Welcome to Acta Agronomica Sinica，

Acta Agronomica Sinica ›› 2021, Vol. 47 ›› Issue (11): 2184-2198.doi: 10.3724/SP.J.1006.2021.04240

• CROP GENETICS & BREEDING · GERMPLASM RESOURCES · MOLECULAR GENETICS • Previous Articles     Next Articles

Identification and analysis of non-specific lipid transfer protein family in tobacco

LI Peng1(), LIU Che1, SONG Hao1, YAO Pan-Pan1, SU Pei-Lin1, WEI Yao-Wei1, YANG Yong-Xia1,*(), LI Qing-Chang2,*()   

  1. 1Tobacco College, Henan Agricultural University, Zhengzhou 450002, Henan, China
    2Zhengzhou Tobacco Research Institute of CNTC, Zhengzhou 450001, Henan, China
  • Received:2020-11-05 Accepted:2021-04-26 Online:2021-11-12 Published:2021-05-13
  • Contact: YANG Yong-Xia,LI Qing-Chang E-mail:lpeng1995@126.com;yyx624@126.com;ctsrc@126.com
  • Supported by:
    Henan Province Science and Technology Research Plan (Agricultural Field) Project(182102110315);Henan Province Science and Technology Research Plan (Agricultural Field) Project(192102110002);Henan Province Science and Technology Research Plan (Agricultural Field) Project(192102110121);Henan University Student Innovation and Entrepreneurship Training Program(S202010466013);Open Innovation Project of Undergraduate Laboratory of Henan Agricultural University(KF1908)

RichHTML390

22

PDF

1172

Abstract:

Plant non-specific lipid transfer proteins (nsLTPs) can transfer lipids in vitro, regulate plant growth and development, and respond to environmental abiotic and biotic stresses. In this study, 74 nsLTPs genes were identified from the genome of Nicotiana tabacum variety K326, and we analyzed multiple characteristics of these genes, including phylogeny, gene structures, conserved motifs, protein domains, chromosome locations, cis-elements in the promoter sequences, 3D structure, and the expression patterns under different hormones and abiotic stresses. The results revealed that nsLTPs in tobacco could be divided into eight types, including type I, II, III, IV, V, VII, VIII, and XIII, according to the interval and sequence similarity between the eight cysteines. The same types of NtLTPs had similar intron-exon patterns and conserved motifs, motif 2 and motif 3 were the characteristic motifs of NtLTPs family. In the process of evolution, fragment duplication dominated the expansion of the NtLTPs family. RNA-seq analysis after drought treatment revealed that the functional differentiation patterns of repeat gene pairs were diverse during evolution period. Promoter analysis showed that they contained a variety of cis-acting elements in response to light response, hormones, and abiotic stress. Furthermore, qRT-PCR demonstrated that NtLTPs family genes had different expression patterns in different tissues and organs of tobacco plants, which could respond to abiotic stresses such as drought, salt, and hormone treatments (IAA, GA, and SA etc.). These results provide a theoretical reference for the in-depth analysis of the functions of NtLTPs family genes and molecular breeding.

Key words: tobacco, nsLTPs, gene family, bioinformatics, gene expression

Table 1

Primers used in this study"

引物名称Primer name 引物序列Primer sequence (5′-3′)
L25-F CCCCTCACCACAGAGTCTGC
L25-R AAGGGTGTTGTTGTCCTCAATCTT
Nitab4.5_0000125g0010-F CGGATCGCCGGAGTGTTTGC
Nitab4.5_0000125g0010-R GCCACATTTGCCAGGGAGGG
Nitab4.5_0004362g0040-F AAGCCGATTTGCGTTGTATG
Nitab4.5_0004362g0040-R CTTAGGCAGTTTCATAGCAG

Table 2

Diversity of eight-cysteine motifs (ECM) of nsLTPs in tobacco"

