Welcome to Acta Agronomica Sinica,

Acta Agronomica Sinica ›› 2019, Vol. 45 ›› Issue (12): 1841-1850.doi: 10.3724/SP.J.1006.2019.94049

• CROP GENETICS & BREEDING · GERMPLASM RESOURCES · MOLECULAR GENETICS • Previous Articles     Next Articles

Identification and expression analysis of GRF transcription factor family of Chenopodium quinoa

Pi-Biao SHI1,Bing HE2,Yue-Yue FEI1,Jun WANG1,Wei-Yi WANG1,Fu-You WEI1,Yuan-Da LYU2,Min-Feng GU1,*()   

  1. 1 Xinyang Agricultural Experiment Station of Yancheng City, Yancheng 224049, Jiangsu, China
    2 Jiangsu Academy of Agricultural Sciences, Nanjing 210014, Jiangsu, China
  • Received:2019-03-22 Accepted:2019-06-22 Online:2019-12-12 Published:2019-07-13
  • Contact: Min-Feng GU E-mail:ycgmf@126.com
  • Supported by:
    This study was supported by the Promotion Demonstration Base Program (Yancheng) of Jiangsu Modern Agriculture (Vegetable) Industry Technology System(JATS(2018)137);Exploratory and Disruptive Innovation Program of Jiangsu Academy of Agricultural Sciences(ZX(17)2015)

Abstract:

Growth-regulating factors (GRFs) are plant-specific proteins which play an important role in regulating plant growth and development. Quinoa is one of the plant sources that can meet human daily nutritional needs and is also considered as one of the most promising crops in the future. However, no systematical study about GRF gene family has been performed in quinoa to date. In this study, the GRFs in the whole genome of quinoa were identified by bioinformatics method, and their physicochemical properties, gene structure, conserved domain, phylogenetic relationship and tissue expression were analyzed. There were 18 GRF transcription factors in quinoa, with the protein length from 77 to 621 aa, the molecular weight from 8.81 to 67.38 kD and the isoelectric point from 5.23 to 9.37. Each member contained 1-4 introns and 2-5 exons. And all 18 GRF proteins possessed highly conserved QLQ domain composed of 31-35 aa or WRC domain composed of 25-43 aa. Phylogenetic analysis showed that the GRF transcription factors were more closely related between quinoa and Arabidopsis than between quinoa and rice. The expression level of GRFs was higher in seed, moderate in inflorescence and root, and relatively lower in other tissues, showing obvious tissue expression specificity.

Key words: Chenopodium quinoa, GRF transcription factor, phylogenetic analysis, expression analysis

Table 1

Primer sequences for RT-qPCR"

基因 Gene 正向引物 Forward primer (5°-3°) 反向引物 Reverse primer (5°-3°)
EF1a GTACGCATGGGTGCTTGACAAACTC ATCAGCCTGGGAGGTACCAGTAAT
AUR62001481 TCCCACCTGAACTCTTCTCTGCT ACATCTTCCTGGCTCTGGGTCT
AUR62002094 GGAGGCATGGTCGGGTTTGG GGGATCGTGGACTGGCTGAG
AUR62009885 CCCTTTCACAGCAAGTCAATGGC AGAGAAGAGTCCAGAAGAAGAGGAAGT
AUR62028212 TGCGCCAAAGAAGCCTACCC GACGACACAGAAGCCGTCGT
AUR62033894 TAGTGGTGCCTGGTGGTGGT GCCTTGCATTCCCTGACTGCT
AUR62043106 ACCGGGAAACCCAACATCGG CCCACCGGCACTCCAATTCA

Table 2

Basic information of GRF gene family members in quinoa"

