Welcome to Acta Agronomica Sinica，

Acta Agronomica Sinica ›› 2025, Vol. 51 ›› Issue (3): 598-608.doi: 10.3724/SP.J.1006.2025.42028

• CROP GENETICS & BREEDING·GERMPLASM RESOURCES·MOLECULAR GENETICS • Previous Articles     Next Articles

Effects of different alleles and natural variations of OsMKK4, a member of the rice MKKs family gene, on grains

LIU Jian-Guo1,2(), CHEN Dong-Dong2, CHEN Yu-Yu2, YI Qin-Qin2, LI Qing2, XU Zheng-Jin1,*(), QIAN Qian2,*(), SHEN Lan2,*()   

  1. 1Rice Research Institute of Shenyang Agricultural University, Shenyang 110866, Liaoning, China
    2China National Rice Research Institute, Hangzhou 311401, Zhejiang, China
  • Received:2024-06-06 Accepted:2024-10-25 Online:2025-03-12 Published:2024-11-12
  • Contact: *E-mail: shenlan@caas.cn; E-mail: qianqian188@hotmail.com; E-mail: xuzhengjin@126.com
  • Supported by:
    Zhejiang Provincial Natural Science Foundation Exploration Project(LY22C130005);National Natural Science Foundation of China(32171987)

RichHTML434

35

PDF

376

Abstract:

The MKK gene family in the MAPK signaling pathway plays a pivotal role in connecting processes related to rice growth, development, and defense signaling, regulating various biological processes. In this study, we identified MKK genes in rice through bioinformatics analysis and constructed a phylogenetic tree, revealing both the conservation and diversity within the MKK gene family. Using gene editing technology, we edited the OsMKK4 gene in the Nipponbare rice variety and successfully obtained six lines with different mutation types in this gene. Grain length, grain width, and 1000-grain weight in these mutant lines were significantly reduced compared to the wild type. Haplotype analysis revealed clear differentiation in OsMKK4 gene haplotypes between indica and japonica rice, primarily divided into the Glu14 japonica type and Leu14 indica type. On average, japonica rice containing Glu14 exhibited shorter grain length but higher grain width and 1000-grain weight. Furthermore, introducing the OsMKK4 gene with the Leu14 haplotype from Kasalath into Nipponbare resulted in significantly reduced grain length, grain width, and 1000-grain weight in the DHX (CSSL) compared to Nipponbare. However, compared to Kasalath, the grain width and 1000-grain weight of the substitution line increased significantly, particularly in grain width. This study highlights the

influence of key OsMKK4 gene haplotypes on rice grain traits, providing valuable genetic resources and strategies for more precise molecular breeding design.

Key words: rice, MAPK, OsMKK4, grain size, haplotype

Table 1

Primers used in this study"

引物名称
Primer name		 正向引物
Forward sequence (5'-3')		 反向引物
Reverse sequence (5'-3')
OsMKK4g1 GGCAAGCGACGTGAGGTCCCGCTG AAACCAGCGGGACCTCACGTCGCT
OsMKK4g2 GGCAGTGCCCACCCCGCCGAATT AAACAATTCGGCGGGGTGGGCAC
OsMKK4-JC GCGAGCCCACCAGAAAACGC TCGTCGTGGTTCCCGTAGAGCA
Hyg ACCAGACACGAGACGACTAA ATCGGTGCGGGCCTCTTC

Fig. 1

Phylogenetic and structural analysis of MKKs gene family and encoded proteins in rice A: phylogenetic tree of MKKs among different species; B: phylogenetic tree of MKKs in rice; C: conserved motif of MKKs; D: conserved domain of MKKs; E: cis-acting element of MKKs promoter; F: gene structure of MKKs."

Fig. 2

Schematic diagram of OsMKK4 target site and schematic representations of amino acid sequence change of OsMKK4 mutant proteins A: schematic diagram of OsMKK4 target site. The positions and base sequences of the two gRNA target sites of OsMKK4, with the PAM sequence in red font. B: yellow highlights the PAM; red lowercase letters represent inserted bases; + indicates insertion; - indicates deletion; * indicates translation termination. C: the red box in the sequencing results indicates the mutation site; D: analysis of the tertiary structure of the mutant protein. NPB: Nipponbare; osmkk4 1-1, osmkk4 1-2, osmkk4 2-1, osmkk4 2-2, osmkk4 2-3, and osmkk4 2-4: six mutation types of OsMKK4."