类型
Type		 数量
Number of members		 ECM
I 38 C X9,24 C X12-16 CC X19,20,22 CXC X21-23 C X10-15,25 C
II 6 C X7 C X13 CC X8 CXC X23 C X6,10 C
III 1 C X9 C X14 CC X9 CXC X12 C X6 C
IV 10 C X9,10 C X14-16 CC X9,12 CXC X24 C X7-10 C
V 1 C X14 C X14 CC X11 CXC X24 C X10 C
VII 5 C X9 C X14,16 CC X12 CXC X25,27 C X9 C
VIII 7 C X6 C X12,14 CC X12 CXC X25,27 C X8 C
XIII 6 C X9 C X14 CC X12 CXC X26,30 C X8 C

Fig. 1

Distributions of molecular weights and isoelectric points of tobacco nsLTPs"

Fig. 2

Phylogenetic relationship of nsLTPs family in tobacco"

Fig. 3

Conserved motifs of tobacco nsLTPs proteins (middle part) and gene structures of nsLTPs genes (right part) in tobacco"

Fig. 4

Conserved cysteine domain of nsLTPs in tobacco"

Fig. 5

Distribution of nsLTPs genes on the chromosomes in tobacco"

Fig. 6

Gene duplications of nsLTPs genes in tobacco"

Fig. 7

Frequency distribution of Ka and Ka/Ks values of duplicated NtLTPs gene pairs"

Fig. 8

3D-structure of nine nsLTPs proteins in tobacco"

Fig. 9

Cis-acting elements of nsLTPs promoter in tobacco"

Fig. 10

Relative expression profile of variety K326 under drought treatment in tobacco The relative expression levels of nsLTPs are measured by FPKM value in RNA-seq data and the relative expression heatmap are drew after FPKM normalized by log2. CK represents no drought treatment, and D represents drought treatment. Red and white color indicate high and low expression levels, respectively."

Fig. 11

Relative expression levels of Nitab4.5_0000125g0010 (type I) and Nitab4.5_0004362g0040 (type IV) in different tissues of tobacco The relative expression levels in the roots were used as controls, with high and low relative expression levels in red and green, respectively. R: root; ST: stem; L: lugs; ML: middle leaf; UL: upper leaf; F: flower."

Fig. 12

Relative expression patterns of Nitab4.5_0000125g0010 (black) and Nitab4.5_0004362g0040 (gray) under different treatments The relative gene expression was calculated by 2-ΔΔCT method. The relative expression of 0 h was set to 1. Error bars represent the standard deviations of three biological replicates. 37°C: high temperature treatment; NaCl: salt treatment; Mannitol: mannitol treatment; GA: gibberellin treatment; IAA: auxin treatment; MeJA: methyl jasmonate treatment; ABA: abscisic acid treatment; SA: salicylic acid treatment. *: P < 0.05."

