGGTTGTGACTGCTATGT; R: TGTGGCATTTATTGTTCAT 342

Fig. 1

Overview of the kernel development dynamics and comparison between wild-type and mutant kernels in different days after pollination A: Ear performance of heterozygous plants; B: Comparison of dek101 and wild-type kernels at 30 days after pollination; C: Developmental dynamics of wild-type and mutant kernels in different time series; D-E: Dynamics changes in dry weight, fresh weight of 50 wild-type and dek101 kernels at different stages. F: Dynamics changes in volume of 20 wild-type and dek101 kernels at different stages. WT: wild type; dek101: mutant. Bar in A-C: 1 cm. **, indicates extremely significant difference of expression in specific tissues between dek101 and WT (P < 0.01). DAP: days after pollination."

Fig. 2

SEM observation of the starch granule between WT and dek101 kernels A-C: SEM observation of wild-type kernel of 15, 21, and 27 DAP; D-F: SEM observation of mutant type kernel of 15, 21, and 27 DAP. Bar = 5 μm."

Table 2

Segregation ratio of mutant kernels in four F2 ears"

果穗
Ear
野生型籽粒数
Wild-type
突变型籽粒数
Mutant
χ2
1 268 86 0.06
2 292 103 0.19
3 252 85 0.001
4 241 80 0.001
总计Total 1053 354 0.019

Fig. 3

Fine mapping of dek101 n: individuals of F2 and recombinant-derived F3 population; the black vertical lines represent primary physical distance; the red numbers under InDel markers represent recombination events; the rectangular boxes represent the genotypes and phenotypes of five recombinants; the black and gray rectangles represent B73 and heterozygous genotypes, respectively."

Table 3

Candidate genes annotation in the location interval"

基因位点
Gene locus
基因注释
Gene annotation
染色体
Chr.
Zm00001d028813 Transducin family protein/WD-40 repeat family protein Chr.1
Zm00001d028814 Pathogenesis-related protein 10 Chr.1
Zm00001d028815 Pathogenesis-related protein 10 Chr.1
Zm00001d028816 Pathogenesis-related protein 10 Chr.1
Zm00001d028818 Calpain-type cysteine protease DEK1 Chr.1

Fig. 4

Relative expression levels of five predicted genes in different tissues of maize inbred line B73SAM: shoot apical meristem."

