Welcome to Acta Agronomica Sinica,

Acta Agronomica Sinica ›› 2024, Vol. 50 ›› Issue (3): 656-668.doi: 10.3724/SP.J.1006.2024.34069

• CROP GENETICS & BREEDINGZ·GERMPLASM RESOURCES·MOLECULAR GENETICS • Previous Articles     Next Articles

Cloning and relative expression pattern analysis of CsMCC1 and CsMCC2 in tea plant (Camellia sinensis)

DAI Hong-Wei(), LIU Jie-Qiang, ZHANG Li, TONG Hua-Rong(), YUAN Lian-Yu()   

  1. College of Food Science, Southwest University / Chongqing Key Laboratory of Specialty Food Co-built by Sichuan and Chongqing, Chongqing 400715, China
  • Received:2023-04-07 Accepted:2023-09-13 Online:2024-03-12 Published:2023-09-28
  • Contact: *E-mail: yuanlianyu88@163.com; E-mail: huart@swu.edu.cn
  • Supported by:
    Chongqing Technology Innovation and Application Demonstration Project(CSTB2022TIAD-CUX0021);Chongqing Agriculture and Rural Affairs Commission Chongqing Modern Mountain Characteristic Efficient Agriculture Tea Industry Technology System(2022-8)

Abstract:

Histone acetylation is an essential type of epigenetic modifications, which is mainly catalyzed by histone acetylases (HATs) and deacetylases (HDACs) and plays a crucial role in plant growth, stress response, and hormone regulation. However, little research information is available about tea plants histone acetylases. We cloned two MCC (MEIOTIC CONTROL OF CROSSOVERS) genes (CsMCC1 and CsMCC2) of HATs family from the ‘Fuding Dabaicha’ tea plant. Meanwhile, the function of these two CsMCC genes was analyzed by bioinformatics methods, qRT-PCR, and subcellular localization. Results showed that the CsMCC1 and CsMCC2 genes were located on chromosomes 1 and 7, encoding alkaline unstable hydrophilic proteins of 257 and 269 amino acids, respectively. The CsMCC genes and protein structure of tea plant were similar to those of the Arabidopsis AtMCC1 gene. The phylogenetic tree and conserved structural domain analysis showed that the MCC protein belonged to the GNAT (GCN5-related N-terminal acetyltransferases) subfamily of HATs proteins, and contained GNAT conserved structures. The evolutionary relationship of CsMCC proteins was closely related to the MCC members in grapes and tomatoes with the highly conserved protein sequences. The subcellular localization in Arabidopsis protoplasts revealed that the CsMCC1 and CsMCC2 proteins were localized on the cytoplasmic membrane. And the promoters of CsMCC1 and CsMCC2 genes contained a number of elements involved in responses to stress, light, and phytohormones. According to transcription data and expression analysis, the relative expression level of CsMCC1 gene was significantly higher in the younger stages of leaf, flower, and root development than the older stages, and CsMCC2 gene was higher in root than other tissues and lasted for a longer time during root development period. The CsMCC1 and CsMCC2 could be regulated by various abiotic stresses (drought, salt, and cold) and exogenous hormones (MeJA, GA3, and IAA). In addition, CsMCC proteins could interact with acetyltransferase-related proteins. Hence, CsMCC genes might play roles in tea plant growth and development, and the response to environment through histone acetylation modification. This study explored the basic features and functions of CsMCC, providing the useful theoretical reference for further research on the functions of CsMCC genes in tea plant.

Key words: tea plant, histone acetylation, CsMCC genes, relative expression analysis

Table 1

Primers for PCR in tea plant"

引物名称
Primer name
引物序列
Primer sequences (5°-3°)
用途
Primer function
CsMCC1 ATGCCATATTCTTCAATGGCA & TCAACTCTGCTCTTTATAGGG 基因克隆
Gene cloning
CsMCC2 ATGCCAATTTTTTGCTGGGGA & CTACACACATTGAAACCCGGT
CsMCC1-Q GGCGTATACGACCCTCTGATT & TCAACTGCTCCCCAGGATACA 基因表达分析
Gene relative expression level
CsMCC2-Q AGGTGTCCTCCATCCAACCAT & CAGTCAACAGCTCCCCAAGAT
CsACTIN CCAGAAAGATGCTTATGTAG & AGATCTTTTCCATGTCATCC
CsMCC1-p AAGTCCGGAGCTAGCTCTAGatgccatattcttcaatggcagacttgaaagg & AGCGGCCGCTGTACAGGATCaaactcggtaccatcagtcacaggg 亚细胞定位
Subcellular localization
CsMCC2-p AAGTCCGGAGCTAGCTCTAGatgccaattttttgctggggattaatgcaacc & AGCGGCCGCTGTACAGGATCcacacattgaaacccggtaccttgag

