Welcome to Acta Agronomica Sinica，

Acta Agronomica Sinica ›› 2024, Vol. 50 ›› Issue (12): 3155-3164.doi: 10.3724/SP.J.1006.2024.44054

• RESEARCH NOTES • Previous Articles    

Cloning and expression analysis of transcription factor AhWRI1s in peanut

YIN Xiang-Zhen1(), ZHAO Jian-Xin2, HAO Cui-Cui2, PAN Li-Juan1, CHEN Na1, XU Jing1, JIANG Xiao1, ZHAO Xu-Hong1, WANG En-Qi2, CAO Huan2, YU Shan-Lin1, CHI Xiao-Yuan1,*()   

  1. 1Shandong Peanut Research Institute, Qingdao 266100, Shandong, China
    2College of Marine Science and Biological Engineering, Qingdao University of Science and Technology, Qingdao 266042, Shandong, China
  • Received:2024-03-29 Accepted:2024-08-15 Online:2024-12-12 Published:2024-09-03
  • Contact: *E-mail: chi000@126.com
  • Supported by:
    China Agriculture Research System of MOF and MARA(CARS-13);Agricultural Science and Technology Innovation Project of Shandong Academy of Agricultural Sciences(CXGC2023F20);Agricultural Science and Technology Innovation Project of Shandong Academy of Agricultural Sciences(CXGC2024F20);Key-Area Research and Development Program of Guangdong Province(2020B020219003);Major Scientific and Technological Project in Xinjiang(2022A02008-3);Taishan Scholar Project Funding, the Research and Development Program of Shandong Province (the Improved Variety Engineering Project)(2022LZGC007);Natural Science Foundation of Shandong Province(ZR2021QC172);Natural Science Foundation of Shandong Province(ZR2023QC146);Key Research and Development Plan of Shandong Province (Action Plan to Boost Scientific and Technological Innovation in Rural Revitalization)(2022TZXD0031)

RichHTML431

40

PDF

477

Abstract:

Peanut is one of the widely cultivated oil and economic crops worldwide and has become a major source of oil and protein for humans due to its high oil and protein content. With the increasing global demand for vegetable oil, improving the fatty acid composition and increasing the lipid content of peanut seeds has become a top priority in peanut breeding. Transcriptional regulators can modulate the expression of a series of genes in metabolic pathways related to lipid synthesis, significantly affecting lipid synthesis and metabolism. In this study, two transcription factors, AhWRI1-1 and AhWRI1-2, were cloned from the leaves of Huayu 33. The ORF of AhWRI1-1 was 1101 bp, encoding 366 amino acids, and the ORF of AhWRI1-2 was 1128 bp, encoding 375 amino acids. Bioinformatics analysis revealed that both AhWRI1-1 and AhWRI1-2 contained two AP2/EREBP conserved domains. The expression patterns of AhWRI1-1 and AhWRI1-2 in different tissues were detected by qRT-PCR. The results showed that AhWRI1-1 had the highest expression in seeds, suggesting its involvement in the regulation of fatty acid synthesis and oil accumulation, while AhWRI1-2 had the highest expression in hypocotyls, indicating its role in hypocotyl development. Additionally, the differences in the responses of AhWRI1-1 and AhWRI1-2 to abiotic stresses suggested that these transcription factors may play different roles under such conditions. Transcriptional activation experiments in yeast showed that both AhWRI1-1 and AhWRI1-2 possess transcriptional activation activities. This study lays the foundation for future in-depth functional studies of AhWRI1-1 and AhWRI1-2.

Key words: peanut, AP2/EREBP transcription factor, abiotic stress, gene expression analysis, transcriptional activation

Table 1

PCR primers"

引物名称
Primer name		 序列
Sequence (5′-3′)
AhWRI1-1-F ATGAAGAGGTCTCCTAATTCCTCT
AhWRI1-1-R TTAATAATTGGCATAGACATGCATATC
AhWRI1-2-F ATGGAAATGATGACAAAGAAA
AhWRI1-2-R TCACAGATAAGGGAGATTGC
qAhWRI1-1-F TGCCGAATTATCCGAGTT
qAhWRI1-1-R CAGCCATACACATAAGATTGAT
qAhWRI1-2-F TGAAGAGGAGTTGGATGTC
qAhWRI1-2-R TGTAGTGTTGGTAGTGGAAT

Fig. 1

Nucleotide sequence and deduced amino acid sequence of AhWRI1-1 (a) and AhWRI1-2 (b)"

Fig. 2

Alignment of WRI1 amino acid sequences from peanut and other species The two AP2/EREBP domains of WRI1 protein were marked by horizontal lines."

