Welcome to Acta Agronomica Sinica,

Acta Agronomica Sinica ›› 2019, Vol. 45 ›› Issue (11): 1615-1627.doi: 10.3724/SP.J.1006.2019.91009

• CROP GENETICS & BREEDING · GERMPLASM RESOURCES · MOLECULAR GENETICS •     Next Articles

Transcription factor gene TaNAC67 involved in regulation spike length and spikelet number per spike in common wheat

ZHANG Hong-Juan1,2,LI Yu-Ying2,3,MIAO Li-Li2,WANG Jing-Yi2,LI Chao-Nan2,YANG De-Long1,*(),MAO Xin-Guo1,2,*(),JING Rui-Lian2   

  1. 1 College of Life Science and Technology, Gansu Agricultural University, Lanzhou 730070, Gansu, China
    2 Institute of Crop Sciences, Chinese Academy of Agricultural Sciences / National Key Facility for Crop Gene Resources and Genetic Improvement / Key Laboratory of Crop Germplasm and Utilization, Ministry of Agriculture, Beijing 100081, China
    3 College of Agriculture, Henan Agricultural University, Zhengzhou 450002, Henan, China
  • Received:2019-01-23 Accepted:2019-05-12 Online:2019-11-12 Published:2019-05-22
  • Contact: De-Long YANG,Xin-Guo MAO E-mail:yangdl@gsau.edu.cn;maoxinguo@caas.cn
  • Supported by:
    This study was supported by the National Key Research and Development Plan(2017YFD0300202);Gansu Agriculture Research System(GARS-01-04)

Abstract:

NAC transcription factor is a plant specific superfamily and plays an essential role in regulating plant growth and development and stress response. Our previous research indicated that TaNAC67 involved in the response to various environmental stimuli and its overexpression resulted in enhanced tolerance to multiple abiotic stresses. To probe its roles in plant growth and development, a panel consisted of 36 wheat accessions with high diversity we need for polymorphism assays. The genomic sequences, covering the promoter region and gene coding region, were obtained by Sanger sequencing, and named as TaNAC67-6A, TaNAC67-6B, and TaNAC67-6D according to their genomic origins. For TaNAC67-6A, a SNP (A/G) at -1516 nt and a 126 bp InDel between -873 and -748 nt were identified in the promoter region, and one CAPS and one allele specific marker were developed, respectively. For TaNAC67-6B, two SNPs, at -2014 and -1916 nt were detected, and two dCAPS markers were developed accordingly. For TaNAC67-6D, two SNPs, one at -1795 nt in the promoter region, and the other at 357 nt in the gene coding region were identified, and one CAPS and one dCAPS marker were designed, respectively. To probe the relationship of molecular markers and potential agronomic traits, we introduced a population (PA) with 282 common wheat accessions to perform association assay. No association was identified between markers from TaNAC67-6A and 6B and agronomic traits. However, strong associations were identified between SNP-D-1and spike length (SL), and between SNP-D-2 and the total number of spikelet per spike (TNSS). Haplotype assays showed there were three major haplotypes in PA, i.e. Hap-6D-1, -2, -3. Furthermore, the SL of accessions with Hap-6D-3 was significant longer than that with the other two haplotypes under all 30 environments, and the TNSS was significant larger under 22 environments, thus Hap-6D-3 is an elite haplotype for both SL and TNSS, which was selected positively in the process of wheat breeding in China. Further transgenic experiments revealed that TaNAC67-overexpressing rice lines had lager panicles and more seeds relative to wild type, which is consistent with the association assay results. Therefore, TaNAC67 is a potential candidate gene in spike traits improvement, and TaNAC67-6D might be used in marker assistant molecular breeding in wheat.

