Welcome to Acta Agronomica Sinica,

Acta Agronomica Sinica ›› 2024, Vol. 50 ›› Issue (10): 2447-2457.doi: 10.3724/SP.J.1006.2024.44009

• CROP GENETICS & BREEDING·GERMPLASM RESOURCES·MOLECULAR GENETICS • Previous Articles     Next Articles

Transcription factor GhWRKY41 enhances cotton resistance to Verticillium dahliae by promoting SA synthesis

XIAO Sheng-Hua1,2,**,*(), DONG Xian-Man1,**(), PENG Xin1, LI An-Zi1, BI Zhao-Fu1, LIAO Ming-Jing1, HUANG Li-Hao1, GUAN Qian-Qian2, HU Qin1,2,*(), ZHU Long-Fu2,3,*()   

  1. 1State Key Laboratory of Conservation and Utilization of Agro-Biological Resources in Subtropical Region / College of Agriculture, Guangxi University, Nanning 530004, Guangxi, China
    2State Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural University, Wuhan 430070, Hubei, China
    3Hubei Hongshan Laboratory, Huazhong Agricultural University, Wuhan 430070, Hubei, China
  • Received:2024-01-15 Accepted:2024-06-20 Online:2024-10-12 Published:2024-07-12
  • Contact: *E-mail: shxiao@gxu.edu.cn;E-mail: lfzhu@mail.hzau.edu.cn; E-mail: huqin-0509@gxu.edu.cn
  • About author:**(Contributed equally to this work)
  • Supported by:
    National Natural Science Foundation of China(32301880);National Natural Science Foundation of China(32230076);Hubei Hongshan Laboratory Foundation(2021hszd006)

Abstract:

Cotton is an important commercial crop, and its yield and quality are severely affected by Verticillium dahliae. Identifying cotton resistance genes to Verticillium dahliae and exploring the underlying molecular mechanisms is of great significance for accelerating the breeding process of cotton resistant to Verticillium wilt. In a previous study, the WRKY gene GhWRKY41 was identified as being induced by Verticillium dahliae in multiple resistant cotton varieties, enhancing cotton resistance through the activation of phenylpropanoid metabolism. This study further analyzed the expression patterns of GhWRKY41 under different hormone treatments, validated its disease resistance function in the upland cotton variety ‘Jin668’ using a virus-induced gene silencing (VIGS) assay, and measured endogenous hormone content. The results demonstrated that GhWRKY41 was significantly up-regulated by SA, Me-JA, and H2O2. Silencing GhWRKY41 weakened cotton resistance to Verticillium dahliae, while overexpression of GhWRKY41 led to a marked increase in SA content, and its RNAi lines showed a decrease in SA content. RT-qPCR results revealed that the expression levels of the SA biosynthesis gene GhSID2 and the SA signal transduction genes GhNPR1, GhPR1, and GhPR5 were significantly up-regulated in GhWRKY41-overexpression plants but decreased in GhWRKY41-RNAi plants. ChIP-qPCR and luciferase reporter gene assays showed that GhWRKY41 binds to and activates the expression of GhSID2, GhPR1, and GhPR5. Additionally, external spraying of SA significantly enhanced cotton resistance to Verticillium dahliae. In summary, GhWRKY41 enhances cotton resistance to Verticillium dahliae by promoting SA synthesis. This study elucidates the biological function of GhWRKY41 in cotton resistance to Verticillium dahliae and provides a theoretical basis for developing cotton varieties with improved resistance.

Key words: cotton, Verticillium dahliae, GhWRKY41, salicylic acid

Table 1

Primers used for vector construction, RT-qPCR, and ChIP-qPCR"