Fig. 1

Cloning and physicochemical characterization of CsMCC genes in tea plant (A): gel electrophoresis analysis of CsMCC genes; (B): chromosomal localization of CsMCC genes; (C): gene structural analysis of CsMCC and AtMCC1; (D): transmembrane structure prediction of CsMCC1 protein; (E): hydrophobicity prediction of CsMCC protein, values < 0 indicate hydrophilic and > 0 indicate hydrophobic."

Table 2

Physicochemical properties of CsMCC1 and CsMCC2 proteins in tea plant"

基因
Gene
基因位置
Gene location
编码长度
Encoding length (bp)
蛋白分子质量
Protein molecular weight (kD)
等电点
Isoelectric point
跨膜结构
Transmembrane structures
不稳定指数
Instability index
CsMCC1 (TEA029044) Scaffold1047: 74780-82234 774 29.34 9.44 1 46.50
CsMCC2 (TEA011651) Scaffold7556: 73159-84022 810 30.69 8.22 0 46.13

Fig. 2

Evolutionary tree of the HAT protein family (A) and plant MCC proteins (B) The evolutionary tree of MCC homologous proteins from Camellia sinensis (CsMCC1/2), Arabidopsis thaliana (AtMCC1), Solanum lycopersicum (Solyc03T002163), Zea mays (Zm00001d017691), Oryza sativa (LOC_Os02g46700), Vitis vinifera (VIT_216s0039g01810), Carya illinoinensis Pawnee (CiPaw.05G216100), Castanea dentata (Caden.12G113400), Cucumis sativus (Cucsa.318740), Gossypium darwinii (Godar.D08G277700, Godar.A08G263100), Capsella rubella (Carub.0003s0211), Eruca vesicaria (Eruve.2849s0002), Isatis tinctoria (Isati.1576s0019), Citrus clementina (Ciclev10021817m), and Populus trichocarpa (Potri.013G079900)."

Fig. 3

Characterization of the MCC protein sequences (A): the analysis of conserved motifs in CsMCC and AtMCC1 proteins; (B): the schematic representation for conserved structural domains of MCC proteins; (C): the multiple sequence alignment of plant MCC proteins."

Fig. 4

Spatial structure analysis of CsMCC1 and CsMCC2 proteins (A): protein secondary structure; (B): protein tertiary structure."

Fig. 5

Subcellular localization of CsMCC in Arabidopsis protoplasts"

Fig. 6

Cis-elements detected in the promoter of the CsMCC genes (A): promoter element distribution, different colors correspond to different elements in the figure below; (B): the heat map shows the number of promoter elements, and the gray square indicates that the elements couldn’t be detected."

Fig. 7

Spatial-specific expression analysis of CsMCC genes in tea plants (A): the relative expression level of CsMCC1 and CsMCC2 genes in different tissues of tea plants; (B)-(E): the relative expression level of CsMCC1 and CsMCC2 genes at different developmental stages of tea buds, leaves, flowers, and roots, respectively."

Fig. 8

Relative expression pattern of CsMCC genes under different abiotic stresses and phytohormones in tea plant (A): 25% PEG was used to simulate the arid environment of tea plants, and CK_P, PEG_24 h/48 h/72 h indicated that tea plants were treated with PEG for 0, 24, 48, and 72 h, respectively. (B): simulated salt stress of tea plants with 11.7 g L-1 NaCl, CK_N, NaCl_24 h/48 h/72 h indicated that tea plants were treated with NaCl for 0, 24, 48, and 72 h, respectively. (C): cold acclimation treatment, CK_C as control, CA1 for cold acclimation, CA2 for de-acclimated; (D): CK_M, MeJA_12 h/24 h/48 h/denoting 0, 12, 24, and 48 h treated with MeJA, respectively. (E): CK_G and GA3_24 h/48 h indicated that tea plants were treated 0, 24, and 48 h were with 100 mg L-1 GA3, respectively; (F): CK_I, IAA_24 h/48 h indicated that tea plants were treated 0, 24, and 48 h with 50 mg L-1 IAA, respectively. TBtools generated a heatmap with normalized log2-transformed values. Red indicates upward expression, while blue indicates downward expression, and the darker the color, the greater the change in expression."