Key words: wheat, transcription factor, single nucleotide polymorphism, functional marker, haplotype, association assay

Table 1

Primers used in experiments"

引物名称
Primer name
引物序列
Primer sequence (5'-3')
退火温度
Annealing temperature (℃)
用途
Purpose
NAC67AsF TGTTCCGTATTCAGTACCGGC 55 基因组特异引物
Genome specific primers
NAC67AsR ACACGTTGACCTTACGAATTACAAG
NAC67BsF TATCTCGTCCACTGTTCTCATCTTC 60
NAC67BsR GACTATTGAGAGGTCAGAAGAAGAATG
NAC67DsF GTTAAAGAGAAAGGGAGGAAGGGA 58
NAC67DsR CGTGAGAGTATTGAGAGCTCAGAAG
NAC67AseqF1 ACGTGTGCCCCTATATTTTTAC 测序引物
Sequencing primers
NAC67AseqF2 GACGGCTGAAACACCTAAAAC
NAC67BseqF1 CCGGGCGCGATGTG
NAC67BseqF2 TTAGACACCTAAAAAGTGTCATCG
NAC67DseqF1 GGCTGACAGTAATGATGTTTAGTG
NAC67DseqF2 GTGCCGTTTGGGTCAGG
NAC67ABDseqR CCCGCGGCGTGAAG
A-1516-F GCCTCCTTGTGACTTTGCGA 65 功能标记特异引物
Specific primers for
functional markers
A-1516-R CGCCGGATAATTACAGGTCAGTT
A-126-F GAAGCCTCATTAGGCCCAATT 65
A-126-R TCGACCGGCCGTAGCCT
B-2014-F GGTCTAAGCGGGGTACCGGACTGCA 61
B-2014-R CCTTCTTTGGTATGCCAGGAACTCA
B-1916-F TTGCACAACATGATCATTGAGAGCTA 61
B-1916-R TCACACATCGCGCCCGGC
D-1795-F AGACGATGTGAAGACGACCAAGA 61
D-1795-R ACTGTGGTTCGTGCAACCCTAG
D357-F CCCATCATCGCCGAGGTCGA 64
D357-R CTTCTTGATCCCGACGGTCCTG

Fig. 1

TaNAC67-6A sequence polymorphism (A) and allele specific marker SNP-A-1 (B), and CAPS marker SNP-A-2 (C) Fig. C: if the nucleotide at -1516 nt is A, the PCR product cannot be digested; if it is G, the PCR products can be digested. M: 100 bp DNA ladder."

Fig. 2

TaNAC67-6B sequence polymorphism (A), dCAPS marker SNP-B-1 (B), and SNP-B-2 (C) Fig. B: if the genotype at -2014 nt is C the PCR products can be digested; if it is T the PCR products cannot be digested. Fig. C: if the genotype at-1916 nt is T, the PCR products cannot be digested, if it is C the PCR products can be digested. M: 100 bp DNA ladder."

Fig. 3

TaNAC67-6D sequence polymorphisms (A) and CAPS marker SNP-D-1 (B) and dCAPS marker SNP-B-2 (C) Fig. B: if the genotype at -1795 nt is G, the PCR products can be digested; if it is T the PCR products cannot be digested. Fig. C: if the genotype at 357 nt is T the PCR products cannot be digested, if it is C the PCR products can be digested. M: 100 bp DNA ladder."

Table 2

Associations between SNP-D-1, SNP-D-2 of TaNPC67-6D and agronomic traits"

年份
Year
地点
Site
环境条件
Environment
性状Trait (P-value)
SNP-D-1-SL SNP-D-2-TNSS
2010 SY DS 2.43E-04*** n.s.
DS+HS 0.00327*** n.s.
WW 0.00346*** 0.02375*
WW+HS 0.01165* 0.00126***
2011 SY DS+HS 0.00162*** n.s.
DS 3.63E-04*** n.s.
WW+HS 1.72E-05*** n.s.
WW 5.24E-04*** 0.03478*
2012 SY DS+HS 0.00192*** 0.00506**
DS 0.00159*** 0.0313*
WW+HS 0.02646* n.s.
WW 0.00363*** 0.03707*
2013 CP DS 0.00129*** 0.01055*
WW 0.00168*** n.s.
2015 SY DS+HS 2.81E-04*** 0.00336***
DS 0.00121*** 0.01369*
WW+HS 0.00268*** n.s.
WW 0.02357* n.s.
2016 SY DS+HS 0.00895** n.s.
DS 0.00996** 0.01447*
WW+HS 9.65E-05*** 0.00877**
WW 0.00788** 4.15E-04***
CP WW 0.0022*** 0.00386***
DS 0.00598** 0.03743*
2017 SY DS+HS 5.86E-04*** 0.02236*
DS 0.01736* 3.51E-05***
WW+HS 9.82E-04*** 0.0054**
WW 0.00184*** 0.01334*
CP DS 0.00153*** 0.02641*
WW 0.00296*** 0.00599***