Fig. 3

Gene structure of AhWRI1-1 and AhWRI1-2"

Fig. 4

Phylogenetic analysis of plant WRI1s"

Fig. 5

Expression analysis of AhWRI1-1 and AhWRI1-2 in different tissues and at different seed developmental stages in peanut a: expression analysis of AhWRI1-1 in different tissues; b: expression analysis of AhWRI1-2 in different tissues; c: expression analysis of AhWRI1-1 in seeds at different developmental periods; d: expression analysis of AhWRI1-1 in seeds at different developmental periods. Actin11 was used as the internal reference gene. In a, b, c, and d, set the expression levels of AhWRI1-1 in seeds, AhWRI1-2 in hypocotyls, AhWRI1-1 in seeds at 48 d, and AhWRI1-2 in seeds at 12 d to 1, respectively, as reference points."

Fig. 6

Expression analysis of AhWRI1-1 (a) and AhWRI1-2 (b) under abiotic stresses and hormone treatment conditions Using Actin11 as the internal reference gene, set the expression levels of AhWRI1-1 and AhWRI1-2 at 0 h to 1, respectively, as reference points. ABA: abscisic acid; GA: gibberellic acid; ET: ethephon; JA: jasmonic acid; SA: salicylic acid."

Fig. 7

Analysis of transcriptional activation activity of AhWRI1-1 and AhWRI1-2"