[1] Rossi V, Hartings H, Thompson R, Mario M . Genetic and molecular approaches for upgrading starch and protein fractions in maize kernels. Maydica, 2001,46:147-158.
[2] Shannon J C, Pien F M, Cao H, Liu K C . Brittle-1, an adenylate translocator, facilitates transfer of extraplastidial synthesized ADP-Glucose into amyloplasts of maize endosperms. Plant Physiol, 1998,117:1235-1252.
doi: 10.1104/pp.117.4.1235 pmid: 9701580
[3] Dickinson D B, Preiss J . Presence of ADP-Glucose pyrophosphorylase in shrunken-2 and brittle-2 mutants of maize endosperm. Plant Physiol, 1969,44:1058-1062.
doi: 10.1104/pp.44.7.1058 pmid: 16657157
[4] Zhang X L, Colleoni C, Ratushna V, Colleoni M S, Martha J, Myers A . Molecular characterization demonstrates that the Zea mays gene sugary2 codes for the starch synthase isoform SSIIa. Plant Mol Biol, 2004,54:865-879.
doi: 10.1007/s11103-004-0312-1
[5] Wang Y J, White P, Pollak L, Jane J L . Characterization of starch structure of 17 maize endosperm mutant genotypes with Oh43 inbred line background. Cereal Chem, 1993,70:171-179.
[6] Shure M, Wessler S, Fedoroff N . Molecular identification and isolation of the waxy locus in maize. Cell, 1983,35:225-233.
doi: 10.1016/0092-8674(83)90225-8 pmid: 6313224
[7] Fu S N, Meeley R, Scanlon M J . Empty pericarp2 encodes a negative regulator of the heat shock response and is required for maize embryogenesis. Plant Cell, 2002,14:3119-3132.
doi: 10.1105/tpc.006726 pmid: 12468731
[8] Jose F, Gutierrez M, Mauro D P . Empty pericarp4 encodes a mitochondrion-targeted Pentatricopeptide repeat protein necessary for seed development and plant growth in maize. Plant Cell, 2007,19:196-210.
doi: 10.1105/tpc.105.039594 pmid: 17259266
[9] He Y H, Wang J G, Qi W W, Song R T . Maize dek15 encodes the cohesin-loading complex subunit SCC4 and is essential for chromosome segregation and kernel development. Plant Cell, 2019,31:465-485.
doi: 10.1105/tpc.18.00921 pmid: 30705131
[10] Garcia N, Li Y B, Dooner H K, Messing J . Maize defective kernel mutant generated by insertion of a Ds element in a gene encoding a highly conserved TTI2 cochaperone. Proc Natl Acad Sci USA, 2017,114:5165-5170.
doi: 10.1073/pnas.1703498114 pmid: 28461460
[11] Qi W W, Lu L, Huang S C, Song R T . Maize dek44 encodes mitochondrial ribosomal protein L9 and is required for seed development. Plant Physiol, 2019,180:2106-2119.
doi: 10.1104/pp.19.00546 pmid: 31182559
[12] Shen Y, Li C L, McCarty D R, Meeley R, Bao C T . Embryo defective 12 encodes the plastid initiation factor 3 and is essential for embryogenesis in maize. Plant J, 2013,74:792-804.
doi: 10.1111/tpj.12161
[13] Li C, Shen Y, Meeley R, McCarty D R, Bao C T . Embryo defective 14 encodes a plastid-targeted cGTPase essential for embryogenesis in maize. Plant J, 2015,84:785-799.
doi: 10.1111/tpj.13045 pmid: 26771182
[14] Mertz ET, Bates L S, Nelson O E . Mutant gene that changes protein composition and increases lysine content of maize endosperm. Science, 1964,145:279-280.
doi: 10.1126/science.145.3629.279 pmid: 14171571
[15] Ueda T, Waverczak W, Ward K, Sher K, Ketuda M, Schmidt R J, Messing J . Mutations of the 22- and 27-kD zein promoters affect transactivation by the Opaque-2 protein. Plant Cell, 1992,4:701-709.
doi: 10.1105/tpc.4.6.701 pmid: 1392591
[16] Coleman C E, Larkins B A . The Prolamins of Maize. Seed Proteins. Springer Netherlands, 1999. pp 109-139.
[17] Nelson O E, Mertz E T, Bates L S . Second mutant gene affecting the amino acid pattern of maize. Endosperm Proteins, 1966,150:1469-1470.
[18] Huang Y C, Wang H H, Huang X, Wang Q, Wang C J, An D, Li J Q, Wang W Q, Wu Y R . Maize VKS1 regulates mitosis and cytokinesis during early endosperm development. Plant Cell, 2019,31:1238-1256.
doi: 10.1105/tpc.18.00966 pmid: 30962394
[19] Zheng X X, Li Q, Li C S, An D, Xiao Q, Wang W Q, Wu Y R . Intra-kernel reallocation of proteins in maize depends on VP1-mediated scutellum development and nutrient assimilation. Plant Cell, 2019,31:2613-2635.
doi: 10.1105/tpc.19.00444 pmid: 31530735
[20] Chen J, Zeng B, Zhang M, Xie S J, Wang G K, Hauck A, Lai J S . Dynamic transcriptome landscape of maize embryo and endosperm development. Plant Physiol, 2014,166:252-264.