Fig. 4

Phenotypic comparisons of two genotypes for SNP-D-1 and SNP-D-2 under 30 environmental conditions Comparisons of spike length (A) and total number of spikelet per spike (B) for two genotypes of SNP-D-1 (A) and SNP-D-2 (B) under 30 environmental conditions. *, **, *** represent significant at the 0.05, 0.01, 0.001 probability levels, respectively."

Fig. 5

Phenotypic comparisons of three Haplotypes for TaNAC67-6D under 30 environmental conditions Comparisons of spike length (A) and total number of spikelet per spike (B) for three haplotypes of TaNAC67-6D under 30 environments. Bars superscripted by different letters are significantly different at the 0.05 probability level."

Fig. 6

Geographical distributions of the three haplotypes for TaNAC67-6D in the ten wheat zones in China Haplotype distributions of TaNAC67-6D in landrace (A) and modern variety (B) populations. I: Northern Winter Wheat Zone; II: Yellow and Huai River Valleys Facultative Wheat Zone; III: Middle and Low Yangtze Valleys Autumn-Sown Spring Wheat Zone; IV: Southwestern Autumn-Sown Spring Wheat Zone; V: Southern Autumn-Sown Spring Wheat Zone; VI: Northeastern Spring Wheat Zone; VII: Northern Spring Wheat Zone; VIII: Northwestern Spring Wheat Zone; IX: Qinghai-Tibetan Plateau Spring-Winter Wheat Zone; X: Xinjiang Winter-Spring Wheat Zone."

Fig. 7

Comparisons of panicle traits between transgenic rice and WT control Comparisons of panicle traits between transgenic rice (L1, L2) and WT in panicle phenotype (A), panicle length (B), panicle branch (C), grain number per panicle (D), sterile grain number per panicle (E), and thousand grain weight (TGW) (F). ** Significant at the 0.01 probability level."