基因名称
Gene name
Scaffold位置及基因方向
Scaffold location and gene direction (bp)
蛋白长度
Length (aa)
分子量
MW (kDa)
等电点
pI
AUR62001481 C_Quinoa_2716: 5162638-5164244 (+) 248 28.17 9.15
AUR62002094 C_Quinoa_4480: 2028959-2032889 (-) 331 36.64 8.84
AUR62004030 C_Quinoa_2370: 7633423-7637087 (-) 570 61.48 8.25
AUR62004236 C_Quinoa_4250: 1136571-1139467 (+) 362 40.73 9.32
AUR62006018 C_Quinoa_1001: 1290301-1292042 (-) 273 29.95 5.23
AUR62007068 C_Quinoa_1971: 832455-834729 (+) 369 39.86 8.41
AUR62007538 C_Quinoa_2646: 201458-205187 (-) 621 67.38 8.00
AUR62009885 C_Quinoa_2493: 4358019-4358318 (-) 77 8.81 9.18
AUR62013612 C_Quinoa_1412: 163344-166379 (-) 374 41.77 9.37
基因名称
Gene name
Scaffold位置及基因方向
Scaffold location and gene direction (bp)
蛋白长度
Length (aa)
分子量
MW (kD)
等电点
pI
AUR62019933 C_Quinoa_1480: 2623570-2625376 (+) 287 30.90 6.25
AUR62024537 C_Quinoa_2876: 5196136-5201404 (+) 541 58.33 9.11
AUR62025191 C_Quinoa_4329: 621270-623166 (-) 302 33.61 6.59
AUR62028212 C_Quinoa_2933: 1647993-1651942 (-) 325 36.02 8.69
AUR62028983 C_Quinoa_2412: 1335673-1337123 (+) 309 34.31 6.45
AUR62033547 C_Quinoa_1776: 1206319-1208711 (-) 268 28.79 7.79
AUR62033894 C_Quinoa_2654: 4420101-4424297 (+) 532 57.33 8.97
AUR62035608 C_Quinoa_2193: 618326-619612 (+) 283 30.81 5.43
AUR62043106 C_Quinoa_1071: 168739-171090 (-) 270 29.22 6.75

Fig. 1

Phylogenetic tree of GRF gene family in quinoa, Arabidopsis, and rice"

Fig. 2

Phylogenetic tree and gene structure of quinoa GRF gene family"

Fig. 3

Analysis of conserved domains of GRF proteins in quinoa"

Fig. 4

Amino acid sequence alignment of QLQ (A) and WRC (B) domain of quinoa GRF proteins"

Fig. 5

Expression profile analysis of GRF genes in different tissues of quinoa"

Fig. 6

Expression level of six GRF genes in different tissues of quinoa"

