Welcome to Acta Agronomica Sinica，

Acta Agronomica Sinica ›› 2023, Vol. 49 ›› Issue (1): 24-35.doi: 10.3724/SP.J.1006.2023.14233

• CROP GENETICS & BREEDING · GERMPLASM RESOURCES · MOLECULAR GENETICS • Previous Articles     Next Articles

Function of GmPIN2 family gene in regulating root development in soybean

LIANG Zheng1,3(), KE Mei-Yu1,3, CHEN Zhi-Wei2, CHEN Xu3,*(), GAO Zhen3,*()   

  1. 1College of Life Science, Fujian Agriculture and Forestry University, Fuzhou 350002, Fujian, China
    2College of Resources and Environment, Fujian Agriculture and Forestry University, Fuzhou 350002, Fujian, China
    3Haixia Institute of Science and Technology, Horticultural Plant Biology and Metabolomics Center, Fujian Agriculture and Forestry University, Fuzhou 350002, Fujian, China
  • Received:2021-12-08 Accepted:2022-05-05 Online:2023-01-12 Published:2022-05-13
  • Contact: CHEN Xu,GAO Zhen E-mail:1879949813@qq.com;chenxu@inbox.com;gaozhen0695@fafu.edu.cn
  • Supported by:
    Distinguished Young Scholar Program of Fujian Agriculture and Forestry University(XJQ201921)

RichHTML406

40

PDF

484

Abstract:

Auxin is one of the important plant hormones. Auxin transport is involved in the regulation of plant tissue and organ development. In Arabidopsis thaliana, auxin transport is mainly regulated by PIN family proteins, among which AtPIN2 controls auxin basipetal transport and regulates root gravitation in Arabidopsis. However, GmPIN2 family proteins and their functions are still largely unknown in soybean. In this study, we identified two AtPIN2 homologous genes of GmPIN2a and GmPIN2b through phylogenetic and protein domain analysis. The relative expression level showed that GmPIN2a and GmPIN2b were highly expressed in root and nodule. Both genes were highly expressed in root epidermis and cortex, and the vascular bundles of the root nodule. Only GmPIN2a expressed in the epidermis and outer cortex at the tip of the root nodule. Furthermore, Gmpin2ab mutants were generated by CRISPR/Cas9 (Clustered Regularly Interspersed Short Palindromic Repeats/CRISPR Associated 9) gene editing technology. Gmpin2ab mutants had a significant loss of root gravitropism. Moreover, the loss of Gmpin2 resulted in a significant decrease of root area and lateral root length, while the lateral root angle of Gmpin2ab significantly increased. Overexpression of GmPIN2b also resulted in a decrease in root area and lateral root length, but the lateral root angle unchanged. In conclusion, GmPIN2a and GmPIN2b play important roles in regulation of soybean root development via mediating auxin basipetal transport. This study laid a foundation for further analysis of the function and mechanism of GmPIN proteins in soybean root morphogenesis.

Key words: Glycine max (soybean), auxin, PIN protein, root

Table 1

Primer sequences"

引物用途
Purpose of primers		 引物名称
Primer name		 引物序列
Primer sequence (5°-3°)
启动子序列扩增引物
Promoter amplification primers		 pGmPIN2a-F AGATGGTTAGAGAGGCATGAGCCACAATGGAAC
pGmPIN2a-R AGCTCTTATACTCGACATGGTTCATGCGGG
pGmPIN2b-F AGATGGTTAGAGAGGTGATGTTCTTGGCCACTG
pGmPIN2b-R AGCTCTTATACTCGAGATCATGGTTAATGCAGGG
定量PCR引物序列
RT-PCR primers		 GmPIN2a-F CCACACGAAACTGTTGCCTC
GmPIN2a-R AAGCTCCCTCTGATCTCCGT
GmPIN2b-F GGGAATTTGAGGCATGCAGT
GmPIN2b-R CAGGCTCCCTCTCTCCACTC
GmActin-11-F GAGCTATGAATTGCCTGATGG
GmActin-11-R CGTTTCATGAATTCCAGTAGC
sgRNA序列 sgRNA sequence sgRNA-GmPIN2ab TGGAACACCTTCACAAAACATGG
验证编辑载体的引物序列
Primer sequence for verifying the gene editing vectors		 pCas9-F GCCAAGAGCGAGCAGGAAAT
pCas9-R GGTGGATGATATTCTCGGCCT

Fig. 1

Phylogenetic tree of GmPIN and AtPIN proteins The red box represents soybean GmPIN2 and Arabidopsis AtPIN2."