[1] Huang Q, Wang Y, Li B, Chang J, Chen M, Li K, Yang G, He G . TaNAC29, a NAC transcription factor from wheat, enhances salt and drought tolerance in transgenic Arabidopsis. BMC Plant Biol, 2015,15:268.
[2] Jin C, Li K Q, Xu X Y, Zhang H P, Chen H X, Chen Y H, Hao J, Wang Y, Huang X S, Zhang S L . A novel NAC transcription factor, PbeNAC1, of Pyrus betulifolia confers cold and drought tolerance via interacting with PbeDREBs and activating the expression of stress-responsive genes. Front Plant Sci, 2017,8:1049.
[3] Hu H, You J, Fang Y, Zhu X, Qi Z, Xiong L . Characterization of transcription factor gene SNAC2 conferring cold and salt tolerance in rice. Plant Mol Biol, 2010,72:567-568.
[4] Aida M, Ishida T, Fukaki H, Fujisawa H, Tasaka M . Genes involved in organ separation in Arabidopsis: an analysis of the cup-shaped cotyledon mutant. Plant Cell, 1997,9:841-857.
[5] Taoka K, Yanagimoto Y, Daimon Y, Hibara K, Aida M, Tasaka M . The NAC domain mediates functional specificity of cup-shaped cotyledon proteins. Plant J, 2004,40:462.
[6] Nakashima K, Tran L S, Van Nguyen D, Fujita M, Maruyama K, Todaka D, Ito Y, Hayashi N, Shinozaki K, Yamaguchi-Shinozaki K . Functional analysis of a NAC-type transcription factor OsNAC6 involved in abiotic and biotic stress-responsive gene expression in rice. Plant J, 2007,51:617-630.
[7] Nuruzzaman M, Manimekalai R, Sharoni A M, Satoh K, Kondoh H, Ooka H, Kikuchi S . Genome-wide analysis of NAC transcription factor family in rice. Gene, 2010,465:30-44.
[8] Souer E, van Houwelingen Adèle, Kloos D, Mol J, Koes R . Kloos The no apical meristem gene of Petunia is required for pattern formation in embryos and flowers and is expressed at meristem and primordia boundaries. Cell, 1996,85:159-170.
[9] Chen X, Cheng J, Chen L, Zhang G, Huang H, Zhang Y, Xu L . Auxin-independent NAC pathway acts in response to explant- specific wounding and promotes root tip emergence during de novo root organogenesis in Arabidopsis. Plant Physiol, 2016,170:2136-2145.
[10] Redillas M C, Jeong J S, Kim Y S, Jung H, Bang S W, Choi Y D, Ha S H, Reuzeau C, Kim J K . The overexpression of OsNAC9 alters the root architecture of rice plants enhancing drought resistance and grain yield under field conditions. Plant Biotechnol J, 2012,10:792-805.
[11] Shim J S, Oh N, Chung P J, Kim Y S, Choi Y D, Kim J K . Overexpression of OsNAC14 improves drought tolerance in rice. Front Plant Sci, 2018,9:310.
[12] Lee D K, Chung P J, Jeong J S, Jang G, Bang S W, Jung H, Kim Y S, Ha S H, Choi Y D, Kim J K . The rice OsNAC6 transcription factor orchestrates multiple molecular mechanisms involving root structural adaptions and nicotianamine biosynthesis for drought tolerance. Plant Biotechnol J, 2017,15:754-764.
[13] Li J, Guo G H, Guo W W, Guo G G, Tong D, Ni Z F, Sun Q X, Yao Y Y . miRNA164-directed cleavage of ZmNAC1 confers lateral root development in maize (Zea mays L.). BMC Plant Biol, 2012,12:220.
[14] Chen D D, Chai S C, Mcintyre C L, Xue G P . Overexpression of a predominantly root-expressed NAC transcription factor in wheat roots enhances root length, biomass and drought tolerance. Plant Cell Rep, 2018,37:225-237.
[15] Chen D, Richardson T, Chai S, Lynne Mcintyre C, Rae A L, Xue G P . Drought-up-regulated TaNAC69-1 is a transcriptional repressor of TaSHY2 and TaIAA7, and enhances root length and biomass in wheat. Plant Cell Physiol, 2016,57:2076-2090.