引物名称
Primer name
正向引物序列
Forward primer (5′-3′)
反向引物序列
Reverse primer (5′-3′)
GhUB7 GAAGGCATTCCACCTGACCAAC CTTGACCTTCTTCTTCTTGTGCTTG
ChIP-qPCR-ProGhPR5-1 AGCCCCTATATTGATTTTGC AAAGCTACCACATGTCACCA
ChIP-qPCR-ProGhPR5-2 GAAGCAACTTAGGCTATCTCAT TTGGATTCGATTCCTAACTC
ChIP-qPCR-ProGhPR1-1 TGTCATCCTGTTGATTGAGCAA ACACTGTCCATTCAAACCTACCA
ChIP-qPCR-ProGhPR1-2 TAATATCCATTCCAGCCG TCTTGACTTGAAATTTGAGAGA
ChIP-qPCR-ProGhPR1-3 AATGCAGATCTTCACGAAAA AAATTGGACTCTTTTTAAAAGG
ChIP-qPCR-ProGhSID2-1 TCAACATATTAGGCAGCACTG GACGTTGTCATGCTGTTAGG
ChIP-qPCR-ProGhSID2-2 GCTTAACAATCTGCCACAA TTTGTGAGGAACCTACCTTC
ChIP-qPCR-ProGhSID2-3 CAAATGATTAGACTTAGGTTGAA TGAGTCGATCCTAACACAACA
ChIP-qPCR-ProGhSID2-4 GAATCCTCAAAACATAAACACA GGAGATTTGTAAAGTATGACTCC
TRV:GhWRKY41 CTCAAGGAAGCACGATGAGCTTGAGCAACTTCCAAGGGGTGCT TTGAACCTAAAACTTCAGACACGGACATTCCAACGATTCCTACATTGC
GhWRKY41-62-SK CGCTCTAGAACTAGTGGATCCATGGAGAACATGTGGAAG CTTGATATCGAATTCCTGCAGTTAGGAGAAAAATCCCGG
ProGhSID2-0800-LUC CTTGATATCGAATTCCTGCAGTAATGATGATGTCAACATATTAGG CGCTCTAGAACTAGTGGATCCGTTCAAGATAGGCTCATTGCTGGC
ProPR1-0800-LUC CTTGATATCGAATTCCTGCAGATGATAATAATGAAATAATGTCAT CGCTCTAGAACTAGTGGATCCAAGGTTAATGGTTAAATTGGACTC
ProPR5-0800-LUC CTTGATATCGAATTCCTGCAGTCTTCTGTCTTTTCATGGTCGG CGCTCTAGAACTAGTGGATCCTGACAACATTCAAGCATCAAACTC
GhWRKY41-qPCR GCCGTTCATGTCTCCCGA GCACCCCTTGGAAGTTGTTC
GhSID2-qPCR ATCGAGTGGCTCCATGCTCAAC CGGCGGCACCAACAAGATTATG
GhPR1-qPCR CCATGCCCAAGACTCACACCAA GTCCACTGGAGTGCACAAGGTT
GhPR5-qPCR GCAGTCAAGGCAGTTGGTGGTA ATATTCCGGCGTGTTGAAGGCA
GhNPR1-qPCR TTGTCTCTTGCCATCGCTGGTG GGTGCCTCATTCAAGTCCACTGT

Fig. 1

Silencing of the expression of GhWRKY41 decreased cotton resistance to Verticillium dahliae A: disease symptoms of TRV:GhWRKY41 cotton after inoculation with Verticillium dahliae for 2 weeks. B: RT-PCR analysis to detect the expression of GhWRKY41 in cotton seedlings. C: the observation of longitudinal cotyledon node of TRV:GhWRKY41 plants after inoculation with Verticillium dahliae for 14 d. D: disease index of TRV:00 and TRV:GhWRKY41 cotton. **: P < 0.01, Student’s t-test."

Fig. 2

Expression pattern analysis of GhWRKY41 * and ** indicate significant differences at the 0.05 and 0.01 probability levels, respectively."

Fig. 3

GhWRKY41 promotes the synthesis of SA The SA content in WT, GhWRKY41-overexpression and GhWRKY41- RNAi cotton under normal conditions and inoculation with Verticillium dahliae. Different letters indicate significant differences as determined using ANOVA (P < 0.05)."

Fig. 4

Expression of GhSID2, GhPR1, GhPR5, and GhNPR1 in GhWRKY41 transgenic cotton"

Fig. 5

GhWRKY41 binds to the W-box elements within promoters in GhSID2, GhPR1, and GhPR5 A-C: ChIP-qPCR analysis of GhWRKY41 binding affinity to promoters of GhSID2 (A), GhPR1 (B), and GhPR5 (C). The red/yellow/green lines indicate the W-box elements in the promoter of GhSID2, GhPR1, and GhPR5. P1-P4 indicate the ChIP-qPCR primers. GhUB7 was used as the internal reference."

Fig. 6

GhWRKY41 activates the expression of GhSID2, GhPR1, and GhPR5 A: schematic diagrams of the effector and reporter constructs used for DLR assay. EV, Empty vector. B: luminescence imaging of DLR assay in N. benthamiana leaves. C: the relative LUC/REN ratio of GhWRKY41 to pGhSID2-LUC, pGhPR1-LUC, and pGhPR5-LUC in cotton protoplast. *: P < 0.05, **: P < 0.01, Student’s t-test."

Fig. 7

SA enhances the resistance of cotton to Verticillium dahliae A: disease symptom of cotton V592-inoculated after treatment with ddH2O, 500 μmol L-1 SA and 1 mmol L-1 SA for 12 d. B, C: statistics of disease index (B) and disease grade (C) of cotton inoculated with Verticillium dahliae. D: the observation of longitudinal cotyledon node of cotton plants after inoculation with Verticillium dahliae. E: qPCR analysis of the amount of fungal DNA in the cotyledonary nodes. GhUB7 was used as the internal reference, and the internal transcribed spacer region (ITS) of the fungal ribosomal DNA was targeted. F: the fungal recovery assays and luminescence imaging of Verticillium dahliae fused GFP tag. G: statistics of fluorescence in (F). CPS: counts per second. **: P < 0.01, Student’s t-test."