Fig. 2

Bioinformatics analysis of PIN2 protein families in Arabidopsis thaliana, Glycine max, Medicago truncatula, Lotus japonicus, Oryza sativa, and Zea mays A: gene structure of the PIN2 protein family in Arabidopsis thaliana, Glycine max, Medicago truncatula, Lotus japonicus, Oryza sativa, and Zea mays. B: analysis of gene promoter regions of the PIN2 protein family in Arabidopsis thaliana, Glycine max, Medicago truncatula, Lotus japonicus, Oryza sativa, and Zea mays. C: protein sequence alignment of the PIN2 protein family in Arabidopsis thaliana, Glycine max, Medicago truncatula, Lotus japonicus, Oryza sativa, and Zea mays. AT5G57090: AtPIN2; Glyma.13G101900: GmPIN2a; Glyma.17G057300: GmPIN2b; LOC_Os06g44970: OsPIN2; Medtr4g127100: MtPIN2a; Medtr4g127090: MtPIN2b; Lj4g3v2139970: LjPIN2; Zm00001d046893_ P001: ZmPIN2."

Table 2

Homology comparison of PIN2 protein families in Arabidopsis thaliana, Glycine max, Medicago truncatula, Lotus japonicus, Oryza sativa, and Zea mays (%)"

Seq-> AtPIN2 GmPIN2a GmPIN2b OsPIN2 MtPIN2a MtPIN2b LjPIN2 ZmPIN2
AtPIN2 100.0 76.5 77.2 61.7 75.0 63.7 76.5 61.0
GmPIN2a 76.5 100.0 96.8 63.9 85.1 68.3 90.7 61.9
GmPIN2b 77.2 96.8 100.0 63.5 85.5 68.8 90.8 61.9
OsPIN2 61.7 63.9 63.5 100.0 63.8 53.8 63.4 87.3
MtPIN2a 75.0 85.1 85.5 63.8 100.0 75.4 85.0 63.6
MtPIN2b 63.7 68.3 68.8 53.8 75.4 100.0 68.8 53.4
LjPIN2 76.5 90.7 90.8 63.4 85.0 68.8 100.0 61.7
ZmPIN2 61.0 61.9 61.9 87.3 63.6 53.4 61.7 100.0

Fig. 3

Tissue expression pattern analysis and histochemical localization of GmPIN2a and GmPIN2b genes A: the relative expression pattern of GmPIN2a and GmPIN2b genes; B: histochemical localization of GmPIN2a and GmPIN2b in root and nodule. Bars: 100 μm."

Fig. 4

Construction of homozygous mutants of Gmpin2ab-#1 and Gmpin2ab-#2 A: the gene structure of GmPIN2a and GmPIN2b and target sites of designed sgRNAs. The black arrow represents the sgRNA position, black boxes represent exons, red boxes represent 5′UTR and 3′UTR and black lines represent introns. B: the validation of gene editing vectors in Gmpin2ab-L1 and Gmpin2ab-L2. White numbers from left to right indicate the wild type, 35S::GmPIN2b, Gmpin2ab-L1, and Gmpin2ab-L2. C: the relative expression level of GmPIN2 family in wild type, 35S::GmPIN2b, Gmpin2ab-L1, and Gmpin2ab-L2. P-values are determined by a two-tailed Student’s t-test assuming equal variances, ** indicates that Gmpin2ab-L1, Gmpin2ab-L2 significantly different from wild type at P < 0.01; *** indicates that 35S::GmPIN2b significantly different from wild type at P < 0.001; **** indicates that Gmpin2ab-L1, Gmpin2ab-L2 significantly different from wild type at P < 0.0001. ns: not significant. D: the sequence alignment of Gmpin2ab-#1 and Gmpin2ab-#2. Green letters represent sgRNA targeting sequences; red letters and red dash lines represent added or missing codons. E: the protein sequence of WT, Gmpin2ab-#1 and Gmpin2ab-#2 homogenous mutants. AA represents amino acid. The black arrow represents the positions of frameshift mutations. The purple box represents the frame-shifting mutant protein sequence. The number represents the number of frameshift amino acids."