[16] Li W, Li X X, Chao J T, Zhang Z L, Wang W F, Guo Y F . NAC family transcription factors in tobacco and their potential role in regulating leaf senescence. Front Plant Sci, 2018,9:1900
[17] Zhao F L, Ma J H, Li L B, Fan S L, Guo Y N, Song M Z, Wei H L, Pang C Y, Yu S X . GhNAC12, a neutral candidate gene, leads to early aging in cotton(Gossypium hirsutum L.). Gene, 2015,576:268-274.
[18] Ren T T, Wang J W, Zhao M M, Gong X M, Wang S X, Wang G, Zhou C J . Involvement of NAC transcription factor SiNAC1 in a positive feedback loop via ABA biosynthesis and leaf senescence in foxtail millet. Planta, 2017,247:1-16.
[19] El Mannai Y, Akabane K, Hiratsu K, Satoh-Nagasawa N, Wabiko H . The NAC transcription factor gene OsY37 (ONAC011) promotes leaf senescence and accelerates heading time in rice. Int J Mol Sci, 2017,18:2165.
[20] Christiansen M W, Matthewman C, Podzimska-Sroka D, O’Shea C, Lindemose S, Mollegaard N E, Holme I B, Hebelstrup K, Skriver K, Gregersen P L . Barley plants over-expressing the NAC transcription factor gene HvNAC005 show stunting and delay in development combined with early senescence. J Exp Bot, 2016,67:5259-5273.
[21] Collinge M, Boller T . Differential induction of two potato genes, Stprx2 and StNAC, in response to infection by Phytophthora infestans and to wounding. Plant Mol Biol, 2001,46:521-529.
[22] Xia N, Zhang G, Liu X Y, Deng L, Cai G L, Zhang Y, Wang X J, Zhao J, Huang L L, Kang Z S . Characterization of a novel wheat NAC transcription factor gene involved in defense response against stripe rust pathogen infection and abiotic stresses. Mol Biol Rep, 2010,37:3703-3712.
[23] Wang B, Wei J, Song N, Wang N, Zhao J, Kang Z S . A novel wheat NAC transcription factor, TaNAC30, negatively regulates resistance of wheat to stripe rust. J Integr Plant Biol, 2018,60:432-443.
[24] Wang Z, Xia Y, Lin S, Wang Y, Guo B, Song X, Ding S, Zheng L, Feng R, Chen S, Bao Y, Sheng C, Zhang X, Wu J, Niu D, Jin H, Zhao H . Osa-miR164a targets OsNAC60 and negatively regulates rice immunity against the blast fungus Magnaporthe oryzae. Plant J, 2018,95:584-597.
[25] Liu Q, Yan S J, Huang W J, Yang J Y, Dong J F, Zhang S H, Zhao J L, Yang T F, Mao X X, Zhu X Y . NAC transcription factor ONAC066 positively regulates disease resistance by suppressing the ABA signaling pathway in rice. Plant Mol Biol, 2018,98:289-302.
[26] Mao C, Ding J, Zhang B, Xi D, Ming F . OsNAC2 positively affects salt-induced cell death and binds to the OsAP37 and OsCOX11 promoters. Plant J, 2018,94:454-468.
[27] Shen J, Lü B, Luo L, He J, Mao C, Xi D, Ming F . The NAC-type transcription factor OsNAC2 regulates ABA-dependent genes and abiotic stress tolerance in rice. Sci Rep, 2017,7:40641.
[28] Chung P J, Jung H, Choi Y D, Kim J K . Genome-wide analyses of direct target genes of four rice NAC-domain transcription factors involved in drought tolerance. BMC Genom, 2018,19:40.
[29] 卢敏, 张登峰, 石云素, 宋燕春, 黎裕, 王天宇 . 玉米胁迫诱导表达基因ZmSNAC1的功能分析. 作物学报, 2013,39:2177-2182.
Lu M, Zhang D F, Shi Y S, Song Y C, Li Y, Wang T Y . Overexpression of a stress induced maize NAC transcription factor gene, ZmSNAC1, improved drought and salt tolerance in Arabidopsis. Acta Agron Sin, 2013,39:2177-2182 (in Chinese with English abstract).