[1] Pasupuleti J, Nigam S N, Pandey M K, Nagesh P, Varshney R K. Groundnut improvement: use of genetic and genomic tools. Front Plant Sci, 2013, 4: 23.
doi: 10.3389/fpls.2013.00023 pmid: 23443056
[2] 姚云游, 乔玉兰. 花生功能成分及营养价值的研究进展. 中国油脂, 2005, 30(9): 31-33.
Yao Y Y, Qiao Y L. Advance in study on functional compositions and nutritive value of peanut. China Oils Fats, 2005, 30(9): 31-33 (in Chinese with English abstract).
[3] Latchman D S. Transcription factors: an overview. Int J Biochem Cell Biol, 1997, 29: 1305-1312.
[4] Yang Y Z, Kong Q, Lim A R Q, Lu S P, Zhao H, Guo L, Yuan L, Ma W. Transcriptional regulation of oil biosynthesis in seed plants: current understanding, applications, and perspectives. Plant Commun, 2022, 3: 100328.
[5] 李玉兰, 孙勤富, 王幼平. 植物油脂合成的转录调控研究进展. 分子植物育种, 2016, 14: 2509-2518.
Li Y L, Sun Q F, Wang Y P. Research advance in transcriptional regulation of lipid synthesis and accumulation in plant. Mol Plant Breed, 2016, 14: 2509-2518 (in Chinese with English abstract).
[6] Focks N, Benning C. wrinkled1: a novel, low-seed-oil mutant of Arabidopsis with a deficiency in the seed-specific regulation of carbohydrate metabolism. Plant Physiol, 1998, 118: 91-101.
doi: 10.1104/pp.118.1.91 pmid: 9733529
[7] Cernac A, Benning C. WRINKLED1 encodes an AP2/EREB domain protein involved in the control of storage compound biosynthesis in Arabidopsis. Plant J, 2004, 40: 575-585.
doi: 10.1111/j.1365-313X.2004.02235.x pmid: 15500472
[8] Ma W, Kong Q, Grix M, Mantyla J J, Yang Y, Benning C, Ohlrogge J B. Deletion of a C-terminal intrinsically disordered region of WRINKLED1 affects its stability and enhances oil accumulation in Arabidopsis. Plant J, 2015, 83: 864-874.
[9] Baud S, Mendoza M S, To A, Harscoet E, Lepiniec L, Dubreucq B. WRINKLED1 specifies the regulatory action of LEAFY COTYLEDON2 towards fatty acid metabolism during seed maturation in Arabidopsis. Plant J, 2007, 50: 825-838.
[10] Sánchez R, González-Thuillier I, Venegas-Calerón M, Garcés R, Salas J J, Martínez-Force E. The sunflower WRINKLED1 transcription factor regulates fatty acid biosynthesis genes through an AW box binding sequence with a particular base bias. Plants (Basel), 2022, 11: 972.
[11] Maeo K, Tokuda T, Ayame A, Mitsui N, Kawai T, Tsukagoshi H, Ishiguro S, Nakamura K. An AP2-type transcription factor, WRINKLED1 of Arabidopsis thaliana binds to the AW-box sequence conserved among proximal upstream regions of genes involved in fatty acid synthesis. Plant J, 2009, 60: 476-487.
[12] Baud S, Wuillème S, To A, Rochat C, Lepiniec L. Role of WRINKLED1 in the transcriptional regulation of glycolytic and fatty acid biosynthetic genes in Arabidopsis. Plant J, 2009, 60: 933-947.
[13] Sanjaya, Durrett T P, Weise S E, Benning C. Increasing the energy density of vegetative tissues by diverting carbon from starch to oil biosynthesis in transgenic Arabidopsis. Plant Biotechnol J, 2011, 9: 874-883.
pmid: 22003502
[14] Snell P, Wilkinson M, Taylor G J, Hall S, Sharma S, Sirijovski N, Hansson M, Shewry P R, Hofvander P, Grimberg Å. Characterisation of grains and flour fractions from field grown transgenic oil-accumulating wheat expressing oat WRI1. Plants, 2022, 11: 889.
[15] Dash S, Cannon E K S, Kalberer S R, Farmer A D, Cannon S B. PeanutBase and other bioinformatic resources for peanut. In: Stalker H T, Wilson R F, eds. Peanuts Genetics, Processing, and Utilization. Urbana: AOCS Press, 2016. pp 241-252.
[16] Lalitha S. Primer premier 5. Biotech Softw Internet Rep, 2000, 1: 270-272.
[17] Gasteiger E, Hoogland C, Gattiker A, Duvaud S, Wilkins M R, Appel R D, Bairoch A. Protein identification and analysis tools on the ExPASy Server. In: Walker J M, eds. The Proteomics Protocols Handbook. NJ: Humana Press, 2005. pp 571-607.