Fig. 5

Plant phenotype of wild type, Gmpin2ab-L1, Gmpin2ab-L2, and 35S::GmPIN2b A: Gmpin2ab-L1 and Gmpin2ab-L2 are defective in root gravitropism. The red box indicates that the mutant is growing toward the ground. B: the scanning pattern of seven-day wild-type, Gmpin2ab-L1, Gmpin2ab-L2, and 35S::GmPIN2b, Bars: 1 cm. P-values are determined by a two-tailed Student’s t-test assuming equal variances, **** indicates P < 0.0001. ns: not significant. n = 7."

[1] Peer W A, Blakeslee J J, Yang H, Murphy A S. Seven things we think we know about auxin transport. Mol Plant, 2011, 4: 487-504.
doi: 10.1093/mp/ssr034 pmid: 21505044
[2] Friml J, Palme K. Polar auxin transport—old questions and new concepts? Plant Mol Biol, 2002, 49: 273-284.
doi: 10.1023/A:1015248926412
[3] Ljung K, Ostin A, Lioussanne L, Sandberg G. Developmental regulation of indole-3-acetic acid turnover in Scots pine seedlings. Plant Physiol, 2001, 125: 464-475.
pmid: 11154354
[4] Balzan S, Johal G S, Carraro N. The role of auxin transporters in monocots development. Front Plant Sci, 2014, 5: 393.
doi: 10.3389/fpls.2014.00393 pmid: 25177324
[5] Krecek P, Skupa P, Libus J, Naramoto S, Tejos R, Friml J, Zazímalová E. The PIN-FORMED (PIN) protein family of auxin transporters. Genome Biol, 2009, 10: 249.
doi: 10.1186/gb-2009-10-12-249 pmid: 20053306
[6] Bohn-Courseau I. Auxin: a major regulator of organogenesis. C R Biol, 2010, 333: 290-296.
doi: 10.1016/j.crvi.2010.01.004
[7] Saini S, Sharma I, Kaur N, Pati P K. Auxin: a master regulator in plant root development. Plant Cell Rep, 2013, 32: 741-757.
doi: 10.1007/s00299-013-1430-5 pmid: 23553556
[8] Overvoorde P, Fukaki H, Beeckman T. Auxin control of root development. Cold Spring Harb Perspect Biol, 2010, 2: a001537.
[9] Olatunji D, Geelen D, Verstraeten I. Control of endogenous auxin levels in plant root development. Int J Mol Sci, 2017, 18: 2587.
doi: 10.3390/ijms18122587
[10] Blilou I, Xu J, Wildwater M, Willemsen V, Paponov I, Friml J, Heidstra R, Aida M, Palme K, Scheres B. The PIN auxin efflux facilitator network controls growth and patterning in Arabidopsis roots. Nature, 2005, 433: 39-44.
doi: 10.1038/nature03184
[11] Benková E, Michniewicz M, Sauer M, Teichmann T, Seifertová D, Jürgens G, Friml J. Local, efflux-dependent auxin gradients as a common module for plant organ formation. Cell, 2003, 115: 591-602.
pmid: 14651850
[12] Wang H Z, Yang K Z, Zou J J, Zhu L L, Xie Z D, Morita M T, Tasaka M, Friml J, Grotewold E, Beeckman T, Vanneste S, Sack F, Le J. Transcriptional regulation of PIN genes by FOUR LIPS and MYB88 during Arabidopsis root gravitropism. Nat Commun, 2015, 6: 8822.
doi: 10.1038/ncomms9822
[13] Gao Z, Chen Z, Cui Y, Ke M, Xu H, Xu Q, Chen J, Li Y, Huang L, Zhao H, Huang D, Mai S, Xu T, Liu X, Li S, Guan Y, Yang W, Friml J, Petrášek J, Zhang J, Chen X. GmPIN-dependent polar auxin transport is involved in soybean nodule development. Plant Cell, 2021, 33: 2981-3003.
doi: 10.1093/plcell/koab183
[14] Sańko-Sawczenko I, Łotocka B, Czarnocka W. Expression analysis of PIN genes in root tips and nodules of Medicago truncatula. Int J Mol Sci, 2016, 17: 1197.
doi: 10.3390/ijms17081197
[15] Kohlen W, Ng J L P, Deinum E E, Mathesius U. Auxin transport, metabolism, and signaling during nodule initiation: indeterminate and determinate nodules. J Exp Bot, 2018, 69: 229-244.