Fig. 9

Functional interacting network of CsMCC proteins"

[1] Wang Z, Hong C, Chen F Y, Liu Y X. The roles of histone acetylation in seed performance and plant development. Plant Physiol Biochem, 2014, 84: 125-133.
doi: 10.1016/j.plaphy.2014.09.010
[2] Hollender C, Liu Z C. Histone deacetylase genes in Arabidopsis development. J Integr Plant Biol, 2008, 50: 875-885.
doi: 10.1111/j.1744-7909.2008.00704.x
[3] Struhl K. Histone acetylation and transcriptional regulatory mechanisms. Gene Dev, 1998, 12: 599-606.
doi: 10.1101/gad.12.5.599 pmid: 9499396
[4] Jenuwein T, Allis C D. Translating the histone code. Science, 2001, 293: 1074-1080.
doi: 10.1126/science.1063127 pmid: 11498575
[5] Millán-Zambrano G, Burton A, Bannister A J, Schneider R. Histone post-translational modifications-cause and consequence of genome function. Nat Rev Genet, 2022, 23: 563-580.
[6] Kuo M H, Allis C D. Roles of histone acetyltransferases and deacetylases in gene regulation. Bioessays, 1998, 20: 615-626.
doi: 10.1002/(SICI)1521-1878(199808)20:8<615::AID-BIES4>3.0.CO;2-H pmid: 9780836
[7] Cosgrove M S, Boeke J D, Wolberger C. Regulated nucleosome mobility and the histone code. Nat Struct Mol Biol, 2004, 11: 1037-1043.
pmid: 15523479
[8] Chen Z J, Tian L. Roles of dynamic and reversible histone acetylation in plant development and polyploidy. Biochim Biophys Acta, 2007, 1769: 295-307.
doi: 10.1016/j.bbaexp.2007.04.007 pmid: 17556080
[9] Liu X, Yang S, Yu C W, Chen C Y, Wu K. Histone acetylation and plant development. Enzymes, 2016, 40: 173-199.
doi: S1874-6047(16)30023-3 pmid: 27776781
[10] Lu Y, Xu Q, Liu Y, Yu Y, Cheng Z Y, Zhao Y, Zhou D X. Dynamics and functional interplay of histone lysine butyrylation, crotonylation, and acetylation in rice under starvation and submergence. Genome Biol, 2018, 19: 144.
doi: 10.1186/s13059-018-1533-y pmid: 30253806
[11] Aquea F, Timmermann T, Arce-Johnson P. Analysis of histone acetyltransferase and deacetylase families of Vitis vinifera. Plant Physiol Biochem, 2010, 48: 194-199.
doi: 10.1016/j.plaphy.2009.12.009
[12] Liu X, Luo M, Zhang W, Zhao J H, Zhang J X, Wu K Q, Tian L N, Duan J. Histone acetyltransferases in rice (Oryza sativa L.): phylogenetic analysis, subcellular localization and expression. BMC Plant Biol, 2012, 12: 145.
doi: 10.1186/1471-2229-12-145
[13] Aiese Cigliano R, Sanseverino W, Cremona G, Ercolano M R, Conicella C, Consiglio F M. Genome-wide analysis of histone modifiers in tomato: gaining an insight into their developmental roles. BMC Genomics, 2013, 14: 57.
doi: 10.1186/1471-2164-14-57 pmid: 23356725
[14] Peng M J, Ying P Y, Liu X C, Li C Q, Xia R, Li J G, Zhao M L. Genome-wide identification of histone modifiers and their expression patterns during fruit abscission in Litchi. Front Plant Sci, 2017, 8: 639.
doi: 10.3389/fpls.2017.00639 pmid: 28496451
[15] Gao S Q, Li L Z, Han X L, Liu T T, Jin P, Cai L N, Xu M Z, Zhang T Y, Zhang F, Chen J P, Yang J, Zhong K L. Genome-wide identification of the histone acetyltransferase gene family in Triticum aestivum. BMC Genomics, 2021, 22: 49.
doi: 10.1186/s12864-020-07348-6
[16] Cheng Y F, Ning K, Chen Y Z, Hou C, Yu H B, Yu H T, Chen S L, Guo X T, Dong L L. Identification of histone acetyltransferase genes responsible for cannabinoid synthesis in hemp. Chin Med, 2023, 18: 16.