[30] Mao H, Yu L, Han R, Li Z, Liu H . ZmNAC55, a maize stress-responsive NAC transcription factor, confers drought resistance in transgenic Arabidopsis. Plant Physiol Biochem, 2016,105:55-66.
[31] Xia N, Zhang G, Yan F, Zhu L, Xu L S, Chen X M, Liu B O . TaNAC8, a novel NAC transcription factor gene in wheat, responds to stripe rust pathogen infection and abiotic stresses. Physiol Mol Plant Pathol, 2010,74:394-402.
[32] Mao X G, Zhang H Y, Qian X Y, Li A, Zhao G Y, Jing R L . TaNAC2, a NAC-type wheat transcription factor conferring enhanced multiple abiotic stress tolerances in Arabidopsis. J Exp Bot, 2012,63:2933-2946.
[33] Mao X G, Chen S S, Li A, Zhai C C, Jing R L . Novel NAC transcription factor TaNAC67 confers enhanced multi-abiotic stress tolerances in Arabidopsis. PLoS One, 2014,9:e84359.
[34] 金善宝 . 中国小麦学. 北京: 中国农业出版社, 1996. pp 95-124.
Jin S B . Chinese Wheat. Beijing: China Agriculture Press, 1996. pp 95-124(in Chinese).
[35] Shiriga K, Sharma R, Kumar K, Yadav S K, Hossain F, Thirunavukkarasu N . Genome-wide identification and expression pattern of drought-responsive members of the NAC family in maize. Meta Gene, 2014,2:407-417.
[36] Singh A K, Sharma V, Pal A K, Acharya V, Ahuja P S . Genome-wide organization and expression profiling of the NAC transcription factor family in potato (italic>Solanum tuberosum.). DNA Res, 2013,20:403-423.
[37] Borrill P, Harrington S A, Uauy C . Genome-wide sequence and expression analysis of the NAC transcription factor family in polyploid wheat. G3: Genes Genom Genet, 2017,7:3019-3029.
[38] Huysmans M, Buono R A, Skorzinski N, Radio M C, De Winter F, Parizot B, Mertens J, Karimi M, Fendrych M, Nowack M K . NAC transcription factors ANAC087 and ANAC046 control distinct aspects of programmed cell death in the Arabidopsis columella and lateral root cap. Plant Cell, 2018,30:2197-2213.
[39] Guo S, Dai S, Singh P K, Wang H, Wang Y, Tan J L H, Wee W, Ito T . A membrane-bound NAC-like transcription factor OsNTL5 represses the flowering in Oryza sativa. Front Plant Sci, 2018,9:555.
[1] Chen Guo-Huan, Zhang Rui, Li Yan-Di, Zhao Jia-Qi, Ren Yong-Tao, Zhang Tian-Ci, Guo Hua-Chun, Li Jun, Yang Fang. Effects of foliar application of exogenous selenium on anthocyanin biosynthesis in tubers of light purple-fleshed potatoes [J]. Acta Agronomica Sinica, 2026, 52(6): 1876-1890.
[2] Zhai Sheng-Nan, Cao Xin-You, Li Hao-Sheng, Li Ji-Hu, Li Fa-Ji, Liu Jin-Dong, Xia Xian-Chun, Lyu Ying-Ying, Ma Rui-Feng, Wang Ying, Geng Hong-Wei, Liu Jian-Jun. Analysis of the genetic effects of allelic variation at the Pod-A1, Pod-D1, and Pod-2D loci on peroxidase activity in wheat grains [J]. Acta Agronomica Sinica, 2026, 52(6): 1593-1603.
[3] Xi Qian-Hui, Xu Zi-Yuan, Liu Meng-Meng, Wang Hong-Yi, Lang Kai-Lin, Jing Zhen-Hai, Chen Feng, Zhao Lei. Genome-wide association study and candidate gene prediction of grain copper content in wheat [J]. Acta Agronomica Sinica, 2026, 52(6): 1604-1617.
[4] Mao Jia-Qi, Huang Peng-Yu, Zhao Jia-Jia, Zheng Xing-Wei, Wu Bang-Bang, Hao Yu-Qiong, Qu Fei, Liu Cheng, Ma Peng-Tao, Zheng Jun. Evaluation of powdery mildew resistance in wheat cultivars and molecular detection of resistance genes in Shanxi province, China [J]. Acta Agronomica Sinica, 2026, 52(6): 1669-1681.