[1] Schwechheimer C, Bevan M W . The regulation of transcription factor activity in plants. Trends Plant Sci, 1998,3:378-383.
doi: 10.1016/S1360-1385(98)01302-8
[2] Chen Y, Cao J . Comparative analysis of Dof transcription factor family in maize. Plant Mol Biol Rep, 2015,33:1245-1258.
doi: 10.1007/s11105-014-0835-9
[3] Kim J H, Tsukaya H . Regulation of plant growth and development by the GROWTH-REGULATING FACTOR and GRF- INTERACTING FACTOR duo. J Exp Bot, 2015,66:6093-6107.
doi: 10.1093/jxb/erv349
[4] Jin J P, Tian F, Yang D C, Meng Y Q, Kong L, Luo J C, Gao G . PlantTFDB 4.0: toward a central hub for transcription factors and regulatory interactions in plants. Nucleic Acids Res, 2017,45:1040-1045.
[5] Wang F D, Qiu N W, Ding Q, Li J J, Zhang Y H, Li H Y, Gao J W . Genome-wide identification and analysis of the growth-regulating factor family in Chinese cabbage (Brassica rapa L. ssp. pekinensis). BMC Genomics, 2014,15:807. doi: 10.1186/1471- 2164-15-807.
doi: 10.1186/1471-2164-15-807
[6] Debernardi J M, Mecchia M A, Vercruyssen L, Smaczniak C, Kaufmann K, Inze D, Rodriguez R E, Palatnik J F . Post-transcriptional control of GRF transcription factors by microRNA miR396 and GIF co-activator affects leaf size and longevity. Plant J, 2014,79:413-426.
doi: 10.1111/tpj.12567
[7] Omidbakhshfard M A, Proost S, Fujikura U, Mueller-Roeber B . Growth-regulating factors (GRFs): a small transcription factor family with important functions in plant biology. Mol Plant, 2015,8:998-1010.
doi: 10.1016/j.molp.2015.01.013
[8] Kim J H, Choi D, Kende H . The AtGRF family of putative transcription factors is involved in leaf and cotyledon growth in Arabidopsis. Plant J, 2003,36:94-104.
doi: 10.1046/j.1365-313X.2003.01862.x
[9] Rodriguez R E, Ercoli M F, Debernardi J M, Breakfield N W, Mecchia M A, Sabatini M, Cools T, De Veylder L, Benfey P N, Palatnik J F . MicroRNA miR396 regulates the switch between stem cells and transit-amplifying cells in Arabidopsis roots. Plant Cell, 2015,27:3354-3366.
doi: 10.1105/tpc.15.00452
[10] Kim J H, Kende H . A transcriptional coactivator, AtGIF1, is involved in regulated leaf growth and morphology in Arabidopsis. Proc Natl Acad Sci USA, 2004,101:13374-13379.
doi: 10.1073/pnas.0405450101
[11] van der Knaap E, Kim J H, Kende H . A novel gibberellin-induced gene from rice and its potential regulatory role in stem growth. Plant Physiol, 2000,122:695-704.
doi: 10.1104/pp.122.3.695
[12] Cao Y P, Han Y H, Jin Q, Lin Y, Cai Y P . Comparative genomic analysis of the GRF genes in Chinese pear (Pyrus bretschneideri Rehd), poplar (Populous), grape (Vitis vinifera), Arabidopsis and rice (Oryza sativa) Front Plant Sci 2016,7:1750. doi: 10.3389/fpls.2016.01750.
[13] Choi D, Kim J H, Kende H . Whole genome analysis of the OsGRF gene family encoding plant-specific putative transcription activators in rice(Oryza sativa L.). Plant Cell Physiol, 2004,45:897-904.
doi: 10.1093/pcp/pch098
[14] Rodriguez R E, Mecchia M A, Debernardi J M, Schommer C, Weigel D, Palatnik J F . Control of cell proliferation in Aarabidopsis thaliana by microRNA miR396. Development, 2010,137:103-112.
doi: 10.1242/dev.043067