doi: 10.1186/s13020-023-00720-0
[17] Chu J S, Chen Z. Molecular identification of histone acetyltransferases and deacetylases in lower plant Marchantia polymorpha. Plant Physiol Biochem, 2018, 132: 612-622.
doi: 10.1016/j.plaphy.2018.10.012
[18] Patrick R M, Huang X Q, Dudareva N, Li Y. Dynamic histone acetylation in floral volatile synthesis and emission in petunia flowers. J Exp Bot, 2021, 72: 3704-3722.
doi: 10.1093/jxb/erab072 pmid: 33606881
[19] Papaefthimiou D, Likotrafiti E, Kapazoglou A, Bladenopoulos K, Tsaftaris A. Epigenetic chromatin modifiers in barley: III. Isolation and characterization of the barley GNAT-MYST family of histone acetyltransferases and responses to exogenous ABA. Plant Physiol Biochem, 2010, 48: 98-107.
doi: 10.1016/j.plaphy.2010.01.002
[20] Latrasse D, Benhamed M, Henry Y, Domenichini S, Kim W, Zhou D X, Delarue M. The MYST histone acetyltransferases are essential for gametophyte development in Arabidopsis. BMC Plant Biol, 2008, 8: 121.
doi: 10.1186/1471-2229-8-121 pmid: 19040736
[21] Deng W W, Liu C Y, Pei Y X, Deng X, Niu L F, Cao X F. Involvement of the histone acetyltransferase AtHAC1 in the regulation of flowering time via repression of FLOWERING LOCUS C in Arabidopsis. Plant Physiol, 2007, 143: 1660-1668.
doi: 10.1104/pp.107.095521
[22] Han S K, Song J D, Noh Y S, Noh B. Role of plant CBP/p300-like genes in the regulation of flowering time. Plant J, 2007, 49: 103-114.
doi: 10.1111/tpj.2007.49.issue-1
[23] Benhamed M, Bertrand C, Servet C, Zhou D X. Arabidopsis GCN5, HD1, and TAF1/HAF2 interact to regulate histone acetylation required for light-responsive gene expression. Plant Cell, 2006, 18: 2893-2903.
doi: 10.1105/tpc.106.043489 pmid: 17085686
[24] Dunphy E L, Johnson T, Auerbach S S, Wang E H. Requirement for TAFII250 acetyltransferase activity in cell cycle progression. Mol Cell Biol, 2000, 20: 1134-1139.
doi: 10.1128/MCB.20.4.1134-1139.2000 pmid: 10648598
[25] Stockinger E J, Mao Y P, Regier M K, Triezenberg S J, Thomashow M F. Transcriptional adaptor and histone acetyltransferase proteins in Arabidopsis and their interactions with CBF1, a transcriptional activator involved in cold-regulated gene expression. Nucleic Acids Res, 2001, 29: 1524-1533.
doi: 10.1093/nar/29.7.1524 pmid: 11266554
[26] Kornet N, Scheres B. Members of the GCN5 histone acetyltransferase complex regulate PLETHORA-mediated root stem cell niche maintenance and transit amplifying cell proliferation in Arabidopsis. Plant Cell, 2009, 21: 1070-1079.
doi: 10.1105/tpc.108.065300
[27] Li H, Yan S H, Zhao L, Tan J J, Zhang Q, Gao F, Wang P, Hou H L, Li L J. Histone acetylation associated up-regulation of the cell wall related genes is involved in salt stress induced maize root swelling. BMC Plant Biol, 2014, 14: 105.
doi: 10.1186/1471-2229-14-105 pmid: 24758373
[28] Perrella G, Consiglio M F, Aiese-Cigliano R, Cremona G, Sanchez-Moran E, Barra L, Errico A, Bressan R A, Franklin F C, Conicella C. Histone hyperacetylation affects meiotic recombination and chromosome segregation in Arabidopsis. Plant J, 2010, 62: 796-806.
doi: 10.1111/tpj.2010.62.issue-5