doi: 10.1093/jxb/erx308
[16] Plet J, Wasson A, Ariel F, Le Signor C, Baker D, Mathesius U, Crespi M, Frugier F. MtCRE1-dependent cytokinin signaling integrates bacterial and plant cues to coordinate symbiotic nodule organogenesis in Medicago truncatula. Plant J, 2011, 65: 622-633.
doi: 10.1111/j.1365-313X.2010.04447.x
[17] Huo X, Schnabel E, Hughes K, Frugoli J. RNAi phenotypes and the localization of a protein::GUS fusion imply a role for Medicago truncatula PIN genes in nodulation. J Plant Growth Regul, 2006, 25: 156-165.
doi: 10.1007/s00344-005-0106-y
[18] Sańko-Sawczenko I, Dmitruk D, Łotocka B, Różańska E, Czarnocka W. Expression analysis of PIN genes in root tips and nodules of Lotus japonicus. Int J Mol Sci, 2019, 20: 235.
doi: 10.3390/ijms20020235
[19] Xu M, Zhu L, Shou H, Wu P. A PIN1 family gene, OsPIN1, involved in auxin-dependent adventitious root emergence and tillering in rice. Plant Cell Physiol, 2005, 46: 1674-1681.
doi: 10.1093/pcp/pci183
[20] Li Y, Zhu J, Wu L, Shao Y, Wu Y, Mao C. Functional divergence of PIN1 paralogous genes in rice. Plant Cell Physiol, 2019, 60: 2720-2732.
doi: 10.1093/pcp/pcz159
[21] Li Z, Zhang X, Zhao Y, Li Y, Zhang G, Peng Z, Zhang J. Enhancing auxin accumulation in maize root tips improves root growth and dwarfs plant height. Plant Biotechnol J, 2018, 16: 86-99.
doi: 10.1111/pbi.12751 pmid: 28499064
[22] 郭安源, 朱其慧, 陈新, 罗静初. GSDS: 基因结构显示系统. 遗传, 2007, 29: 1023-1026.
Guo A Y, Zhu Q H, Chen X, Luo J C. GSDS: a gene structure display server. Hereditas, 2007, 29: 1023-1026. (in Chinese with English abstract)
[23] Chen C, Chen H, Zhang Y, Thomas H R, Frank M H, He Y, Xia R. TBtools: an integrative toolkit developed for interactive analyses of big biological data. Mol Plant, 2020, 13: 1194-1202.
doi: S1674-2052(20)30187-8 pmid: 32585190
[24] Xie X, Ma X, Zhu Q, Zeng D, Li G, Liu Y G. CRISPR-GE: a convenient software toolkit for CRISPR-based genome editing. Mol Plant, 2017, 10: 1246-1249.
doi: 10.1016/j.molp.2017.06.004
[25] Bai M, Yuan J, Kuang H, Gong P, Li S, Zhang Z, Liu B, Sun J, Yang M, Yang L, Wang D, Song S, Guan Y. Generation of a multiplex mutagenesis population via pooled CRISPR-Cas9 in soya bean. Plant Biotechnol J, 2020, 18: 721-731.
doi: 10.1111/pbi.13239
[26] Luschnig C, Gaxiola R A, Grisafi P, Fink G R. EIR1, a root-specific protein involved in auxin transport, is required for gravitropism in Arabidopsis thaliana. Genes Dev, 1998, 12: 2175-2187.
doi: 10.1101/gad.12.14.2175
[27] Motte H, Vanneste S, Beeckman T. Molecular and environmental regulation of root development. Annu Rev Plant Biol, 2019, 70: 465-488.
doi: 10.1146/annurev-arplant-050718-100423 pmid: 30822115
[28] Raven J A, Edwards D. Roots: evolutionary origins and biogeochemical significance. J Exp Bot, 2001, 52: 381-401.
pmid: 11326045
[29] Pires N D, Dolan L. Morphological evolution in land plants: new designs with old genes. Philosoph Trans RSB, 2012, 367: 508-518.
[30] Dubrovsky J G, Sauer M, Napsucialy-Mendivil S, Ivanchenko M G, Friml J, Shishkova S, Celenza J, Benková E. Auxin acts as a local morphogenetic trigger to specify lateral root founder cells. Proc Natl Acad Sci USA, 2008, 105: 8790-8794.
doi: 10.1073/pnas.0712307105
[31] Krupinski P, Jönsson H. Modeling auxin-regulated development. Cold Spring Harb Perspect Biol, 2010, 2: a001560.