[15] Horiguchi G, Kim G T, Tsukaya H . The transcription factor AtGRF5 and the transcription coactivator AN3 regulate cell proliferation in leaf primordia of Arabidopsis thaliana. Plant J, 2005,43:68-78.
doi: 10.1111/tpj.2005.43.issue-1
[16] Kim J H, Lee B H . GROWTH-REGULATING FACTOR4 of Arabidopsis thaliana is required for development of leaves, cotyledons, and shoot apical meristem. J Plant Biol, 2006,49:463-468.
doi: 10.1007/BF03031127
[17] Liu D M, Song Y, Chen Z X, Yu D Q . Ectopic expression of miR396 suppresses GRF target gene expression and alters leaf growth in Arabidopsis. Physiol Plant, 2009,136:223-236.
doi: 10.1111/ppl.2009.136.issue-2
[18] Ercoli M F, Rojas A M, Debernardi J M, Palatnik J F, Rodriguez R E . Control of cell proliferation and elongation by miR396. Plant Signal Behav, 2016,11:e1184809
doi: 10.1080/15592324.2016.1184809
[19] Lee B H, Jeon J O, Lee M M, Kim J H . Genetic interaction between GROWTH-REGULATING FACTOR and CUP-SHAPED COTYLEDON in organ separation. Plant Signal Behav, 2015,10:e988071
doi: 10.4161/15592324.2014.988071
[20] Yang F, Liang G, Liu D, Yu D Q . Arabidopsis miR396 mediates the development of leaves and flowers in transgenic tobacco. J Plant Biol, 2009,52:475-481.
doi: 10.1007/s12374-009-9061-7
[21] Liang G, He H, Li Y, Wang F, Yu D Q . Molecular mechanism of miR396 mediating pistil development in Arabidopsis. Plant Physiol, 2014,164:249-258.
doi: 10.1104/pp.113.225144
[22] Baucher M, Moussawi J, Vandeputte O M, Monteyne D, Mol A, Pérez-Morga D, Jaziri M E I . A role for the miR396/GRF network in specification of organ type during flower development, as supported by ectopic expression of Populus trichocarpa miR396c in transgenic tobacco. Plant Biol, 2013,15:892-898.
doi: 10.1111/plb.2013.15.issue-5
[23] Wynn A N, Rueschhoff E E, Franks R G . Transcriptomic characterization of a synergistic genetic interaction during carpel margin meristem development in Arabidopsis thaliana. PLoS One, 2011,6:e26231
doi: 10.1371/journal.pone.0026231
[24] Liu J, Hua W, Yang H L, Zhan G M, Li R J, Deng L B, Wang X F, Liu G H, Wang H Z . The BnGRF2 gene (GRF2-like gene from Brassica napus) enhances seed oil production through regulating cell number and plant photosynthesis. J Exp Bot, 2012,63:3727-3740.
doi: 10.1093/jxb/ers066
[25] Lee B H, Ko J H, Lee S, Lee Y, Pak J H, Kim J H . The Arabidopsis GRF-INTERACTING FACTOR gene family performs an overlapping function in determining organ size as well as multiple developmental properties. Plant Physiol, 2009,151:655-668.
doi: 10.1104/pp.109.141838
[26] Lee B H, Kim J H . Spatio-temporal distribution patterns of GRF-INTERACTING FACTOR expression and leaf size control. Plant Signal Behav, 2014,9:1-4.
[27] Vercruyssen L, Verkest A, Gonzalez N, Heyndrickx K S, Eeckhout D, Han S K, Jégu T, Archacki R, Leene J V, Andriankaja M, De Bodt S, Abeel T, Coppens F, Dhondt S, De Milde L, Vermeersch M, Maleux K, Gevaert K, Jerzmanowski A, Benhamed M, Wagner D, Vandepoele K, De Jaeger G, Inzé D . ANGUSTIFOLIA3 binds to SWI/SNF chromatin remodeling complexes to regulate transcription during Arabidopsis leaf development. Plant Cell, 2014,26:210-229.
doi: 10.1105/tpc.113.115907