[29] Barra L, Aiese-Cigliano R, Cremona G, De Luca P, Zoppoli P, Bressan R A, Consiglio F M, Conicella C. Transcription profiling of laser microdissected microsporocytes in an Arabidopsis mutant (Atmcc1) with enhanced histone acetylation. J Plant Biol, 2012, 55: 281-289.
doi: 10.1007/s12374-011-0268-z
[30] Yuan L Y, Dai H W, Zheng S T, Huang R, Tong H R. Genome-wide identification of the HDAC family proteins and functional characterization of CsHD2C, a HD2-type histone deacetylase gene in tea plant (Camellia sinensis L. O. Kuntze). Plant Physiol Biochem, 2020, 155: 898-913.
doi: 10.1016/j.plaphy.2020.07.047
[31] Gu D C, Wu S H, Yu Z M, Zeng L T, Qian J J, Zhou X C, Yang Z Y. Involvement of histone deacetylase CsHDA2 in regulating (E)-nerolidol formation in tea (Camellia sinensis) exposed to tea green leafhopper infestation. Hortic Res, 2022, 9: uhac158.
doi: 10.1093/hr/uhac158
[32] Zhang S P, Guo Y, Chen S Q, Li H. The histone acetyltransferase CfGcn5 regulates growth, development, and pathogenicity in the anthracnose fungus Colletotrichum fructicola on the tea-oil tree. Front Microbiol, 2021, 12: 680415.
doi: 10.3389/fmicb.2021.680415
[33] Wu Z J, Tian C, Jiang Q, Li X H, Zhuang J. Selection of suitable reference genes for qRT-PCR normalization during leaf development and hormonal stimuli in tea plant (Camellia sinensis). Sci Rep, 2016, 6: 19748.
doi: 10.1038/srep19748
[34] Xing G F, Jin M S, Qu R F, Zhang J W, Han Y H, Han Y Q, Wang X C, Li X K, Ma F F, Zhao X W. Genome-wide investigation of histone acetyltransferase gene family and its responses to biotic and abiotic stress in foxtail millet (Setaria italica [L.] P. Beauv). BMC Plant Biol, 2022, 22: 292.
doi: 10.1186/s12870-022-03676-9
[35] Sterner D E, Berger S L. Acetylation of histones and transcription-related factors. Microbiol Mol Biol Rev, 2000, 64: 435-459.
doi: 10.1128/MMBR.64.2.435-459.2000
[36] Ogryzko V. Mammalian histone acetyltransferases and their complexes. Cell Mol Life Sci, 2001, 58: 683-692.
pmid: 11437230
[37] Salah Ud-Din A I M, Tikhomirova A, Roujeinikova A. Structure and functional diversity of GCN5-related N-acetyltransferases (GNAT). Int J Mol Sci, 2016, 17: 1018.
doi: 10.3390/ijms17071018
[38] Imran M, Shafiq S, Farooq M A, Naeem M K, Widemann E, Bakhsh A, Jensen K B, Wang R R C. Comparative genome-wide analysis and expression profiling of histone acetyltransferase (HAT) gene family in response to hormonal applications, metal and abiotic stresses in cotton. Int J Mol Sci, 2019, 20: 5311.
doi: 10.3390/ijms20215311
[1] Xu Miao-Miao, Di Tai-Mei, Wang Jie, Wu Ye-Die, Liu En-Bei, Wang Yu-Chun, Wang Xin-Chao, Wang Lu. Molecular mechanisms of exogenous quercetin in enhancing cold resistance in tea plants [J]. Acta Agronomica Sinica, 2026, 52(5): 1418-1429.
[2] Yang Ying, Hao Yu-Wan, Zhang Xue-Ning, Fang Jia-Lu, Ma Yue-Hua, Yang Wei-Long, Sun Wen-Qing, Wang Xin-Chao, Wang Yu-Chun, Huang Jian-Yan. Molecular mechanism of CsERF9-mediated regulation of anthracnose resistance in tea plant [J]. Acta Agronomica Sinica, 2026, 52(4): 1103-1115.
[3] LI Hai-Fen, LU Qing, LIU Hao, WEN Shi-Jie, WANG Run-Feng, HUANG Lu, CHEN Xiao-Ping, HONG Yan-Bin, LIANG Xuan-Qiang. Genome-wide identification and expression analysis of AhGA3ox gene family in peanut (Arachis hypogaea L.) [J]. Acta Agronomica Sinica, 2024, 50(4): 932-943.
