Welcome to Acta Agronomica Sinica,

Acta Agronomica Sinica ›› 2018, Vol. 44 ›› Issue (03): 376-384.doi: 10.3724/SP.J.1006.2018.00376

• CROP GENETICS & BREEDING · GERMPLASM RESOURCES · MOLECULAR GENETICS • Previous Articles     Next Articles

Cloning and Imprinting Characterization Analyses of Paternally Expressed Gene ZmVIL1 in Maize Endosperm

Chao-Xian LIU**, Jiu-Guang WANG**, Xiu-Peng MEI, Ting-Ting YU, Guo-Qiang WANG, Lian ZHOU, Yi-Lin CAI*()   

  1. Maize Research Institute, Southwest University / Engineering Research Center of South Upland Agriculture, Ministry of Education, Chongqing 400715, China
  • Received:2017-07-11 Accepted:2017-11-21 Online:2018-03-12 Published:2017-12-04
  • Contact: Chao-Xian LIU,Jiu-Guang WANG,Yi-Lin CAI E-mail:caiyilin1789@163.com
  • Supported by:
    This study was supported by China Postdoctoral Science Foundation (2014M552303), Fundamental Research Funds for the Central Universities (XDJK2015B009), and the Technology Integration and Demonstration of Zhongkeyu 9699, and Xidabainuo 1 (cstc2015jcsf-nycgzhA80006).

Abstract:

Imprint genes play important roles in maize seed development. ZmVIL1 is a paternal-preferentially expressed gene. In this study, the full length of ZmVIL1 cDNA was cloned by RACE, which is about 2.2 kb and encodes a protein consisting of 598 amino acids. The analyses of allele expression of ZmVIL1 in endosperm and embryo at 14 days after pollination (DAP) of hybrids from reciprocal crosses between B73 and Mo17 indicated that ZmVIL1 was maternally imprinted in endosperm, while not in embryo. The allele expression was extensively evaluated in 14 DAP endosperm of hybrids form reciprocal crosses of Zheng 58 and Chang 7-2, Huang C and 178, PH6WC and PH4CV, and in 10-28 DAP endosperm of hybrids form reciprocal crosses of B73 and Mo17, suggesting that ZmVIL1 was gene-specific and binary imprinting and consistently imprinted in endosperm from 12 to 28 DAP. Expression pattern analyses demonstrated ZmVIL1 was constitutively expressed from vegetative to reproductive stages. ZmVIL1 was strongly expressed in seed at 10 DAP, immature tassels, immature ears and silk, and secondly expressed in ovule, embryo at 25 DAP and root, suggesting that ZmVIL1 plays important roles in maize seed and flower development.

Key words: ZmVIL1, gene cloning, gene imprinting, imprinting pattern

Table 1

Primer sequences for 5° RACE, 3° RACE, CDS amplification and imprinting characterization analyses of ZmVIL1"

引物名称
Primer name
正向引物序列
Forward primer sequence (5°-3°)
反向引物序列
Reverse primer sequence (5°-3°)
内切酶
Restriction enzyme
ZmVIL1-5° race GCCCATCGCATTCCAACTGCCTTACTAC
ZmVIL1-5° race-nest-1 GCGTTTAGGTCGGGGACAGAAGATGAG
ZmVIL1-5° race-nest-2 GGTCAGGAGAACTCAACCACTCGTCAGC
ZmVIL1-3° race CTCGGCAAGTAAGCAAGGTGAATAGCGT
ZmVIL1-3° race-nest-1 GCAACTGGATGGGGATTATGAGCACTG
ZmVIL1-3° race-nest-2 AGGTAGTAAGGCAGTTGGAATGCGATGG
ZmVIL1-CDS ATGCCCAAAACACCTCCTGT CTCAGCGAACCACAACAACAAA
ZmVIL1-imprinting ATTCAAAGAGCTGACGAGTGGT TCATAATCCCCATCCAGTTGCC Hph I

Fig. 1

5° RACE and 3° RACE for ZmVIL1 cloning A, B, C: the gel electrophoresis for the first, second and third round RACE PCR products. L1, L3, L5: the gel electrophoresis for ZmVIL1 cDNA 5° RACE; L2, L4, L6: the gel electrophoresis for ZmVIL1 cDNA 3°RACE; Marker: D2000 plus."