[28] Wu L, Zhang D F, Xue M, Qian J J, He Y, Wang S C . Overexpression of the maize GRF10, an endogenous truncated GROWTH- REGULATING FACTOR protein, leads to reduction in leaf size and plant height. J Integr Plant Biol, 2014,56:1053-1063.
doi: 10.1111/jipb.12220
[29] Nelissen H, Eeckhout D, Demuynck K, Persiau G, Walton A, van Bel M, Vervoort M, Candaele J, De Block J, Aesaert S, Van Lijsebettens M, Goormachtig S, Vandepoele K, Van Leene J, Muszynski M, Gevaert K, Inzé D, De Jaeger G, . Dynamic changes in ANGUSTIFOLIA3 complex composition reveal a growth regulatory mechanism in the maize leaf. Plant Cell, 2015,27:1605-1619.
doi: 10.1105/tpc.15.00269
[30] Wu L, Zhang D F, Xue M, Qian J J, He Y, Wang S C . Overexpression of the maize GRF10, an endogenous truncated GROWTH-REGULATING FACTOR protein, leads to reduction in leaf size and plant height. J Integr Plant Biol, 2014,56:1053-1063.
doi: 10.1111/jipb.12220
[31] Omidbakhshfard M A, Fujikura U, Olas J J, Xue G P, Balazadeh S, Mueller-Roeber B . GROWTH-REGULATING FACTOR 9 negatively regulates Arabidopsis leaf growth by controlling ORG3 and restricting cell proliferation in leaf primordia. PLoS Genet, 2018,14:e1007484.
doi: 10.1371/journal.pgen.1007484
[32] Ng S C, Anderson A, Coker J, Ondrus M . Characterization of lipid oxidation products in quinoa (Chenopodium quinoa). Food Chem, 2006,101:185-192.
doi: 10.1016/j.foodchem.2006.01.016
[33] Ogungbenle H N . Nutritional evaluation and functional properties of quinoa (Chenopodium quinoa) flour. Int J Food Sci Nutr, 2009,54:153-158.
doi: 10.1080/0963748031000084106
[34] Razzaghi F, Ahmadi S H, Adolf V I, Jensen C R, Jacobsen S E, Andersen M N . Water relations and transpiration of quinoa (Chenopodium quinoa Willd.) under salinity and soil drying. J Agron Crop Sci, 2011,197:348-360.
doi: 10.1111/j.1439-037X.2011.00473.x
[35] Jacobsen S E, Monteros C, Christiansen J L, Bravo L A, Corcuera L J, Mujica A . Plant responses of quinoa (Chenopodium quinoa Willd.) to frost at various phenological stages. Eur J Agron, 2005,22:131-139.
doi: 10.1016/j.eja.2004.01.003
[36] Hariadi Y, Marandon K, Tian Y, Jacobsen S E, Shabala S . Ionic and osmotic relations in quinoa (Chenopodium quinoa Willd.) plants grown at various salinity levels. J Exp Bot, 2011,62:185-193.
doi: 10.1093/jxb/erq257
[37] Jarvis D E, Ho Y S, Lightfoot D J, Schmockel S M, Li B, Borm T J A, Ohyanagi H, Mineta K, Michell C T, Saber N, Kharbatia N M, Rupper R R, Sharp A R, Dally N, Boughton B A, Woo Y H, Gao G, Schijlen E G W M, Guo X J, Momin A A, Negrão S, Al-Babili S, Gehring C, Roessner U, Jung C, Murphy K, Arold S T, Gojobori T, van der Linden C G, van Loo E N, Jellen E N, Maughan P J, Tester M . The genome of Chenopodium quinoa. Nature, 2017,542:307-312.
doi: 10.1038/nature21370
[38] Liu J X, Wang R M, Liu W Y, Zhang H L, Guo Y D, Wen R Y . Genome-wide characterization of heat-shock protein 70S from Chenopodium quinoa and expression analyses of Cqhsp70s in response to drought stress. Genes, 2018,9:35. doi: 10.3390/ genes9020035.
doi: 10.3390/genes9020035
[39] Zhang D F, Li B, Jia G Q, Zhang T F, Dai J R, Li J S, Wang S C . Isolation and characterization of genes encoding GRF transcription factors and GIF transcriptional coactivators in maize (Zea mays L.). Plant Sci, 2008,175:809-817.