[4] DAI Shu-Tao, ZHU Can-Can, MA Xiao-Qian, QIN Na, SONG Ying-Hui, WEI Xin, WANG Chun-Yi, LI Jun-Xia. Genome-wide identification of the HAK/KUP/KT potassium transporter family in foxtail millet and its response to K+ deficiency and high salt stress [J]. Acta Agronomica Sinica, 2023, 49(8): 2105-2121.
[5] WEN Li-Chao, XIONG Tao, DENG Zhi-Chao, LIU Tao, GUO Cun, LI Wei, GUO Yong-Feng. Expression and functional characterization of NtNAC080 transcription factor gene from Nicotiana tabacumin under abiotic stress [J]. Acta Agronomica Sinica, 2023, 49(8): 2171-2182.
[6] LIU Jia, ZOU Xiao-Yue, MA Ji-Fang, WANG Yong-Fang, DONG Zhi-Ping, LI Zhi-Yong, BAI Hui. Genome-wide identification and characterization of MAPK genes and their response to biotic stresses in foxtail millet [J]. Acta Agronomica Sinica, 2023, 49(6): 1480-1495.
[7] CHEN Lu, ZHOU Shu-Qian, LI Yong-Xin, CHEN Gang, LU Guo-Quan, YANG Hu-Qing. Identification and expression analysis of uncoupling protein gene family in sweetpotato [J]. Acta Agronomica Sinica, 2022, 48(7): 1683-1696.
[8] CHEN Song-Yu, DING Yi-Juan, SUN Jun-Ming, HUANG Deng-Wen, YANG Nan, DAI Yu-Han, WAN Hua-Fang, QIAN Wei. Genome-wide identification of BnCNGC and the gene expression analysis in Brassica napus challenged with Sclerotinia sclerotiorum and PEG-simulated drought [J]. Acta Agronomica Sinica, 2022, 48(6): 1357-1371.
[9] LI Na-Na, LIU Ying, ZHANG Hao-Jie, WANG Lu, HAO Xin-Yuan, ZHANG Wei-Fu, WANG Yu-Chun, XIONG Fei, YANG Ya-Jun, WANG Xin-Chao. Promoter cloning and expression analysis of the hexokinase gene CsHXK2 in tea plant (Camellia sinensis) [J]. Acta Agronomica Sinica, 2020, 46(10): 1628-1638.
[10] HAO Xin-Yuan,YUEChuan,TANG Hu,QIAN Wen-Jun,WANG Yu-Chun,WANG Lu, WANG Xin-Chao,YANG Ya-Jun. Cloning of β-amylase Gene (CsBAM3) and ItsExpression ModelResponseto Cold Stress in Tea Plant [J]. Acta Agron Sin, 2017, 43(10): 1417-1425.
[11] CAO Hong-Li,WANG Lu,QIAN Wen-Jun,HAO Xin-Yuan,YANG Ya-Jun,WANG Xin-Chao. Positive Regulation of CsbZIP4 Transcription Factor on Salt Stress Response in Transgenic Arabidopsis [J]. Acta Agron Sin, 2017, 43(07): 1012-1020.
[12] TANG Hu,HAO Xin-Yuan,WANG Lu,XIAO Bin,WANG Xin-Chao,YANG Ya-Jun. Molecular Regulation and Substance Exchange Dynamics at Dormancy and Budbreak Stages in Overwintering Buds of Tea Plant [J]. Acta Agron Sin, 2017, 43(05): 669-677.
[13] CHEN Lin-Bo,XIA Li-Fei,TIAN Yi-Ping,LI Mei,SONG Wei-Xi,LIANG Ming-Zhi,JIANG Chang-Jun. Exploring Sterility Gene from Tea Plant Flower Based on Digital Gene Expression Profiling [J]. Acta Agron Sin, 2017, 43(02): 210-217.
[14] ZHOU Tian-Shan,WANG Xin-Chao,YU You-Ben,XIAO Yao,QIAN Wen-Jun,XIAO Bin,YANG Ya-Jun. Correlation Analysis between Total Catechins (or Anthocyanins) and Expression Levels of Genes Involved in Flavonoids Biosynthesis in Tea Plant with Purple Leaf [J]. Acta Agron Sin, 2016, 42(04): 525-531 .
[15] QIAN Wen-Jun,YUE Chuan,CAO Hong-Li,HAO Xin-Yuan,WANG Lu,WANG Yu-Chun,HUANG Yu-Ting,WANG Bo,WANG Xin-Chao,XIAO Bin,YANG Ya-Jun. Cloning and Expression Analysis of a Neutral/alkaline Invertase Gene (CsINV10) in Tea Plant (Camellia sinensis L. O. Kuntze) [J]. Acta Agron Sin, 2016, 42(03): 376-388.
Viewed
Full text


Abstract

Cited

  Shared   
  Discussed   
No Suggested Reading articles found!