Fig. 3

Comparative analysis of agronomic traits of new varieties edited by OsMKK4 gene A: comparison of plant morphology between Nipponbare and the newly edited Nipponbare-background line, with a scale of 10 cm; B: comparison of grain length and grain width among different mutated new lines, with a scale of 1 cm; C: statistical analysis of plant height among different mutated new lines; D-F: statistical analysis of 1000-grain weight, grain length, and grain width, respectively. Data are presented as mean ± standard deviation (n ≥ 9). * indicates a significant difference at the P < 0.05 level; ** indicates a significant difference at the P < 0.01 level. Abbreviations are the same as those given in Fig. 2."

Fig. 4

Genetic natural variation and haplotype network analysis of OsMKK4 A: the gene structure and protein structure of OsMKK4, as well as five mutation sites; B: the network graph of eight haplotypes, with black lines representing the number of mutations between two haplotypes; C: statistical data on the thousand-grain weight of eight haplotypes from 1072 samples; D: statistical data on grain length of eight haplotypes from 1072 samples; E: statistical data on grain width of eight haplotypes from 1072 samples (n ≥ 10). The same letter indicates non-significant difference at the 0.05 level, while different lowercase letters represent significant differences at the 0.05 probability level. Hap: haplotype; XI, GJ, Aus, Bas, and admix: different types of rice classified by their regions of origin."

Fig. 5

Natural variation in OsMKK4 is correlated with differences in grain traits A: amino acid sequence distribution among rice subspecies; B-D: statistical data on 1000-grain weight, grain length, and grain width for amino acid sequence combinations (n ≥ 10). The same letter indicates non-significant difference at the 0.05 level, while different lowercase letters represent significant differences at the 0.05 probability level. Abbreviations are the same as those given in Fig. 4."

Fig. 6

Investigation of grain traits in natural variant chromosome substitution lines A: alignment of gene and amino acid sequences from three varieties; B: sequencing results of three varieties’ genes; C: comparison of grain length and width among three varieties, with a scale of 1 cm; D-F: statistical data on 1000-grain weight, grain length, and grain width for the three varieties (n ≥ 9). * indicates a significant difference at the P < 0.05 level; ** indicates a significant difference at the P < 0.01 level. DHX: the rice chromosome segment substitution lines of Nipponbare as the recipient parent and Kasalath as the donor parent. Kasalath: an important representative indica conventional rice variety of rice genome. Abbreviations are the same as those given in Fig. 2."