[1] Carvalho A O, Gomes V M. Role of plant lipid transfer proteins in plant cell physiology-a concise review. Peptides, 2007, 28: 1144-1153.
doi: 10.1016/j.peptides.2007.03.004
[2] Liu F, Zhang X, Lu C, Zeng X, Li Y, Fu D, Wu G. Non-specific lipid transfer proteins in plants: presenting new advances and an integrated functional analysis. J Exp Bot, 2015, 66: 5663-5681.
doi: 10.1093/jxb/erv313
[3] Jose-Estanyol M, Gomis-Ruth F X, Puigdomenech P. The eight-cysteine motif, a versatile structure in plant proteins. Plant Physiol Biochem, 2004, 42: 355-365.
doi: 10.1016/j.plaphy.2004.03.009
[4] Kader J C. Lipid-transfer proteins in plants. Annu Rev Plant Biol, 1996, 47: 627-654.
[5] Boutrot F, Chantret N, Gautier M F. Genome-wide analysis of the rice and Arabidopsis non-specific lipid transfer protein (nsLtp) gene families and identification of wheat nsLtp genes by EST data mining. BMC Genomics, 2008, 9: 86-108.
doi: 10.1186/1471-2164-9-86 pmid: 18291034
[6] Liu W, Huang D, Liu K, Hu S, Yu J, Gao G, Song S. Discovery, Identification and comparative analysis of non-specific lipid transfer protein (nsLtp) family in Solanaceae. Genom Proteom Bioinf, 2010, 8: 229-237.
doi: 10.1016/S1672-0229(10)60024-1
[7] D’Agostino N, Buonanno M, Ayoub J, Barone A, Monti S M, Rigano M M. Identification of non-specific lipid transfer protein gene family members in Solanum lycopersicum and insights into the features of Sola l 3 protein. Sci Rep (UK), 2019, 9: 1607.
doi: 10.1038/s41598-018-38301-z
[8] Li G, Hou M, Liu Y, Pei Y, Ye M, Zhou Y, Huang C, Zhao Y, Ma H. Genome-wide identification, characterization and expression analysis of the non-specific lipid transfer proteins in potato. BMC Genomics, 2019, 20: 375.
doi: 10.1186/s12864-019-5698-x
[9] Edstam M M, Viitanen L, Salminen T A, Edqvist J. Evolutionary history of the non-specific lipid transfer proteins. Mol Plant, 2011, 4: 947-964.
doi: 10.1093/mp/ssr019
[10] Fang Z W, He Y Q, Liu Y K, Jiang W Q, Song J H, Wang S P, Ma D F, Yin J L. Bioinformatic identification and analyses of the non-specific lipid transfer proteins in wheat. J Integr Agric, 2019, 18: 2-17.
[11] Wei K F, Zhong X J. Non-specific lipid transfer proteins in maize. BMC Plant Biol, 2014, 14: 281.
doi: 10.1186/s12870-014-0281-8
[12] Zhang M Y, Kim Y J, Zong J, Lin H, Dievart A, Li H J, Zhang D B, Liang W Q. Genome-wide analysis of the barley non-specific lipid transfer protein gene family. Crop J, 2019, 7: 65-76.
doi: 10.1016/j.cj.2018.07.009
[13] Chae K, Gonong B J, Kim S C, Kieslich C A, Morikis D, Balasubramanian S, Lord E M. A multifaceted study of stigma/style cysteine-rich adhesin (SCA)-like Arabidopsis lipid transfer proteins (LTPs) suggests diversified roles for these LTPs in plant growth and reproduction. J Exp Bot, 2010, 61: 4277-4290.
doi: 10.1093/jxb/erq228
[14] Maldonado A M, Doerner P, Dixon R A, Lamb C J, Cameron R K. A putative lipid transfer protein involved in systemic resistance signalling in Arabidopsis. Nature, 2002, 419: 399-403.
doi: 10.1038/nature00962
[15] Yeats T H, Rose J K. The biochemistry and biology of extracellular plant lipid-transfer proteins (LTPs). Protein Sci, 2008, 17: 191-198.
doi: 10.1110/ps.073300108
[16] Wang H, Sun Y, Chang J, Zheng F, Pei H, Yi Y, Chang C, Dong C H. Regulatory function of Arabidopsis lipid transfer protein 1 (LTP1) in ethylene response and signaling. Plant Mol Biol, 2016, 91: 471-484.
doi: 10.1007/s11103-016-0482-7