[18] Hallgren J, Tsirigos K D, Pedersen M D, Armenteros J J A, Marcatili P, Nielsen H, Krogh A, Winther O. DeepTMHMM predicts alpha and beta transmembrane proteins using deep neural networks. bioRxiv, 2022, doi: https://doi.org/10.1101/2022.04.08.487609.
[19] Almagro Armenteros J J, Tsirigos K D, Sønderby C K, Petersen T N, Winther O, Brunak S, von Heijne G, Nielsen H. SignalP 5.0 improves signal peptide predictions using deep neural networks. Nat Biotechnol, 2019, 37: 420-423.
doi: 10.1038/s41587-019-0036-z pmid: 30778233
[20] Mistry J, Chuguransky S, Williams L, Qureshi M, Salazar G A, Sonnhammer E L L, Tosatto S C E, Paladin L, Raj S, Richardson L J, Finn R D, Bateman A. Pfam: the protein families database in 2021. Nucleic Acids Res, 2021, 49: D412-D419.
[21] Hu B, Jin J P, Guo A Y, Zhang H, Luo J C, Gao G. GSDS 2.0: an upgraded gene feature visualization server. Bioinformatics, 2015, 31: 1296-1297.
doi: 10.1093/bioinformatics/btu817 pmid: 25504850
[22] Goodstein D M, Shu S Q, Howson R, Neupane R, Hayes R D, Fazo J, Mitros T, Dirks W, Hellsten U, Putnam N, Rokhsar D S. Phytozome: a comparative platform for green plant genomics. Nucleic Acids Res, 2012, 40: D1178-D1186.
[23] Ma W, Kong Q, Arondel V, Kilaru A, Bates P D, Thrower N A, Benning C, Ohlrogge J B. Wrinkled1, a ubiquitous regulator in oil accumulating tissues from Arabidopsis embryos to oil palm mesocarp. PLoS One, 2013, 8: e68887.
[24] To A, Joubès J, Barthole G, Lécureuil A, Scagnelli A, Jasinski S, Lepiniec L, Baud S. WRINKLED transcription factors orchestrate tissue-specific regulation of fatty acid biosynthesis in Arabidopsis. Plant Cell, 2012, 24: 5007-5023.
[25] Pouvreau B, Baud S, Vernoud V, Morin V, Py C, Gendrot G, Pichon J P, Rouster J, Paul W, Rogowsky P M. Duplicate maize Wrinkled1 transcription factors activate target genes involved in seed oil biosynthesis. Plant Physiol, 2011, 156: 674-686.
doi: 10.1104/pp.111.173641 pmid: 21474435
[26] Chen L, Zheng Y H, Dong Z M, Meng F F, Sun X M, Fan X H, Zhang Y F, Wang M L, Wang S M. Soybean (Glycine max) WRINKLED1 transcription factor, GmWRI1a, positively regulates seed oil accumulation. Mol Genet Genomics, 2018, 293: 401-415.
doi: 10.1007/s00438-017-1393-2 pmid: 29138932
[27] Baud S, Bourrellier A B F, Azzopardi M, Berger A, Dechorgnat J, Daniel-Vedele F, Lepiniec L, Miquel M, Rochat C, Hodges M, Ferrario-Méry S. PII is induced by WRINKLED1 and fine-tunes fatty acid composition in seeds of Arabidopsis thaliana. Plant J, 2010, 64: 291-303.
[28] Yang Y, Munz J, Cass C, Zienkiewicz A, Kong Q, Ma W, Sanjaya, Sedbrook J, Benning C. Ectopic expression of WRINKLED1 affects fatty acid homeostasis in Brachypodium distachyon vegetative tissues. Plant Physiol, 2015, 169: 1836-1847.
doi: 10.1104/pp.15.01236 pmid: 26419778
[29] Bryant G O, Ptashne M. Independent recruitment in vivo by Gal4 of two complexes required for transcription. Mol Cell, 2003, 11: 1301-1309.
pmid: 12769853
[30] Cutler S R, Rodriguez P L, Finkelstein R R, Abrams S R. Abscisic acid: emergence of a core signaling network. Annu Rev Plant Biol, 2010, 61: 651-679.
doi: 10.1146/annurev-arplant-042809-112122 pmid: 20192755
[1] Zheng Yu-Zhen, Qi Fei-Yan, Sun Zi-Qi, Liu Hua, Qin Li, Shi Lei, Wang Juan, Wang Meng-Meng, Han Suo-Yi, Xu Jing, Miao Li-Juan, Huang Bing-Yan, Dong Wen-Zhao, Zheng Zheng, Zhang Xin-You. QTL mapping of total very long-chain fatty acids and seven fatty acid components in peanut seeds [J]. Acta Agronomica Sinica, 2026, 52(6): 1646-1657.
[2] Lu Yi-Chu, Li Zhen-Ying, Mai Chun-Hai, Zhao Xiao-Rui, Wang Li-Xiang. Positively regulating role of the key evening complex gene AhLUX1 in peanut nodulation [J]. Acta Agronomica Sinica, 2026, 52(6): 1658-1668.