[32] Qin H, He L, Huang R. The coordination of ethylene and other hormones in primary root development. Front Plant Sci, 2019, 10: 874.
doi: 10.3389/fpls.2019.00874 pmid: 31354757
[33] Du Y, Scheres B. Lateral root formation and the multiple roles of auxin. J Exp Bot, 2018, 69: 155-167.
doi: 10.1093/jxb/erx223 pmid: 28992266
[34] Retzer K, Weckwerth W. The TOR-auxin connection upstream of root hair growth. Plants, 2021, 10: 150.
doi: 10.3390/plants10010150
[35] Konstantinova N, Korbei B, Luschnig C. Auxin and root gravitropism: addressing basic cellular processes by exploiting a defined growth response. Int J Mol Sci, 2021, 22: 2749.
doi: 10.3390/ijms22052749
[36] Ng J L P, Welvaert A, Wen J, Chen R, Mathesius U. The Medicago truncatula PIN2 auxin transporter mediates basipetal auxin transport but is not necessary for nodulation. J Exp Bot, 2020, 71: 1562-1573.
doi: 10.1093/jxb/erz510
[37] Inahashi H, Shelley I J, Yamauchi T, Nishiuchi S, Takahashi- Nosaka M, Matsunami M, Ogawa A, Noda Y, Inukai Y. OsPIN2, which encodes a member of the auxin efflux carrier proteins, is involved in root elongation growth and lateral root formation patterns via the regulation of auxin distribution in rice. Physiol Plant, 2018, 164: 216-225.
doi: 10.1111/ppl.12707 pmid: 29446441
[38] Chen Y, Fan X, Song W, Zhang Y, Xu G. Over-expression of OsPIN2 leads to increased tiller numbers, angle and shorter plant height through suppression of OsLAZY1. Plant Biotechnol J, 2012, 10: 139-149.
doi: 10.1111/j.1467-7652.2011.00637.x
[39] Lin D L, Yao H Y, Jia L H, Tan J F, Xu Z H, Zheng W M, Xue H W. Phospholipase D-derived phosphatidic acid promotes root hair development under phosphorus deficiency by suppressing vacuolar degradation of PIN-FORMED2. New Phytol, 2020, 226: 142-155.
doi: 10.1111/nph.16330
[40] Vega A, Fredes I, O’Brien J, Shen Z, Ötvös K, Abualia R, Benkova E, Briggs S P, Gutiérrez R A. Nitrate triggered phosphoproteome changes and a PIN2 phosphosite modulating root system architecture. EMBO Rep, 2021, 22: e51813.
[41] Chai S, Li E, Zhang Y, Li S. NRT1.1-Mediated nitrate suppression of root coiling relies on PIN2- and AUX1-mediated auxin transport. Front Plant Sci, 2020, 11: 671.
doi: 10.3389/fpls.2020.00671 pmid: 32582237
[42] Zou N, Li B, Chen H, Su Y, Kronzucker H J, Xiong L, Baluška F, Shi W. GSA-1/ARG1 protects root gravitropism in Arabidopsis under ammonium stress. New Phytol, 2013, 200: 97-111.
doi: 10.1111/nph.12365 pmid: 23782229
[1] Chen Xue-Yan, He Hua-Chuan, Li Zheng-Jia, Dong Xin-Pan, Li Ou-Qi, Liu Xiao-Yun, Li Dan-Ping, Chen Zhi-Wei, Liu Guo-Xia, Lyu Sheng-Yuan, Wu Yin-Ying, Zhao Zhen-Dong, Cao Xin-You, Wan He-Ping. Dynamic changes in root organic acid secretion and its transcriptional regulatory mechanisms in ‘Jimai 60’ seedlings under combined salinity-alkalinity stress in hydroponics [J]. Acta Agronomica Sinica, 2026, 52(6): 1859-1875.
[2] Zou Yi-Mei, Xu Min, Wang Hai-Yang, Yao Hui, Wang Jia-Feng, Liu Hao, Ren Dai-Sheng. Analysis of transcription factor regulatory networks in two-line male sterile rice seedling roots in response to salt stress [J]. Acta Agronomica Sinica, 2026, 52(6): 1728-1742.
[3] Zhang Xi, Wang Guang-En, Li Shao-Qi, Liu Yi, Li Jun-Lan, Qian Yu-Yuan. Transcriptome sequencing-based analysis on the formation mechanism of fiber micronaire differences between two sister lines derived from Gossypium hirsutum-G. barbadense hybrid [J]. Acta Agronomica Sinica, 2026, 52(5): 1442-1458.