[1] Tang S, Zhao Z Y, Liu X T, Sui Y, Zhang D D, Zhi H, Gao Y Z, Zhang H, Zhang L L, Wang Y N, Zhao M C, Li D D, Wang K, He Q, Zhang R L, Zhang W, Jia G Q, Tang W Q, Ye X G, Wu C Y, Diao X M. An E2-E3 pair contributes to seed size control in grain crops. Nat Commun, 2023, 14: 3091.
doi: 10.1038/s41467-023-38812-y pmid: 37248257
[2] Zhang Y, Xiong Y, Liu R Y, Xue H W, Yang Z B. The Rho-family GTPase OsRac1 controls rice grain size and yield by regulating cell division. Proc Natl Acad Sci USA, 2019, 116: 16121-16126.
doi: 10.1073/pnas.1902321116 pmid: 31320586
[3] Sun S Y, Wang L, Mao H L, Shao L, Li X H, Xiao J H, Ouyang Y D, Zhang Q F. A G-protein pathway determines grain size in rice. Nat Commun, 2018, 9: 851.
doi: 10.1038/s41467-018-03141-y pmid: 29487318
[4] Ren D Y, Ding C Q, Qian Q. Molecular bases of rice grain size and quality for optimized productivity. Sci Bull, 2023, 68: 314-350.
[5] Xiong L N, Tan L B, Xu R, Zhu Z F, Sun X Y, Sun H Y, Sun C Q. A gain-of-function mutation of OsMAPK6 leads to long grain in rice. Crop J, 2021, 9: 1481-1485.
doi: 10.1016/j.cj.2021.03.022
[6] Hu J, Wang Y X, Fang Y X, Zeng L J, Xu J, Yu H P, Shi Z Y, Pan J J, Zhang D, Kang S J, Zhu L, Dong G J, Guo L B, Zeng D L, Zhang G H, Xie L H, Xiong G S, Li J Y, Qian Q. A rare allele of GS2 enhances grain size and grain yield in rice. Mol Plant, 2015, 8: 1455-1465.
doi: 10.1016/j.molp.2015.07.002 pmid: 26187814
[7] Yang W S, Wu K, Wang B, Liu H H, Guo S Y, Guo X Y, Luo W, Sun S Y, Ouyang Y D, Fu X D, Chong K, Zhang Q F, Xu Y Y. The RING E3 ligase CLG1 targets GS3 for degradation via the endosome pathway to determine grain size in rice. Mol Plant, 2021, 14: 1699-1713.
doi: 10.1016/j.molp.2021.06.027 pmid: 34216830
[8] Ying J Z, Ma M, Bai C, Huang X H, Liu J L, Fan Y Y, Song X J. TGW3, a major QTL that negatively modulates grain length and weight in rice. Mol Plant, 2018, 11: 750-753.
[9] Group M A P K. Mitogen-activated protein kinase cascades in plants: a new nomenclature. Trends Plant Sci, 2002, 7: 301-308.
doi: 10.1016/s1360-1385(02)02302-6 pmid: 12119167
[10] Hamel L P, Nicole M C, Sritubtim S, Morency M J, Ellis M, Ehlting J, Beaudoin N, Barbazuk B, Klessig D, Lee J, Martin G, Mundy J, Ohashi Y, Scheel D, Sheen J, Xing T, Zhang S Q, Seguin A, Ellis B E. Ancient signals: comparative genomics of plant MAPK and MAPKK gene families. Trends Plant Sci, 2006, 11: 192-198.
[11] Liu Z Q, Mei E Y, Tian X J, He M L, Tang J Q, Xu M, Liu J L, Song L, Li X F, Wang Z Y, Guan Q J, Xu Q J, Bu Q Y. OsMKKK 70 regulates grain size and leaf angle in rice through the OsMKK4-OsMAPK6-OsWRKY53 signaling pathway. J Integr Plant Biol, 2021, 63: 2043-2057.
[12] Jiang M, Chu Z Q. Comparative analysis of plant MKK gene family reveals novel expansion mechanism of the members and sheds new light on functional conservation. BMC Genomics, 2018, 19: 407.
doi: 10.1186/s12864-018-4793-8 pmid: 29843611
[13] Ma H G, Li J, Ma L, Wang P L, Xue Y, Yin P, Xiao J H, Wang S P. Pathogen-inducible OsMPKK10.2-OsMPK6 cascade phosphorylates the Raf-like kinase OsEDR1 and inhibits its scaffold function to promote rice disease resistance. Mol Plant, 2021, 14: 620-632.