doi: 10.1016/j.plantsci.2008.08.002
[40] Khatun K, Robin A H K, Park J I, Nath U K, Kim C K, Lim K B, Nou I S, Chung M Y . Molecular characterization and expression profiling of tomato GRF transcription factor family genes in response to abiotic stresses and phytohormones. Int J Mol Sci, 2017,18:1056. doi: 10.3390/ijms18051056.
doi: 10.3390/ijms18051056
[41] Noon J B, Hewezi T, Baum T J . Homeostasis in the soybean miRNA396-GRF network is essential for productive soybean cyst nematode infections. J Exp Bot, 2019,70:1653-1668.
doi: 10.1093/jxb/erz022
[42] Vercruyssen L, Tognetti V B, Gonzalez N, Van Dingenen J, De Milde L, Bielach A, De Rycke R, Van Breusegem F, Inzé D . GROWTH REGULATING FACTOR5 stimulates Arabidopsis chloroplast division, photosynthesis, and leaf longevity. Plant Physiol, 2015,167:817-832.
doi: 10.1104/pp.114.256180
[43] Kim J S, Mizoi J, Kidokoro S, Maruyama K, Nakajima J, Nakashima K, Mitsuda N, Takiguchi Y, Ohme-Takagi M, Kondou Y, Yoshizumi T, Matsui M, Shinozaki K, Yamaguchi-Shinozaki K . Arabidopsis growth-regulating factor7 functions as a transcriptional repressor of abscisic acid- and osmotic stress-responsive genes, including DREB2A. Plant Cell, 2012,24:3393-3405.
doi: 10.1105/tpc.112.100933
[44] Chandran V, Wang H, Gao F, Cao X L, Chen Y P, Li G B, Zhu Y, Yang X M, Zhang L L, Zhao Z X, Zhao J H, Wang Y G, Li S, Fan J, Li Y, Zhao J Q, Li S Q, Wang W M . miR396-OsGRFs module balances growth and rice blast disease-resistance. Front Plant Sci, 2019,14:1999. doi: 10.3389/fpls.2018.01999.
[45] Sun P Y, Zhang W H, Wang Y H, He Q, Shu F, Liu H, Wang J, Wang J M, Yuan L P, Deng H F . OsGRF4 controls grain shape, panicle length and seed shattering in rice. J Integr Plant Biol, 2016,58:836-847.
doi: 10.1111/jipb.12473
[46] Li S C, Gao F Y, Xie K L, Zeng X H, Cao Y, Zeng J, He Z S, Ren Y, Li W B, Deng Q M, Wang S Q, Zheng A P, Zhu J, Liu H N, Wang L X, Li P . The OsmiR396c-OsGRF4-OsGIF1 regulatory module determines grain size and yield in rice. Plant Biotechnol J, 2016,14:2134-2146.
doi: 10.1111/pbi.2016.14.issue-11
[47] Panchy N, Lehti-Shiu M, Shiu S H . Evolution of gene duplication in plants. Plant Physiol, 2016,171:2294-2316.
[48] Yang C Y, Huang Y H, Lin C P, Lin Y Y, Hsu H C, Wang C N, Liu L Y, Shen B N, Lin S S . MicroRNA396-targeted SHORT VEGETATIVE PHASE is required to repress flowering and is related to the development of abnormal flower symptoms by the phyllody symptoms1 effector. Plant Physiol, 2015,168:1702-1716.
doi: 10.1104/pp.15.00307
[1] Zuo Tong-Hong, Zhang He-Cui, Zeng Jing, Zhu Li-Quan. Molecular cloning and expression analysis of BoPUB3L associated with self-incompatibility in Brasscia oleracea [J]. Acta Agronomica Sinica, 2026, 52(6): 1698-1710.
[2] Hu Zhao, Qian Run, Xie Feng-Pu, Ying Su-Ping. Genome-wide identification and expression analysis of the SPX gene family in rice under phosphorus treatment [J]. Acta Agronomica Sinica, 2026, 52(6): 1902-1912.