[17] Zaidi M A, O'Leary S J B, Gagnon C, Chabot D, Wu S, Hubbard K, Tran F, Sprott D, Hassan D, Vucurevich T. A triticale tapetal non-specific lipid transfer protein (nsLTP) is translocated to the pollen cell wall. Plant Cell Rep, 2020, 39: 1185-1197.
doi: 10.1007/s00299-020-02556-6
[18] Deng T, Yao H, Wang J, Wang J, Xue H, Zuo K. GhLTPG1, a cotton GPI-anchored lipid transfer protein, regulates the transport of phosphatidylinositol monophosphates and cotton fiber elongation. Sci Rep (UK), 2016, 6: 26829.
doi: 10.1038/srep26829
[19] Potocka I, Baldwin T C, Kurczynska E U. Distribution of lipid transfer protein 1 (LTP1) epitopes associated with morphogenic events during somatic embryogenesis of Arabidopsis thaliana. Plant Cell Rep, 2012, 31: 2031-2045.
doi: 10.1007/s00299-012-1314-0
[20] Finkina E I, Melnikova D N, Bogdanov I V, Ovchinnikova T V. Lipid transfer proteins as components of the plant innate immune system: structure, functions, and applications. Acta Nat, 2016, 8: 47-61.
[21] Gebhardt C, Vieths S, Gubesch M, Averbeck M, Simon J C, Treudler R. 10 kDa lipid transfer protein: the main allergenic structure in a German patient with anaphylaxis to blueberry. Allergy, 2009, 64: 498-499.
doi: 10.1111/j.1398-9995.2008.01923.x pmid: 19220224
[22] Guo L, Yang H, Zhang X, Yang S. Lipid transfer protein 3 as a target of MYB96 mediates freezing and drought stress in Arabidopsis. J Exp Bot, 2013, 64: 1755-1767.
doi: 10.1093/jxb/ert040
[23] McLaughlin J E, Bin-Umer M A, Widiez T, Finn D, McCormick S, Tumer N E. A lipid transfer protein increases the glutathione content and enhances Arabidopsis resistance to a trichothecene mycotoxin. PLoS One, 2015, 10: e0130204.
doi: 10.1371/journal.pone.0130204
[24] Patkar R N, Chattoo B B. Transgenic indica rice expressing ns-LTP-like protein shows enhanced resistance to both fungal and bacterial pathogens. Mol Breed, 2006, 17: 159-171.
doi: 10.1007/s11032-005-4736-3
[25] Wang X, Li Q, Cheng C, Zhang K, Lou Q, Li J, Chen J. Genome-wide analysis of a putative lipid transfer protein LTP_2 gene family reveals CsLTP_2 genes involved in response of cucumber against root-knot nematode (Meloidogyne incognita). Genome, 2020, 63: 225-238.
doi: 10.1139/gen-2019-0157
[26] Zhu X, Li Z, Xu H, Zhou M, Du L, Zhang Z. Overexpression of wheat lipid transfer protein gene TaLTP5 increases resistances to Cochliobolus sativus and Fusarium graminearum in transgenic wheat. Funct Integr Genom, 2012, 12: 481-488.
doi: 10.1007/s10142-012-0286-z
[27] Gaier S, Marsh J, Oberhuber C, Rigby N M, Shewry P R. Purification and structural stability of the peach allergens Pru p 1 and Pru p 3. Mol Nutr Food Res, 2008, 52: S220-229.
[28] Palacin A, Varela J, Quirce S, Pozo V D, Tordesillas L, Barranco P, Fernandez-Nieto M, Sastre J, Diaz-Perales A, Salcedo G. Recombinant lipid transfer protein Tri a 14: a novel heat and proteolytic resistant tool for the diagnosis of baker's asthma. Clin Exp Allergy, 2009, 39: 1267-1276.
doi: 10.1111/j.1365-2222.2009.03280.x pmid: 19486028
[29] Choi Y E, Lim S, Kim H J, Han J Y, Lee M H, Yang Y, Kim J A, Kim Y S. Tobacco NtLTP1, a glandular-specific lipid transfer protein, is required for lipid secretion from glandular trichomes. Plant J, 2012, 70: 480-491.
doi: 10.1111/tpj.2012.70.issue-3
[30] 徐扬. 非特异性脂转移蛋白NtLTP4作为正调控因子参与烟草对非生物和生物胁迫的响应. 山东农业大学博士学位论文, 山东泰安, 2018.
Xu Y. Non-specific Lipid Transfer Protein NtLTP4 as a Positive Regulator Involved in Abiotic and Biotic Stress in Nicotiana tabacum. PhD Dissertation of Shandong Agricultural University, Tai’an, Shandong, China, 2018 (in Chinese with English abstract).