[4] Han Ya-Xin, He Guan-Hua, Zhang Xiao-Qiong, Zhang Deng-Feng, Li Yong-Xiang, Liu Xu-Yang, Wang Tian-Yu, Li Yu, Zou Hua-Wen, Li Chun-Hui. Identification of maize lateral root density genes resources through integrated RNA-seq and BSA-seq analyses [J]. Acta Agronomica Sinica, 2026, 52(5): 1341-1352.
[5] Guo Xing-Yu, Hu Dan, Lin Su-Qi, Wang Meng-Kai, Tan Wen-Feng, Huang Chuan-Qin. Biochar combined with chemical fertilizer increases maize yield and soil ecosystem multifunctionality in an intercropped maize-soybean [J]. Acta Agronomica Sinica, 2026, 52(5): 1536-1547.
[6] Shi Shao-Jie, Liu Kai, Chen Zi-Yi, Wang Hui-Ying, Li San-He, Zhou Lei, You Ai-Qing. Cloning and functional analysis of the dwarf and multi-tiller gene DMT1 in rice [J]. Acta Agronomica Sinica, 2026, 52(4): 1022-1034.
[7] Yang Ya-Li, Xu Ming-Rui, Ma Yue-Fei, Hai Yi-Rui, Liu Kai-Dong, Liu Wan-Mao, Sun Ying. Comparative transcriptome analysis of maize root tips and whole roots in response to iron deficiency [J]. Acta Agronomica Sinica, 2026, 52(4): 1006-1021.
[8] Liu Ji-Chang, Li Si-Ye, Li Xue-Ting, Wang Hong-Zhang, Liu Peng, Zhang Ji-Wang, Zhao Bin, Ren Bai-Zhao, Ren Hao. Effects of salt stress on root growth and nutrient absorption efficiency of different salt-tolerant summer maize varieties [J]. Acta Agronomica Sinica, 2026, 52(2): 565-577.
[9] LI Yun-Xiang, GUO Qian-Qian, HOU Wan-Wei, ZHANG Xiao-Juan. Genome-wide association analysis of drought resistance traits in wheat seedlings introduced from ICARDA [J]. Acta Agronomica Sinica, 2025, 51(9): 2387-2398.
[10] CAI Jin-Shan, LI Chao-Nan, WANG Jing-Yi, LI Ning, LIU Yu-Ping, JING Rui-Lian, LI Long, SUN Dai-Zhen. Genome-wide association study of root traits in wheat seedlings and identification of a superior allele at TaSRL-3B [J]. Acta Agronomica Sinica, 2025, 51(8): 2020-2032.
[11] LEI Song-Han, FAN Jun-Yang, CHE Yan-Yi, DAI Yong-Dong, ZHENG Yu-Meng, TIAN Wei-Jiang, SANG Xian-Chun, WANG Xiao-Wen. Identification of an adaxially-curled-leaf mutant acl3 and function analysis of the regulated gene in rice (Oryza sativa L.) [J]. Acta Agronomica Sinica, 2025, 51(6): 1467-1479.
[12] ZHANG Shi-Bo, LI Hong-Yan, LI Pei-Fu, REN Rui-Hua, LU Hai-Dong. Effects of a 3-4℃ increase in air temperature under natural conditions on root-shoot senescence and yield in plastic-film mulched maize [J]. Acta Agronomica Sinica, 2025, 51(6): 1599-1617.
[13] HUANG Meng-Xin, ZHUANG Ling-Ling, CHENG Pei-Pei, LI Qin, XU Jian-Tang, TAO Ai-Fen, FANG Ping-Ping, QI Jian-Min, ZHANG Li-Wu. Cloning and transcriptional activity analysis of U6 promoter in jute (Corchorus capsularis) [J]. Acta Agronomica Sinica, 2025, 51(5): 1156-1165.
[14] GUO Xu-Hu, LI Ling-Zhi, LI Feng, MA Bo-Yan, JIA Xiao-Yu. Functional study on the regulation of plant architecture by tomato type I MADS-box gene SlMADS79 [J]. Acta Agronomica Sinica, 2025, 51(4): 982-991.
[15] ZHANG Qin, DAI Cheng, MA Chao-Zhi. Auxin response reporter gene transformation of Brassica napus and dynamic signal analysis of GUS in different tissues [J]. Acta Agronomica Sinica, 2025, 51(3): 667-675.
Viewed
Full text


Abstract

Cited
  Shared   
  Discussed   
No Suggested Reading articles found!
Add: No. 80 Xueyuan South Rd, Beijing 100081, P. R. China E-mail: zwxb301@caas.cn
Supported by Beijing Magtech Co.Ltd