[3] Tian Li-Tao, Ding Ning, Wang Shu-Lin, Qi En-Fang, Zhang Rong, Wang Rui-Rui, Ma Li-Wen, Li Jian-Wu, Yang Jiang-Wei. Genome-wide identification of the Argonaute gene family and its induction by late blight in potato (Solanum tuberosum L.) [J]. Acta Agronomica Sinica, 2026, 52(4): 1116-1126.
[4] Yang Zong-Tao, Yang Ting, Wang Yu-Tong, Ai Jing, Li Yan-Ye, Liu Jia-Yong, Deng Jun, Zhao Yong, Zhang Yue-Bin. Identification and expression analysis of the CLC gene family in sugarcane [J]. Acta Agronomica Sinica, 2026, 52(3): 722-734.
[5] Meng Cheng, Wang Zhe. Genome-wide identification and expression analysis of the ZmPFK gene family under biotic and abiotic stresses in maize [J]. Acta Agronomica Sinica, 2026, 52(3): 764-779.
[6] Zhang Li-Lan, Yang Jun, Wang Rang-Jian. Identification of candidate genes related to glycoside aroma precursor content in tea plant using WGCNA [J]. Acta Agronomica Sinica, 2026, 52(2): 494-513.
[7] Jing Xiu-Qing, Cai Yong-Duo, Deng Ning, Zhao Xiao-Dong, Zhai Fei-Hong, Zeng Qun. Identification and expression pattern analysis of RopGEF family genes in Chenopodium quinoa [J]. Acta Agronomica Sinica, 2026, 52(1): 28-43.
[8] WANG Bin, MENG Jiang-Yu, QIU Hao-Liang, HE Ya-Jun, QIAN Wei. Identification and expression pattern analysis of the BnaDUF579 gene family in Brassica napus [J]. Acta Agronomica Sinica, 2025, 51(8): 2100-2110.
[9] GUO Teng-Da, CUI Meng-Jie, CHEN Lin-Jie, HAN Suo-Yi, GUO Jing-Kun, WU Chen-Di, FU Liu-Yang, HUANG Bing-Yan, DONG Wen-Zhao, ZHANG Xin-You. Cloning and expression analysis of the phosphatidylinositol transfer protein AhSFH gene in peanuts responsive to Aspergillus flavus infection [J]. Acta Agronomica Sinica, 2025, 51(6): 1489-1500.
[10] PAN Ju-Zhong, WEI Ping, ZHU De-Ping, SHAO Sheng-Xue, CHEN Shan-Shan, WEI Ya-Qian, GAO Wei-Wei. Cloning and functional analysis of OsERF104 transcription factor in rice [J]. Acta Agronomica Sinica, 2025, 51(4): 900-913.
[11] QI Jia-Min, XU Chun-Miao, XIAO Bin. Genome-wide identification and expression analysis of TIFY gene family in potato (Solanum tuberosum L.) [J]. Acta Agronomica Sinica, 2024, 50(9): 2297-2309.
[12] CAO Song, YAO Min, REN Rui, JIA Yuan, XIANG Xing-Ru, LI Wen, HE Xin, LIU Zhong-Song, GUAN Chun-Yun, QIAN Lun-Wen, XIONG Xing-Hua. A combination of genome-wide association and transcriptome analysis reveal candidate genes affecting seed oil accumulation in Brassica napus [J]. Acta Agronomica Sinica, 2024, 50(5): 1136-1146.
[13] LI Hai-Fen, LU Qing, LIU Hao, WEN Shi-Jie, WANG Run-Feng, HUANG Lu, CHEN Xiao-Ping, HONG Yan-Bin, LIANG Xuan-Qiang. Genome-wide identification and expression analysis of AhGA3ox gene family in peanut (Arachis hypogaea L.) [J]. Acta Agronomica Sinica, 2024, 50(4): 932-943.
[14] WANG Tian-Ning, FENG Ya-Lan, JU Ji-Hao, WU Yi, ZHANG Jun, MA Chao. Whole genome identification and analysis of GRFs transcription factor family in wheat and its ancestral species [J]. Acta Agronomica Sinica, 2024, 50(4): 897-813.
[15] DAI Hong-Wei, LIU Jie-Qiang, ZHANG Li, TONG Hua-Rong, YUAN Lian-Yu. Cloning and relative expression pattern analysis of CsMCC1 and CsMCC2 in tea plant (Camellia sinensis) [J]. Acta Agronomica Sinica, 2024, 50(3): 656-668.
Viewed
Full text


Abstract

Cited

  Shared   
  Discussed   
No Suggested Reading articles found!