Fig. 2

Protein sequences alignment for ZmVIL1 in maize, and VIN3, VIL1 in Arabidopsis"

Fig. 3

SNPs in ZmVIL1 CDS of B73 and Mo17 The arrows indicate the SNPs at the 1380th, 1450th, and 1530th base pairs in ZmVIL1 CDS of B73 and Mo17."

Fig. 4

Imprinting characterization analysis of ZmVIL1 in 14 DAP endosperm and embryo of B73 and Mo17 reciprocal hybrids A: imprinting characterization analysis of ZmVIL1 in 14 DAP endosperm; B: imprinting characterization analysis of ZmVIL1 in 14 DAP embryo. Marker: D2000 plus."

Fig. 5

Imprinting characterization analysis of ZmVIL1 in 14 DAP endosperm of Huang C and 178, Zheng 58 and Chang 7-2, PH6WC and PH4CV reciprocal hybrids H: Huang C; C: Chang 7-2; Z: Zheng 58; 4C: PH4CV; 6W: PH6WC; Marker: D2000 plus."

Fig. 6

Imprinting characterization analysis of ZmVIL1 in 10-28 DAP endosperm of B73 and Mo17 reciprocal hybrids A: imprinting characterization analysis of ZmVIL1 in 10-28 DAP endosperm of B73×Mo17; B: imprinting characterization analysis of ZmVIL1 in 10-28 DAP endosperm of Mo17×B73; Marker: D2000 plus."

Fig. 7

Expression pattern of ZmVIL1 in different maize tissues"

Fig. 8

Molecular evolution relationship analysis of ZmVIL1 with VIN3 protein family in Arabidopsis and rice"