[31] Chen C, Chen H, Zhang Y, Thomas H R, Frank M H, He Y, Xia R. TBtools: an integrative toolkit developed for interactive analyses of big biological data. Mol Plant, 2020, 13: 1194-1202.
doi: 10.1016/j.molp.2020.06.009
[32] Lescot M, Déhais P, Thijs G, Marchal K, Moreau Y, Van de Peer Y, Rouzé P, Rombauts S. PlantCARE, a database of plant cis-acting regulatory elements and a portal to tools for in silico analysis of promoter sequences. Nucleic Acids Res, 2002, 30: 325-327.
doi: 10.1093/nar/30.1.325
[33] Cannon S B, Mitra A, Baumgarten A, Young N D, May G. The roles of segmental and tandem gene duplication in the evolution of large gene families in Arabidopsis thaliana. BMC Plant Biol, 2004, 4: 10.
doi: 10.1186/1471-2229-4-10
[34] Wang L, Guo K, Li Y, Tu Y, Hu H, Wang B, Cui X, Peng L. Expression profiling and integrative analysis of the CESA/CSL superfamily in rice. BMC Plant Biol, 2010, 10: 282.
doi: 10.1186/1471-2229-10-282
[35] Yang Z, Bielawski J P. Statistical methods for detecting molecular. Trends Ecol Evol, 2000, 15: 496-203.
pmid: 11114436
[36] Douliez J P, Michon T, Elmorjani K, Marion D. Mini review: structure, biological and technological functions of lipid transfer proteins and indolines, the major lipid binding proteins from cereal kernels. J Cereal Sci, 2000, 32: 1-20.
doi: 10.1006/jcrs.2000.0315
[37] Deng W, Li R, Xu Y, Mao R, Chen S, Chen L, Chen L, Liu Y G, Chen Y. A lipid transfer protein variant with a mutant eight-cysteine motif causes photoperiod-and thermo-sensitive dwarfism in rice. J Exp Bot, 2020, 71: 1294-1305.
doi: 10.1093/jxb/erz500
[38] Li F, Fan K, Ma F, Yue E, Bibi N, Wang M, Shen H, Hasan M M, Wang X. Genomic identification and comparative expansion analysis of the non-specific lipid transfer protein gene family in Gossypium. Sci Rep(UK)), 2016, 6: 38948.
doi: 10.1038/srep38948
[39] Lynch M. Intron evolution as a population-genetic process. Proc Natl Acad Sci USA, 2002, 99: 6118-6123.
doi: 10.1073/pnas.092595699
[40] Mattick J S, Gagen M J. The evolution of controlled multitasked gene networks: the role of introns and other noncoding RNAs in the development of complex organisms. Mol Biol Evol, 2001, 18: 1611-1630.
pmid: 11504843
[41] Li J, Gao G, Xu K, Chen B, Yan G, Li F, Qiao J, Zhang T, Wu X. Genome-wide survey and expression analysis of the putative non-specific lipid transfer proteins in Brassica rapa L. PLoS One, 2014, 9: e84556.
doi: 10.1371/journal.pone.0084556
[42] Moore R C, Purugganan M D. The evolutionary dynamics of plant duplicate genes. Curr Opin Plant Biol, 2005, 8: 122-128.
doi: 10.1016/j.pbi.2004.12.001
[1] Hu Zhao, Qian Run, Xie Feng-Pu, Ying Su-Ping. Genome-wide identification and expression analysis of the SPX gene family in rice under phosphorus treatment [J]. Acta Agronomica Sinica, 2026, 52(6): 1902-1912.
[2] Zhang Xian-Feng, Guo Li-Jian, Li Kang-Chun, Kong Bin-Xue, Liu Yu-Fang, Che Zhuo, Yang De-Long. Identification of the ABHD6 gene family and development of functional markers for grain weight in wheat [J]. Acta Agronomica Sinica, 2026, 52(6): 1711-1727.
[3] Sun Shu-Feng, Xu Zhen-Nan, Huang Jia-Xin, Weng Jian-Feng, Li Xin-Hai. Genome-wide identification of the maize MAPK gene family and its response to Fusarium verticillioides infection [J]. Acta Agronomica Sinica, 2026, 52(5): 1291-1308.