[14] Rao K P, Richa T, Kumar K, Raghuram B, Sinha A K. In silico analysis reveals 75 members of mitogen-activated protein kinase kinase kinase gene family in rice. DNA Res, 2010, 17: 139-153.
doi: 10.1093/dnares/dsq011 pmid: 20395279
[15] Kumar K, Rao K P, Sharma P, Sinha A K. Differential regulation of rice mitogen activated protein kinase kinase (MKK) by abiotic stress. Plant Physiol Biochem, 2008, 46: 891-897.
[16] Xu R, Duan P G, Yu H Y, Zhou Z K, Zhang B L, Wang R C, Li J, Zhang G Z, Zhuang S S, Lyu J, Li N, Chai T Y, Tian Z X, Yao S G, Li Y H. Control of grain size and weight by the OsMKKK10- OsMKK4-OsMAPK6 signaling pathway in rice. Mol Plant, 2018, 11: 860-873.
[17] Duan P G, Rao Y C, Zeng D L, Yang Y L, Xu R, Zhang B L, Dong G J, Qian Q, Li Y H. SMALL GRAIN 1, which encodes a mitogen-activated protein kinase kinase 4, influences grain size in rice. Plant J, 2014, 77: 547-557.
[18] Liu J G, Shen L, Guo L B, Zhang G H, Gao Z Y, Zhu L, Hu J, Dong G J, Ren D Y, Zhang Q, Li Q, Zeng D L, Yan C J, Qian Q. OsSTS, a novel allele of mitogen-activated protein kinase kinase 4 (OsMKK4), controls grain size and salt tolerance in rice. Rice (N Y), 2023, 16: 47.
doi: 10.1186/s12284-023-00663-y pmid: 37874376
[19] Guo T, Chen K, Dong N Q, Shi C L, Ye W W, Gao J P, Shan J X, Lin H X. GRAIN SIZE AND NUMBER1 negatively regulates the OsMKKK10-OsMKK4-OsMPK6 cascade to coordinate the trade-off between grain number per panicle and grain size in rice. Plant Cell, 2018, 30: 871-888.
[20] Guo T, Lu Z Q, Shan J X, Ye W W, Dong N Q, Lin H X. ERECTA 1 acts upstream of the OsMKKK10-OsMKK4-OsMPK6 cascade to control spikelet number by regulating cytokinin metabolism in rice. Plant Cell, 2020, 32: 2763-2779.
[21] Liu S Y, Hua L, Dong S J, Chen H Q, Zhu X D, Jiang J E, Zhang F, Li Y H, Fang X H, Chen F. OsMAPK6, a mitogen-activated protein kinase, influences rice grain size and biomass production. Plant J, 2015, 84: 672-681.
[22] Ma H G, Chen J, Zhang Z Z, Ma L, Yang Z Y, Zhang Q L, Li X H, Xiao J H, Wang S P. MAPK kinase 10.2 promotes disease resistance and drought tolerance by activating different MAPKs in rice. Plant J, 2017, 92: 557-570.
[23] Xie G S, Kato H, Imai R. Biochemical identification of the OsMKK6-OsMPK3 signalling pathway for chilling stress tolerance in rice. Biochem J, 2012, 443: 95-102.
doi: 10.1042/BJ20111792 pmid: 22248149
[24] Wang F Z, Jing W, Zhang W H. The mitogen-activated protein kinase cascade MKK1-MPK4 mediates salt signaling in rice. Plant Sci, 2014, 227: 181-189.
doi: 10.1016/j.plantsci.2014.08.007 pmid: 25219319
[25] Jing C Y, Zhang F M, Wang X H, Wang M X, Zhou L, Cai Z, Han J D, Geng M F, Yu W H, Jiao Z H, Huang L, Liu R, Zheng X M, Meng Q L, Ren N N, Zhang H X, Du Y S, Wang X, Qiang C G, Zou X H, Gaut B S, Ge S. Multiple domestications of Asian rice. Nat Plants, 2023, 9: 1221-1235.
[26] Zhao H, Li J, Yang L, Qin G, Xia C, Xu X, Su Y, Liu Y, Ming L, Chen L L, Xiong L, Xie W. An inferred functional impact map of genetic variants in rice. Mol Plant, 2021, 14: 1584-1599.
doi: 10.1016/j.molp.2021.06.025 pmid: 34214659