[1] Köhler C, Wolff P, Spillane C.Epigenetic mechanisms underlying genomic imprinting in plants.Annu Rev Plant Biol, 2012, 63: 331-352
[2] Bhavani P, Harinikumar K, Shashidhar H, Zargar S M.Genetic imprinting in maize.Maize Genet Genomics, 2012, 3: 13-21
[3] Kermicle J.Dependence of the r-mottled aleurone phenotype in maize on mode of sexual transmission. Genetics, 1970, 66: 69-85
[4] Surani M, Barton S C, Norris M.Development of reconstituted mouse eggs suggests imprinting of the genome during gametogenesis.Nature, 1984, 308: 548-550
[5] McGrath J, Solter D. Completion of mouse embryogenesis requires both the maternal and paternal genomes.Cell, 1984, 37: 179-183
[6] Bartolomei M S, Tilghman S M.Genomic imprinting in mammals. Annu Rev Genet, 1997, 1: 493-525
[7] Abramowitz L K, Bartolomei M S.Genomic imprinting: recognition and marking of imprinted loci.Curr Opin Genet Dev, 2012, 22: 72-78
[8] Egger G, Liang G, Aparicio A, Jones P A.Epigenetics in human disease and prospects for epigenetic therapy.Nature, 2004, 429: 457-463
[9] Luo M, Taylor J M, Spriggs A, Zhang H, Wu X, Russell S, Singh M, Koltunow A.A genome-wide survey of imprinted genes in rice seeds reveals imprinting primarily occurs in the endosperm.PLoS Genet, 2011, 7: e1002125
[10] Gehring M, Missirian V, Henikoff S.Genomic analysis of parent-of-origin allelic expression inArabidopsis thaliana seeds. PLoS One, 2011, 6: e23687
[11] Waters A J, Makarevitch I, Eichten S R, Swanson-Wagner R A, Yeh C T, Xu W, Schnable P S, Vaughn M W, Gehring M, Springer N M. Parent-of-origin effects on gene expression and DNA methylation in the maize endosperm.Plant Cell, 2011, 23: 4221-4233
[12] Liu C, Wang J, Mei X, Deng X, Yu T, Liu X, Wang G, Liu Z, Cai Y.Characterization of the imprinting and expression patterns of ZAG2 in maize endosperm and embryo. Crop J, 2015, 3: 74-79
[13] Costa L M, Yuan J, Rouster J, Paul W, Dickinson H, Gutierrezmarcos J F.Maternal control of nutrient allocation in plant seeds by genomic imprinting.Curr Biol, 2012, 22: 160-165
[14] Guo M, Rupe M A, Danilevskaya O N, Yang X, Hu Z.Genome-wide mRNA profiling reveals heterochronic allelic variation and a new imprinted gene in hybrid maize endosperm.Plant J, 2003, 36: 30-44
[15] Chaudhuri S, Messing J.Allele-specific parental imprinting of dzr1, a posttranscriptional regulator of zein accumulation. Proc Natl Acad Sci USA, 1994, 91: 4867-4871
[16] Haun W J, Laoueillé‐Duprat S, O'connell M J, Spillane C, Grossniklaus U, Phillips A R, Kaeppler S M, Springer N M. Genomic imprinting, methylation and molecular evolution of Maize enhancer of zeste(Mez) homologs. Plant J, 2007, 49: 325-337
[17] Jahnke S, Scholten S.Epigenetic resetting of a gene imprinted in plant embryos.Curr Biol, 2009, 19: 1677-1681
[18] Danilevskaya O N, Hermon P, Hantke S, Muszynski M G, Kollipara K, Ananiev E V.Duplicated fie genes in maize expression pattern and imprinting suggest distinct functions. Plant Cell, 2003, 15: 425-438
[19] Mei X, Liu C, Yu T, Liu X, Xu D, Wang J, Wang G, Cai Y.Identification and characterization of paternal-preferentially expressed geneNF-YC8 in maize endosperm. Mol Genet Genomics, 2015, 290: 1819-1831
[20] Gutierrez-Marcos J F, Pennington P D, Costa L M, Dickinson H G. Imprinting in the endosperm: a possible role in preventing wide hybridization.Phil Trans R Soc Lond B, 2003, 358: 1105-1111
[21] Zhang M, Zhao H, Xie S, Chen J, Xu Y, Wang K, Zhao H, Guan H, Hu X, Jiao Y.Extensive, clustered parental imprinting of protein-coding and noncoding RNAs in developing maize endosperm.Proc Natl Acad Sci USA, 2011, 108: 20042-20047