[4] Song Yu-Zhen, Bheel Chander Kumar, Wang Yue, Zhang Ying-Xing, Guo Juan, Khound Rituraj, Santra Dipak Kumar, Cao Xiao-Ning, Wang Rui-Yun. Genome-wide identification of the AP2 subfamily in broomcorn millet and functional characterization of PmAP2-1 and PmAP2-9 in salt tolerance [J]. Acta Agronomica Sinica, 2026, 52(4): 1127-1139.
[5] Niu Li, Wang Yong-Sheng, Wang Chang-Jie, Zhang Hong, Meng Ya-Xiong, Li Bao-Chun, Yang Ke, Ma Xiao-Le, Yao Li-Rong, Si Er-Jing, Wang Hua-Jun, Wang Jun-Cheng. Identification and analysis of the NAC gene family in barley (Hordeum vulgare L.) and functional validation of HvNAC38 in salt tolerance [J]. Acta Agronomica Sinica, 2026, 52(3): 688-707.
[6] Yang Zong-Tao, Yang Ting, Wang Yu-Tong, Ai Jing, Li Yan-Ye, Liu Jia-Yong, Deng Jun, Zhao Yong, Zhang Yue-Bin. Identification and expression analysis of the CLC gene family in sugarcane [J]. Acta Agronomica Sinica, 2026, 52(3): 722-734.
[7] Meng Cheng, Wang Zhe. Genome-wide identification and expression analysis of the ZmPFK gene family under biotic and abiotic stresses in maize [J]. Acta Agronomica Sinica, 2026, 52(3): 764-779.
[8] Yang Yue, Zhang Xin-Xin, He Zeng-Hui, Li Rui-Dong, Pan Yu-Jie, Li Jia-Kang, Du Wei, Xu Da-Yong, Du Jin-Song. Non-destructive prediction and visualization of major chemical components in tobacco leaves using hyperspectral imaging [J]. Acta Agronomica Sinica, 2026, 52(3): 922-935.
[9] Zhan Ge-Rui, Yu Wen, Li Feng, Wu Ming-Zhu, Xu Xin, Luo Zhao-Peng, Wu Sheng-Xin, Yang Jun, Zhang Zhi-Qiang, Wang Zhong. Functional study of NtWRKY6 in response to ABA expression and regulation of polyphenol synthesis [J]. Acta Agronomica Sinica, 2026, 52(2): 446-458.
[10] Hu Cheng-Zhen, Gao Wei-Dong, Kong Bin-Xue, Wang Jian-Fei, Che Zhuo, Yang De-Long, Chen Tao. Genome-wide identification of the TaAPC11 gene family in wheat and functional characterization of TaAPC11-5B in drought stress responses [J]. Acta Agronomica Sinica, 2026, 52(1): 148-164.
[11] Kong Na, Liu Tao, Liu Wen-Ting, Chen Gang, Wen Li-Chao, Deng Zhi-Chao, Guo Mei, Li Wei, Guo Yong-Feng. Cloning of the NtCEP7 gene in tobacco and functional analysis of its encoded peptide in seedling-stage drought resistance [J]. Acta Agronomica Sinica, 2026, 52(1): 249-261.
[12] Jing Xiu-Qing, Cai Yong-Duo, Deng Ning, Zhao Xiao-Dong, Zhai Fei-Hong, Zeng Qun. Identification and expression pattern analysis of RopGEF family genes in Chenopodium quinoa [J]. Acta Agronomica Sinica, 2026, 52(1): 28-43.
[13] JI Bai-Lu, SUN Yi-Wen, LIU Wan-Feng, QIAN Ya-Xin, JIANG Cai-Hong, GENG Rui-Mei, LIU Dan, CHENG Li-Rui, YANG Ai-Guo, HUANG Li-Yu, LI Xiao-Xu, PU Wen-Xuan, GAO Jun-Ping, ZHANG Qiang, WEN Liu-Ying. Functional verification of the key gene NtLPAT involved in lipid biosynthesis in tobacco [J]. Acta Agronomica Sinica, 2025, 51(9): 2527-2537.
[14] WANG Bin, MENG Jiang-Yu, QIU Hao-Liang, HE Ya-Jun, QIAN Wei. Identification and expression pattern analysis of the BnaDUF579 gene family in Brassica napus [J]. Acta Agronomica Sinica, 2025, 51(8): 2100-2110.
[15] FENG Wu-Jian, XIAN Xiao-Qing, ZHANG Xin-Bo, CAO Dan, QIANG Cheng-Kui. Rapid transcriptome and AlphaFold-based identification of classical effector proteins of Magnaporthe oryzae and receptors in rice [J]. Acta Agronomica Sinica, 2025, 51(6): 1480-1488.
Viewed
Full text


Abstract

Cited
  Shared   
  Discussed   
No Suggested Reading articles found!
Add: No. 80 Xueyuan South Rd, Beijing 100081, P. R. China E-mail: zwxb301@caas.cn
Supported by Beijing Magtech Co.Ltd