[27] Wang C C, Yu H, Huang J, Wang W S, Faruquee M, Zhang F, Zhao X Q, Fu B Y, Chen K, Zhang H L, Tai S S, Wei C C, McNally K L, Alexandrov N, Gao X Y, Li J Y, Li Z K, Xu J L, Zheng T Q. Towards a deeper haplotype mining of complex traits in rice with RFGB v2.0. Plant Biotechnol J, 2020, 18: 14-16.
[28] Mansueto L, Fuentes R R, Borja F N, Detras J, Abriol-Santos J M, Chebotarov D, Sanciangco M, Palis K, Copetti D, Poliakov A, Dubchak I, Solovyev V, Wing R A, Hamilton R S, Mauleon R, McNally K L, Alexandrov N. Rice SNP-seek database update: new SNPs, indels, and queries. Nucleic Acids Res, 2017, 45: D1075-D1081.
[29] Ruan B P, Shang L G, Zhang B, Hu J, Wang Y X, Lin H, Zhang A P, Liu C L, Peng Y L, Zhu L, Ren D Y, Shen L, Dong G J, Zhang G H, Zeng D L, Guo L B, Qian Q, Gao Z Y. Natural variation in the promoter of TGW2 determines grain width and weight in rice. New Phytol, 2020, 227: 629-640.
doi: 10.1111/nph.16540 pmid: 32167575
[30] Mao X X, Zhang J J, Liu W G, Yan S J, Liu Q, Fu H, Zhao J L, Huang W J, Dong J F, Zhang S H, Yang T F, Yang W, Liu B, Wang F. The MKKK62-MKK3-MAPK7/14 module negatively regulates seed dormancy in rice. Rice (N Y), 2019, 12: 2.
doi: 10.1186/s12284-018-0260-z pmid: 30671680
[31] 单奇伟, 高彩霞. 植物基因组编辑及衍生技术最新研究进展. 遗传, 2015, 37: 953-973.
Shan Q W, Gao C X. Research progress of genome editing and derivative technologies in plants. Hereditas (Beijing), 2015, 37: 953-973 (in Chinese with English abstract).
[32] Ishimaru K, Hirotsu N, Madoka Y, Murakami N, Hara N, Onodera H, Kashiwagi T, Ujiie K, Shimizu B I, Onishi A, Miyagawa H, Katoh E. Loss of function of the IAA-glucose hydrolase gene TGW6 enhances rice grain weight and increases yield. Nat Genet, 2013, 45: 707-711.
doi: 10.1038/ng.2612 pmid: 23583977
[33] Guo N H, Tang S J, Wang Y K, Chen W, An R H, Ren Z L, Hu S K, Tang S Q, Wei X J, Shao G N, Jiao G A, Xie L H, Wang L, Chen Y, Zhao F L, Sheng Z H, Hu P S. A mediator of OsbZIP46 deactivation and degradation negatively regulates seed dormancy in rice. Nat Commun, 2024, 15: 1134.
doi: 10.1038/s41467-024-45402-z pmid: 38326370
[1] Peng Jia-Luo, Li Ying, Li Dan-Dan, Yang Jun-Ning, Guo Xue-Feng, Zhang Wen-Jiao, Yu Xiao-Xue, Zhou Ya-Rong, Wang Zhen-Yu, Wang Cai-Xiang, Ma Xiong-Feng, Su Jun-Ji. Identification of class I LBD family members in upland cotton and function and haplotype analyses of GhLBD6 in regulating flowering period [J]. Acta Agronomica Sinica, 2026, 52(6): 1682-1697.
[2] Tang Kuan-Qiang, Li Gong-Yun, Song Mei-Yi, Zhao Xue, Chang Chun-Ling. Genome-wide association analysis and prediction model construction for soybean plant height [J]. Acta Agronomica Sinica, 2026, 52(6): 1743-1756.
[3] Hu Zhao, Qian Run, Xie Feng-Pu, Ying Su-Ping. Genome-wide identification and expression analysis of the SPX gene family in rice under phosphorus treatment [J]. Acta Agronomica Sinica, 2026, 52(6): 1902-1912.
[4] Zou Yi-Mei, Xu Min, Wang Hai-Yang, Yao Hui, Wang Jia-Feng, Liu Hao, Ren Dai-Sheng. Analysis of transcription factor regulatory networks in two-line male sterile rice seedling roots in response to salt stress [J]. Acta Agronomica Sinica, 2026, 52(6): 1728-1742.