[22] Thiel T, Kota R, Grosse I, Stein N, Graner A.SNP2CAPS: a SNP and INDEL analysis tool for CAPS marker development.Nucl Acids Res, 2004, 32: e5-e5
[23] Fu D, Dunbar M, Dubcovsky J.Wheat VIN3-like PHD finger genes are up-regulated by vernalization. Mol Genet Genomics, 2007, 277: 301-313
[24] Tamura K, Stecher G, Peterson D, Filipski A, Kumar S.MEGA6: molecular evolutionary genetics analysis version 6.0.Mol Biol Evol, 2013, 30: 2725-2729
[25] Saitou N, Nei M.The neighbor-joining method: a new method for reconstructing phylogenetic trees.Mol Biol Evol, 1987, 4: 406-425
[26] Sung S, Amasino R M.Vernalization in Arabidopsis thaliana is mediated by the PHD finger protein VIN3. Nature, 2004, 427: 159-164
[27] Sung S, Schmitz R J, Amasino R M.A PHD finger protein involved in both the vernalization and photoperiod pathways in Arabidopsis. Gene Dev, 2006, 20: 3244-3248
[28] Davidson R M, Hansey C N, Gowda M, Childs K L, Lin H, Vaillancourt B, Sekhon R S, de Leon N, Kaeppler S M, Jiang N. Utility of RNA sequencing for analysis of maize reproductive transcriptomes.Plant Genome, 2011, 4: 191-203
[29] Li P, Ponnala L, Gandotra N, Wang L, Si Y, Tausta S L, Kebrom T H, Provart N, Patel R, Myers C R.The developmental dynamics of the maize leaf transcriptome.Nat Genet, 2010, 42: 1060-1067
[30] Wang X, Elling A A, Li X, Li N, Peng Z, He G, Sun H, Qi Y, Liu X S, Deng X W.Genome-wide and organ-specific landscapes of epigenetic modifications and their relationships to mRNA and small RNA transcriptomes in maize.Plant Cell, 2009, 21: 1053-1069
[31] Jia Y, Lisch D R, Ohtsu K, Scanlon M J, Nettleton D, Schnable P S.Loss of RNA-dependent RNA polymerase 2 (RDR2) function causes widespread and unexpected changes in the expression of transposons, genes, and 24-nt small RNAs.PLoS Genet, 2009, 5: e1000737
[32] Bai F, Settles A.Imprinting in plants as a mechanism to generate seed phenotypic diversity.Front Plant Sci, 2014, 5: 1-10
[33] Raissig M T, Bemer M, Baroux C, Grossniklaus U.Genomic imprinting in the Arabidopsis embryo is partly regulated by PRC2. PLoS Genet, 2013, 9: e1003862
[34] Feil R, Berger F.Convergent evolution of genomic imprinting in plants and mammals.Trends Genet, 2007, 23: 192-199
[35] Berger F, Chaudhury A.Parental memories shape seeds.Trends Plant Sci, 2009, 14: 550-556
[36] Haig D, Westoby M.Genomic imprinting in endosperm: its effect on seed development in crosses between species, and between different ploidies of the same species, and its implications for the evolution of apomixis.Phil Trans R Soc Lond B, 1991, 333: 1-13
[37] Greb T, Mylne J S, Crevillen P, Geraldo N, An H, Gendall A R, Dean C.The PHD finger protein VRN5 functions in the epigenetic silencing of Arabidopsis FLC. Curr Biol, 2007, 17: 73-78
[38] Kim D H, Sung S.The Plant Homeo Domain finger protein, VIN3-LIKE 2, is necessary for photoperiod-mediated epigenetic regulation of the floral repressor, MAF5.Proc Natl Acad Sci USA, 2010, 107: 17029-17034
[39] Yang J, Lee S, Hang R, Kim S R, Lee Y S, Cao X, Amasino R, An G.OsVIL2 functions with PRC2 to induce flowering by repressing OsLFL1 in rice. Plant J, 2013, 73: 566-578
[1] Zuo Tong-Hong, Zhang He-Cui, Zeng Jing, Zhu Li-Quan. Molecular cloning and expression analysis of BoPUB3L associated with self-incompatibility in Brasscia oleracea [J]. Acta Agronomica Sinica, 2026, 52(6): 1698-1710.
[2] SONG Song-Quan, TANG Cui-Fang, CHENG Hong-Yan, WANG Cheng-Liang, YUAN Liang-Bing, ZUO Sheng. Endosperm development of cereal crops and its role in seed dormancy and germination [J]. Acta Agronomica Sinica, 2025, 51(5): 1133-1155.