doi: 10.1104/pp.114.240689
[21] Chourey P S, Nelson O E . The enzymatic deficiency conditioned by the shrunken-1, mutations in maize. Biochem Genet, 1976,14:1041-1055.
doi: 10.1007/BF00485135 pmid: 1016220
[22] Hannah L C, Jr O E N . Characterization of ADP-glucose pyrophosphorylase from shrunken-2, and brittle-2, mutants of maize. Biochemical Genet, 1976,14:547-560.
doi: 10.1007/BF00485834
[23] Gao M, Wanat J, Stinard P S, James M G, Myers A M . Characterization of dull1, a maize gene coding for a novel starch synthase. Plant Cell, 1998,10:399-412.
doi: 10.1105/tpc.10.3.399 pmid: 9501113
[24] Magnard J L, Heckel T, Massonneau A, Wisniewski J P, Cordelier S, Lassagne H, Perez P, Dumas C, Rogowsky P M . Morphogenesis of maize embryos requires ZmPRPL35-1 encoding a plastid ribosomal protein. Plant Physiol, 2004,134:649-663.
doi: 10.1104/pp.103.030767 pmid: 14730079
[25] Qi W, Tian Z, Lu L, Chen X, Chen X, Zhang W, Song R T . Editing of mitochondrial transcripts nad3 and cox2 by dek10 is essential for mitochondrial function and maize plant development. Genetics, 2017,205:1489-1501.
doi: 10.1534/genetics.116.199331 pmid: 28213476
[26] Chen X, Feng F, Qi W, Xu L, Yao D, Wang Q, Song R T . Dek35 encodes a PPR protein that affects cis-splicing of mitochondrial nad4 intron 1 and seed development in maize. Mol Plant, 2017,10:427-441.
doi: 10.1016/j.molp.2016.08.008 pmid: 27596292
[27] Wang G, Zhong M, Shuai B, Song J, Zhang J, Han L, Ling H, Tang Y, Wang G, Song R T . E+ subgroup PPR protein defective kernel 36 is required for multiple mitochondrial transcripts editing and seed development in maize and Arabidopsis. New Phytol, 2017,214:1563-1578.
doi: 10.1111/nph.14507 pmid: 28277611
[28] Dai D, Luan S, Chen X, Wang Q, Feng Y, Zhu C, Qi W, Song R T . Maize dek37 encodes a P-type PPR protein that affects cis-splicing of mitochondrial nad2 intron 1 and seed development. Genetics, 2018,208:1069-1082.
doi: 10.1534/genetics.117.300602 pmid: 29301905
[29] Li X, Gu W, Sun S, Chen Z, Chen J, Song W, Zhao H, Lai J . Defective kernel 39 encodes a PPR protein required for seed development in maize. J Integr Plant Biol, 2018,60:45-64.
doi: 10.1111/jipb.12602
[30] Ren R C, Lu X, Zhao Y J, Wei Y M, Wang L L, Zhang L, Zhang W T, Zhang C, Zhang X S, Zhao X Y . Pentatricopeptide repeat protein DEK40 is required for mitochondrial function and kernel development in maize. J Exp Bot, 2019,70:6163-6179.
doi: 10.1093/jxb/erz391 pmid: 31598687
[31] Zuo Y, Feng F, Qi W W, Song R T . Dek42 encodes an RNA-binding protein that affects alternative pre-mRNA splicing and maize kernel development. J Integr Plant Biol, 2019,61:728-748.
doi: 10.1111/jipb.12798
[32] Stein E L, Darren G, Rudolf J, Jennifer A L, Evgueni A, Mark C, Niu X M, Meeley R, Nichols S, Olsen O A . The defective kernel 1 (dek 1) gene required for aleurone cell development in the endosperm of maize grains encodes a membrane protein of the calpain gene superfamily. Proc Natl Acad Sci USA, 2002,99:5460-5465.
doi: 10.1073/pnas.042098799 pmid: 11929961
[33] Zhu C, Jin G, Fang P, Zhang Y, Feng X, Tang Y, Qi W W, Song R T . Maize Pentatricopeptide repeat protein DEK41 affects cis-splicing of mitochondrial nad4 intron 3 and is required for normal seed development. J Exp Bot, 2019,70:3795-3808.
doi: 10.1093/jxb/erz193 pmid: 31020318
[34] Yi G, Lauter A M, Scott P, Becraft P W . The thick aleurone1 mutant defines a negative regulation of maize aleurone cell fate that functions downstream of defective kernel 1. Plant Physiol, 2011,156:1826-1836.
doi: 10.1104/pp.111.177725
[35] Xu C, Min J R . Structure and function of WD40 domain proteins. Protein Cell, 2011,2:202-214.
doi: 10.1007/s13238-011-1018-1
[36] Xie Y R, Chen Z Y, Brown R L, Bhatnagar D . Expression and functional characterization of two pathogenesis-related protein 10 genes from Zea mays. J Plant Physiol, 2010,167:121-130.
doi: 10.1016/j.jplph.2009.07.004 pmid: 19682768
[1] Liang Jin-Yu, Yin Jia-De, Wang Hong-Li, Zhang Guo-Ping, Hou Hui-Zhi, Dong Bo, Ma Ming-Sheng. Estimation of leaf nitrogen content in dryland forage maize using UAV-based hyperspectral imaging and machine learning [J]. Acta Agronomica Sinica, 2026, 52(6): 1788-1801.