[5] Hu Chuan, Zhao Kai-Nan, Huang Xiu-Li, Wu Jin-Zhi, Ren Kai-Ming, Wang He-Zheng, Fu Guo-Zhan, Huang Ming, Li You-Jun. Effects of tillage methods and nitrogen rates on yield and quality of dryland wheat under one-off irrigation [J]. Acta Agronomica Sinica, 2026, 52(6): 1830-1846.
[6] Chen Xue-Yan, He Hua-Chuan, Li Zheng-Jia, Dong Xin-Pan, Li Ou-Qi, Liu Xiao-Yun, Li Dan-Ping, Chen Zhi-Wei, Liu Guo-Xia, Lyu Sheng-Yuan, Wu Yin-Ying, Zhao Zhen-Dong, Cao Xin-You, Wan He-Ping. Dynamic changes in root organic acid secretion and its transcriptional regulatory mechanisms in ‘Jimai 60’ seedlings under combined salinity-alkalinity stress in hydroponics [J]. Acta Agronomica Sinica, 2026, 52(6): 1859-1875.
[7] Peng Jia-Luo, Li Ying, Li Dan-Dan, Yang Jun-Ning, Guo Xue-Feng, Zhang Wen-Jiao, Yu Xiao-Xue, Zhou Ya-Rong, Wang Zhen-Yu, Wang Cai-Xiang, Ma Xiong-Feng, Su Jun-Ji. Identification of class I LBD family members in upland cotton and function and haplotype analyses of GhLBD6 in regulating flowering period [J]. Acta Agronomica Sinica, 2026, 52(6): 1682-1697.
[8] Gao Pei-Yang, Li Jin-Xuan, Dong Yu-Kui, Shi Yu, Zhang Zhen, Zhang Yong-Li. Response of wheat tillering and spike formation to nitrogen rate under supplementary irrigation based on soil moisture content [J]. Acta Agronomica Sinica, 2026, 52(6): 1847-1858.
[9] Tang Kuan-Qiang, Li Gong-Yun, Song Mei-Yi, Zhao Xue, Chang Chun-Ling. Genome-wide association analysis and prediction model construction for soybean plant height [J]. Acta Agronomica Sinica, 2026, 52(6): 1743-1756.
[10] Wang Wen-Yuan, Yan Xue-Jia, Liu Yu-Lin, Sun Xiao-Tong, Li Ya-Nan, Tang Xin-Hua, Shi Ying. Screening of low-light-tolerant potato varieties and cloning and functional analysis of the transcription factor gene StPIF3 [J]. Acta Agronomica Sinica, 2026, 52(6): 1631-1645.
[11] Zou Yi-Mei, Xu Min, Wang Hai-Yang, Yao Hui, Wang Jia-Feng, Liu Hao, Ren Dai-Sheng. Analysis of transcription factor regulatory networks in two-line male sterile rice seedling roots in response to salt stress [J]. Acta Agronomica Sinica, 2026, 52(6): 1728-1742.
[12] Zhang Xian-Feng, Guo Li-Jian, Li Kang-Chun, Kong Bin-Xue, Liu Yu-Fang, Che Zhuo, Yang De-Long. Identification of the ABHD6 gene family and development of functional markers for grain weight in wheat [J]. Acta Agronomica Sinica, 2026, 52(6): 1711-1727.
[13] Wang Zhuang-Zhuang, Wu Zi-Jun, Zhang Yong-Xin, Zhang Xin-Yuan, Yuan Li-Xue, Chen Ru-Xue, Liu Shi-Ju, Duan Jian-Zhao, Feng Wei, Wang Tong-Chao, Wang Yong-Hua. Optimized water-nitrogen synergy enhances winter wheat yield and nitrogen use efficiency in clay-loam fluvo-aquic soils of southeastern Henan, China [J]. Acta Agronomica Sinica, 2026, 52(5): 1501-1521.
[14] Cai Zhao-Qin, He Guan-Yong, He Wen, Ruan Li-Xia, Liang Zhen-Hua, Li Yong-Zhen, Li Heng-Rui, Chen Hui-Xian. Dynamic transcriptome analysis and key gene discovery during cassava branching development [J]. Acta Agronomica Sinica, 2026, 52(5): 1430-1441.
[15] He Wan-Long, Geng Hong-Wei, Zhang Fei-Fei, Mikereayi·Ababaikere , Luo Zi-Yang, Li Peng-Cheng, Zhou Zhao-Yu, Cheng Yu-Kun. Development of a deep learning-based image recognition system for major wheat diseases [J]. Acta Agronomica Sinica, 2026, 52(5): 1401-1417.
Viewed
Full text


Abstract

Cited

  Shared   
  Discussed   
No Suggested Reading articles found!