[3] Yu Tian-Yi, Wang Chun-Xiao, Xiao Li, Zhong Zhao-Di, Wang Xuan-Cang, Zhao Yong, Lu Ya, Wu Yue, Wu Zheng-Feng. Response of nitrogen accumulation, yield, and quality characteristics of peanut varieties with different nodulation traits to nitrogen fertilizer application rate [J]. Acta Agronomica Sinica, 2026, 52(3): 881-894.
[4] Zhang Sheng-Zhong, Li Guo-Wei, Ge Li-Jiang, Wang Fei-Fei, Hu Xiao-Hui, Miao Hua-Rong, Li Yan, Zhong Wen, Chen Jing. Screening and QTL mapping for mechanical shelling damage related traits in peanut [J]. Acta Agronomica Sinica, 2026, 52(2): 644-652.
[5] Yang Biao, Du Shuai-Kang, Zhang Ji-Wang, Shi Ying, Zhang Li-Li. Genome-wide identification of class III POD gene family in potato and its expression profile analysis [J]. Acta Agronomica Sinica, 2026, 52(2): 405-420.
[6] Wang Fei-Fei, Zhang Sheng-Zhong, Yang Gui-Hua, Miao Hua-Rong, Hu Xiao-Hui, Zhang Ze-Lin, Liu Sha-Sha, Qiao Li-Xian, Shan Shi-Hua, Chen Jing. Comprehensive evaluation of salt tolerance and identification of elite salt-tolerant germplasm in 331 peanut accessions at seedling stage [J]. Acta Agronomica Sinica, 2026, 52(1): 279-294.
[7] Jin Xin-Xin, Song Ya-Hui, Su Qiao, Yang Yong-Qing, Wang Jin. Growth and dry matter production characteristics of high-yielding, high-oil, and high oleic acid peanut varieties [J]. Acta Agronomica Sinica, 2026, 52(1): 191-201.
[8] Chi Xiao-Yuan, Liu Qing, Zhang Jun, Zhao Xu-Hong, Li Mei, Yu Tian-Yi, Pan Li-Juan, Xu Jing, Jiang Xiao, Yin Xiang-Zhen, Ma Jun-Qing, Chen Na. Field evaluation of salt-alkaline tolerance and trait correlation analysis in different peanut varieties (lines) [J]. Acta Agronomica Sinica, 2026, 52(1): 85-98.
[9] Sun Chen-Shuo, Zhang Yue, Tian Ze-Kai, Yan Li-Ying, Kang Yan-Ping, Chen Yu-Ning, Wang Xin, Huai Dong-Xin, Wang Qian-Qian, Jiang Hui-Fang, Luo Huai-Yong, Huang Li, Liao Bo-Shou, Wang Zhi-Hui, Lei Yong. Genetic differentiation of peg strength and analysis of major influencing factors in peanut germplasm [J]. Acta Agronomica Sinica, 2026, 52(1): 118-130.
[10] Jing Xiu-Qing, Cai Yong-Duo, Deng Ning, Zhao Xiao-Dong, Zhai Fei-Hong, Zeng Qun. Identification and expression pattern analysis of RopGEF family genes in Chenopodium quinoa [J]. Acta Agronomica Sinica, 2026, 52(1): 28-43.
[11] YAN Zhi-Lan, ZHAO Qin, CHANG Tian-Da, WANG Yi-Ming, WANG Bi-Hui, WANG Peng, HUANG Chun-Guo, ZHANG Hui, WANG Li-Xiang, HAO Xiao-Peng, ZHAO Bo. Genome-wide identification and characterization of Alternative oxidase (AOX) genes in leguminous crops and their expression patterns in response to abiotic stresses in common bean [J]. Acta Agronomica Sinica, 2025, 51(7): 1769-1783.
[12] WAN Shu-Bo, ZHANG Jia-Lei, GAO Hua-Xin, WANG Cai-Bin. Advances and prospects of high-yield peanut cultivation in China [J]. Acta Agronomica Sinica, 2025, 51(7): 1703-1711.
[13] GUO Teng-Da, CUI Meng-Jie, CHEN Lin-Jie, HAN Suo-Yi, GUO Jing-Kun, WU Chen-Di, FU Liu-Yang, HUANG Bing-Yan, DONG Wen-Zhao, ZHANG Xin-You. Cloning and expression analysis of the phosphatidylinositol transfer protein AhSFH gene in peanuts responsive to Aspergillus flavus infection [J]. Acta Agronomica Sinica, 2025, 51(6): 1489-1500.
[14] LI Wen-Jia, LIAO Yong-Jun, HUANG Lu, LU Qing, LI Shao-Xiong, CHEN Xiao-Ping, JIN Jing-Wei, WANG Run-Feng. Genome-wide associate analysis of flowering traits and identification of candidate genes in peanut [J]. Acta Agronomica Sinica, 2025, 51(5): 1400-1408.
[15] LIN Wei-Jin, GUO Ze-Jia, LIU Hao, LI Hai-Fen, WANG Run-Feng, HUANG Lu, YU Qian-Xia, CHEN Xiao-Ping, HONG Yan-Bin, LI Shao-Xiong, LU Qing. QTL mapping and candidate gene analysis of peanut pod yield-related traits [J]. Acta Agronomica Sinica, 2025, 51(4): 969-981.
Viewed
Full text


Abstract

Cited
  Shared   
  Discussed   
No Suggested Reading articles found!
Add: No. 80 Xueyuan South Rd, Beijing 100081, P. R. China E-mail: zwxb301@caas.cn
Supported by Beijing Magtech Co.Ltd