[5] Zhang Xian-Feng, Guo Li-Jian, Li Kang-Chun, Kong Bin-Xue, Liu Yu-Fang, Che Zhuo, Yang De-Long. Identification of the ABHD6 gene family and development of functional markers for grain weight in wheat [J]. Acta Agronomica Sinica, 2026, 52(6): 1711-1727.
[6] Yan An, Jiang Kun-Wei, Wang Rong-Yuan, Tian Lin, Zhang Lu, Wang Yun, Xu Jian-Long. Identification and cloning of SVN7 controlling small vascular bundle number in the rice flag leaf [J]. Acta Agronomica Sinica, 2026, 52(5): 1364-1372.
[7] Sun Shu-Feng, Xu Zhen-Nan, Huang Jia-Xin, Weng Jian-Feng, Li Xin-Hai. Genome-wide identification of the maize MAPK gene family and its response to Fusarium verticillioides infection [J]. Acta Agronomica Sinica, 2026, 52(5): 1291-1308.
[8] Chen Wei, Wei Wan-Juan, Zhao Qi-Bing, Chang Dong-Wei, Yu Ling-Bo, Zhai Peng-Fei, Feng Zhi-Ming, Chen Zong-Xiang, Ren Yang-Tao, Yang Peng, Liu Hai-Lang, Li Zhen-Fu, Yang Yong-Le, Jin Yan-Gang, Zuo Shi-Min. Developing new germplasm of high-quality and early-maturing rice by editing Hd6 via CRISPR/Cas9 [J]. Acta Agronomica Sinica, 2026, 52(4): 1046-1056.
[9] Shi Shao-Jie, Liu Kai, Chen Zi-Yi, Wang Hui-Ying, Li San-He, Zhou Lei, You Ai-Qing. Cloning and functional analysis of the dwarf and multi-tiller gene DMT1 in rice [J]. Acta Agronomica Sinica, 2026, 52(4): 1022-1034.
[10] Qin Yi-Yan, Fu Yao, Su Chang, Li Na, Xu Jing-Ru, Cheng Xiao-Ran, Zhang Qi, Zhao Ming-Hui. Functional analysis of OsST41 regulating salt tolerance in rice seedlings [J]. Acta Agronomica Sinica, 2026, 52(3): 802-812.
[11] Liu Chang-You, Wang Shen, Shi Hui-Ying, Shen Ying-Chao, Sun Lei, Wang Yan, Zhang Zhi-Xiao, Su Qiu-Zhu, Tian Jing, Fan Bao-Jie. QTL mapping for bruchid resistance in an adzuki bean distant hybridization population using rice bean genetic resources [J]. Acta Agronomica Sinica, 2026, 52(3): 936-944.
[12] Ye Fan, Li Shuai, Li Si-Yu, Chen Yun, Dou Chao-Yin, Liu Li-Jun. Effects of water-saving irrigation on rice yield and population quality in Northeast China [J]. Acta Agronomica Sinica, 2026, 52(3): 895-907.
[13] Liu Ning, Fan Ping, Wang Cheng, Chen Qi-Qi, Cheng Qing-Yue, Tie Xia-Na, Tang Jing-Sha, Liu Bin-Bin, Xie Hong-Kun, Wang Jia-Yue, Shi Yuan-Qing, Ma Jun. Effects of reduced nitrogen application combined with organic fertilizer on yield formation and nitrogen utilization in mechanically transplanted rice [J]. Acta Agronomica Sinica, 2026, 52(3): 866-880.
[14] Li Shi-Qing, Wang Qian, Wang Su-Hua, Zhang Yao-Wen, Wang Li-Xia. Evaluation of salt tolerance at the seedling stage and related gene mining in mung bean germplasm resources [J]. Acta Agronomica Sinica, 2026, 52(2): 376-388.
[15] Zhu Jin-Juan, Wang Hui-Ping, Yang Guo-Dong, Wang Yu-Cheng, Yang Chen, Wang Bin, Agustiani Nurwulan, Tu Jun-Ming, Bi Jun-Guo, Cui Ke-Hui, Huang Jian-Liang, Peng Shao-Bing, Yuan Shen. Effects of water management and variety type on grain yield and quality in ratoon rice [J]. Acta Agronomica Sinica, 2026, 52(1): 295-315.
Viewed
Full text


Abstract

Cited
  Shared   
  Discussed   
No Suggested Reading articles found!
Add: No. 80 Xueyuan South Rd, Beijing 100081, P. R. China E-mail: zwxb301@caas.cn
Supported by Beijing Magtech Co.Ltd