[2] Yang Yang, Chang Shi-Hui, Tian Hong-Li, Yi Hong-Mei, Wang Lu, Ren Jie, Fan Ya-Ming, Liu Ya-Wei, Wang Feng-Ge, Zhao Jiu-Ran. Genetic diversity analysis of nationally approved maize varieties in different ecological regions [J]. Acta Agronomica Sinica, 2026, 52(5): 1352-1364.
[3] Yang Xin-Yu, Cui Wen-Tao, Dilinigeer Alimu, Wang Kai-Xiang, Wu Peng-Hao, Ren Jiao-Jiao. Genome-wide association and genomic selection analysis of the number of leaves above the ear in maize [J]. Acta Agronomica Sinica, 2026, 52(5): 1573-1590.
[4] Han Ya-Xin, He Guan-Hua, Zhang Xiao-Qiong, Zhang Deng-Feng, Li Yong-Xiang, Liu Xu-Yang, Wang Tian-Yu, Li Yu, Zou Hua-Wen, Li Chun-Hui. Identification of maize lateral root density genes resources through integrated RNA-seq and BSA-seq analyses [J]. Acta Agronomica Sinica, 2026, 52(5): 1341-1352.
[5] Sun Shu-Feng, Xu Zhen-Nan, Huang Jia-Xin, Weng Jian-Feng, Li Xin-Hai. Genome-wide identification of the maize MAPK gene family and its response to Fusarium verticillioides infection [J]. Acta Agronomica Sinica, 2026, 52(5): 1291-1308.
[6] Zhang Ning-Ning, Teng Yu-Fei, Ren Na-Na, Wei Xing-Zhuo, Yan Shu-Hao, Fan Ke-Xin, Wang Yong-Hong, Chen Wen-Kang, Zhang Xing-Hua, Zhu Wan-Chao, Xu Shu-Tu, Xue Ji-Quan. Phenotypic evaluation and plasticity analysis of drought resistance in 201 maize inbred lines [J]. Acta Agronomica Sinica, 2026, 52(5): 1309-1325.
[7] Zhang Hong-Rong, Wang Fei-Er, Li Pan, Qiu Hai-Long, Zhu Jing, Zhao Lian-Hao, Nan Yun-You, He Wei, Fan Zhi-Long, Hu Fa-Long, Chai Qiang, Yin Wen. Photosynthetic characteristics of 20% reduced irrigation combined with 25% organic substitution for chemical fertilizer in increasing silage maize yield [J]. Acta Agronomica Sinica, 2026, 52(5): 1487-1500.
[8] Cai Hong-Wei, Yu Ai-Zhong, Jiang Ke-Qiang, Wang Peng-Fei, Wang Yu-Long, Huo Jian-Zhe, Pang Xiao-Neng, Yin Bo, Shang Yong-Pan. Key mechanisms underlying the enhancement of sweet maize yield through partial substitution of chemical fertilizers with organic manure in arid irrigation districts [J]. Acta Agronomica Sinica, 2026, 52(4): 1166-1180.
[9] Tian Hong-Li, Yang Yang, Fan Ya-Ming, Yi Hong-Mei, Guo Dan-Dan, Wang Feng-Ge, Zhao Jiu-Ran. A novel set of tri-allelic variant SNP loci suitable for maize variety identification [J]. Acta Agronomica Sinica, 2026, 52(4): 993-1005.
[10] Guo Xiang-Yang, Tu Liang, Wang Dong, Liu Peng-Fei, Wang An-Gui, Yi Qiang, Ren Hong, Li Gang, Zhu Yun-Fang, Wu Xun, Jiang Yu-Lin, Tian Feng, Chen Ze-Hui. Application and prospects of Suwan germplasm in maize breeding in China [J]. Acta Agronomica Sinica, 2026, 52(3): 655-664.
[11] Meng Cheng, Wang Zhe. Genome-wide identification and expression analysis of the ZmPFK gene family under biotic and abiotic stresses in maize [J]. Acta Agronomica Sinica, 2026, 52(3): 764-779.
[12] Li Xin-Hao, Xing Meng-Ke, Zhou Zi-Hui, Li Si-Ye, Ren Hao, Wang Hong-Zhang, Lai Hua-Jiang. Exogenous melatonin enhances heat tolerance of maize at the seedling stage by coordinating light and dark reactions [J]. Acta Agronomica Sinica, 2026, 52(3): 839-856.
[13] Ma Liang, Ma Lu, Zhang Shu-Yu, Zhang Hui-Min, Wang Ren-Ming, Song Xu-Dong, Zhang Zhen-Liang, Mao Yu-Xiang, Lu Hu-Hua, Chen Guo-Qing, Hao De-Rong, Zhou Guang-Fei. Transcriptome analysis and identification of candidate genes associated with husk number in maize [J]. Acta Agronomica Sinica, 2026, 52(3): 790-801.
[14] Liu Ji-Chang, Li Si-Ye, Li Xue-Ting, Wang Hong-Zhang, Liu Peng, Zhang Ji-Wang, Zhao Bin, Ren Bai-Zhao, Ren Hao. Effects of salt stress on root growth and nutrient absorption efficiency of different salt-tolerant summer maize varieties [J]. Acta Agronomica Sinica, 2026, 52(2): 565-577.
[15] Lin Zi-Qing, Zhong Xing-Yu, Liu Fan, Ren Zi-Ao, Ma Rui, Deng Xiu-Feng, Wang Dong-Wei, Liu Shao-Peng, Chen Kang, Zhang Ming-Cai, Li Zhao-Hu, Zhou Yu-Yi, Duan Liu-Sheng. Development of ultra-high-yield technology for a wheat-maize double cropping system achieving a 2-ton annual grain yield per mu in the coastal plain of Northern Shandong peninsula, China [J]. Acta Agronomica Sinica, 2026, 52(2): 631-643.
Viewed
Full text


Abstract

Cited

  Shared   
  Discussed   
No Suggested Reading articles found!