[3] WANG Lin, CHEN Xiao-Yu, ZHANG Wen-Meng-Long, WANG Si-Qi, CHENG Bing-Yun, CHENG Jing-Qiu, PAN Rui, ZHANG Wen-Ying. Molecular characteristics and functional analysis of HvMYB2 in response to drought stress in barley [J]. Acta Agronomica Sinica, 2025, 51(4): 873-887.
[4] ZHANG Zheng-Kang, SU Yan-Hong, RUAN Sun-Mei, ZHANG Min, ZHANG Pan, ZHANG Hui, ZENG Qian-Chun, LUO Qiong. Cloning and functional study of OgXa13 in Oryza meyeriana [J]. Acta Agronomica Sinica, 2025, 51(2): 334-346.
[5] WANG Yu-Jiao, WANG Yong-Le, TIAN Chang-Jiu, YU Chun-Wang, LYU Jia-Bin, ZHU Jia-Bao. Cloning of the VQ4 gene and preliminary analysis of its role in salt tolerance in Coix lacryma-jobi L. [J]. Acta Agronomica Sinica, 2025, 51(12): 3198-3210.
[6] WANG Mu-Mu, HE Yan-Fan, ZHENG Yong-Sheng, WANG Hui, WANG Li-Yuan, WANG Dong-Jian, ZHANG Han, LI Ru-Yu. Fine mapping and cloning of a seed shattering gene SH8 in rice (Oryza sativa L.) [J]. Acta Agronomica Sinica, 2022, 48(8): 1948-1956.
[7] CUI Lian-Hua, ZHAN Wei-Min, YANG Lu-Hao, WANG Shao-Ci, MA Wen-Qi, JIANG Liang-Liang, ZHANG Yan-Pei, YANG Jian-Ping, YANG Qing-Hua. Molecular cloning of two maize (Zea mays) ZmCOP1 genes and their transcription abundances in response to different light treatments [J]. Acta Agronomica Sinica, 2022, 48(6): 1312-1324.
[8] ZHOU Hui-Wen, QIU Li-Hang, HUANG Xing, LI Qiang, CHEN Rong-Fa, FAN Ye-Geng, LUO Han-Min, YAN Hai-Feng, WENG Meng-Ling, ZHOU Zhong-Feng, WU Jian-Ming. Cloning and functional analysis of ScGA20ox1 gibberellin oxidase gene in sugarcane [J]. Acta Agronomica Sinica, 2022, 48(4): 1017-1026.
[9] YANG Lu-Hao, WANG Li-Jian, SUN Guang-Hua, WANG Shao-Ci, CUI Lian-Hua, CHEN Chang, SONG Mei-Fang, ZHANG Yan-Pei, JIANG Liang-Liang, YANG Jian-Ping, WANG Chen-Yang. Transcription abundances of PHYA, PHYB, and PHYC genes in response to different light treatments in Secale cereale [J]. Acta Agronomica Sinica, 2022, 48(12): 3057-3070.
[10] XIE Qin-Qin, ZUO Tong-Hong, HU Deng-Ke, LIU Qian-Ying, ZHANG Yi-Zhong, ZHANG He-Cui, ZENG Wen-Yi, YUAN Chong-Mo, ZHU Li-Quan. Molecular cloning and expression analysis of BoPUB9 in self-incompatibility Brassica oleracea [J]. Acta Agronomica Sinica, 2022, 48(1): 108-120.
[11] TANG Rui-Min, JIA Xiao-Yun, ZHU Wen-Jiao, YIN Jing-Ming, YANG Qing. Cloning of potato heat shock transcription factor StHsfA3 gene and its functional analysis in heat tolerance [J]. Acta Agronomica Sinica, 2021, 47(4): 672-683.
[12] YUE Jie-Ru, BAI Jian-Fang, ZHANG Feng-Ting, GUO Li-Ping, YUAN Shao-Hua, LI Yan-Mei, ZHANG Sheng-Quan, ZHAO Chang-Ping, ZHANG Li-Ping. Cloning and potential function analysis of ascorbic peroxidase gene of hybrid wheat in seed aging [J]. Acta Agronomica Sinica, 2021, 47(3): 405-415.
[13] YANG Qin-Li, YANG Duo-Feng, DING Lin-Yun, ZHANG Ting, ZHANG Jun, MEI Huan, HUANG Chu-Jun, GAO Yang, YE Li, GAO Meng-Tao, YAN Sun-Yi, ZHANG Tian-Zhen, HU Yan. Identification of a cotton flower organ mutant 182-9 and cloning of candidate genes [J]. Acta Agronomica Sinica, 2021, 47(10): 1854-1862.
[14] HE Xiao, LIU Xing, XIN Zheng-Qi, XIE Hai-Yan, XIN Yu-Feng, WU Neng-Biao. Molecular cloning, expression, and enzyme kinetic analysis of a phenylalanine ammonia-lyase gene in Pinellia ternate [J]. Acta Agronomica Sinica, 2021, 47(10): 1941-1952.
[15] Tong-Hong ZUO, He-Cui ZHANG, Qian-Ying LIU, Xiao-Ping LIAN, Qin-Qin XIE, Deng-Ke HU, Yi-Zhong ZHANG, Yu-Kui WANG, Xiao-Jing BAI, Li-Quan ZHU. Molecular cloning and expression analysis of BoGSTL21 in self-incompatibility Brasscia oleracea [J]. Acta Agronomica Sinica, 2020, 46(12): 1850-1861.
Viewed
Full text


Abstract

Cited

  Shared   
  Discussed   
No Suggested Reading articles found!