[1] Chen J, Clinton M, Qi G, Wang D W, Liu F Q, Fu Z Q. Reprogramming and remodeling: transcriptional and epigenetic regulation of salicylic acid-mediated plant defense. J Exp Bot, 2020, 71: 5256-5268.
doi: 10.1093/jxb/eraa072 pmid: 32060527
[2] Zhang Y X, Xu S H, Ding P T, Wang D M, Cheng Y T, He J, Gao M H, Xu F, Li Y, Zhu Z H, Li X, Zhang Y L. Control of salicylic acid synthesis and systemic acquired resistance by two members of a plant-specific family of transcription factors. Proc Natl Acad Sci USA, 2010, 107: 18220-18225.
doi: 10.1073/pnas.1005225107 pmid: 20921422
[3] Wang L, Tsuda K, Truman W, Sato M, Nguyen le V, Katagiri F, Glazebrook J. CBP60g and SARD1 play partially redundant critical roles in salicylic acid signaling. Plant J, 2011, 67: 1029-1041.
[4] Gao Q M, Venugopal S, Navarre D, Kachroo A. Low oleic acid-derived repression of jasmonic acid-inducible defense responses requires the WRKY50 and WRKY51 proteins. Plant Physiol, 2011, 155: 464-476.
[5] van Verk M C, Bol J F, Linthorst H J. WRKY transcription factors involved in activation of SA biosynthesis genes. BMC Plant Biol, 2011, 11: 89-100.
doi: 10.1186/1471-2229-11-89 pmid: 21595875
[6] Guo P R, Li Z H, Huang P X, Li B S, Fang S, Chu J F, Guo H W. A tripartite amplification loop involving the transcription factor WRKY75, salicylic acid, and reactive oxygen species accelerates leaf senescence. Plant Cell, 2017, 29: 2854-2870.
[7] Zhang S H, Li C, Wang R, Chen Y X, Shu S, Huang R H, Zhang D W, Li J, Xiao S, Yao N, Yang C W. The Arabidopsis mitochondrial rrotease FtSH4 is involved in leaf senescence via regulation of WRKY-dependent salicylic acid accumulation and signaling. Plant Physiol, 2017, 173: 2294-2307.
[8] Jiang J J, Ma S H, Ye N H, Jiang M, Cao J S, Zhang J H. WRKY transcription factors in plant responses to stresses. J Integr Plant Biol, 2017, 59: 86-101.
doi: 10.1111/jipb.12513
[9] Yamasaki K, Kigawa T, Inoue M, Tateno M, Yamasaki T, Yabuki T, Aoki M, Seki E, Matsuda T, Tomo Y, Hayami N, Terada T, Shirouzu M, Tanaka A, Seki M, Shinozaki K, Yokoyama S. Solution structure of an Arabidopsis WRKY DNA binding domain. Plant Cell, 2005, 17: 86-101.
[10] Rushton P J, Somssich I E, Ringler P, Shen Q J. WRKY transcription factors. Trends Plant Sci, 2010, 15: 247-258.
doi: 10.1016/j.tplants.2010.02.006 pmid: 20304701
[11] Xie W Y, Ke Y G, Cao J B, Wang S P, Yuan M. Knock out of transcription factor WRKY53 thickens sclerenchyma cell walls, confers bacterial blight resistance. Plant Physiol, 2021, 187: 1746-1761.
[12] Li C, He X, Luo X Y, Xu L, Liu L L, Min L, Jin L, Zhu L F, Zhang X L. Cotton WRKY1 mediates the plant defense-todevelopment transition during infection of cotton by Verticillium dahliae by activating JASMONATE ZIM-DOMAIN1 expression. Plant Physiol, 2014, 166: 2179-2194.
[13] Yang S, Cai W W, Shen L, Cao J S, Liu C L, Hu J, Guan D Y, He S L. A CaCDPK29-CaWRKY27b module promotes CaWRKY40- mediated thermotolerance and immunity to Ralstonia solanacearum in pepper. New Phytol, 2022, 233: 1843-1863.
[14] 徐爱武. 近十年我国棉花生产量与消费量分析及建议. 棉花科学, 2022, 44(4): 61-64.
Xu A W. Analysis and suggestion of cotton production and consumption in China in recent ten years. Cotton Sci, 2022, 44(4): 61-64 (in Chinese with English abstract).
[15] Yang X Y, Zhang X L, Yuan D J, Jin F Y, Zhang Y C, Xu J. Transcript profiling reveals complex auxin signalling pathway and transcription regulation involved in dedifferentiation and redifferentiation during somatic embryogenesis in cotton. BMC Plant Biol, 2012, 12: 110-128.
doi: 10.1186/1471-2229-12-110 pmid: 22817809
[16] Gao W, Long L, Zhu L F, Xu L, Gao W H, Sun L Q, Liu L L, Zhang X L. Proteomic and virus-induced gene silencing (VIGS) analyses reveal that gossypol, brassinosteroids, and jasmonic acid contribute to the resistance of cotton to Verticillium dahliae. Mol Cell Proteomics, 2013, 12: 3690-3703.
[17] Xu L, Zhu L F, Tu L L, Gao X P, Long L, Sun L Q, Gao W, Zhang X L. Differential gene expression in cotton defence response to Verticillium dahliae by SSH. J Phytopathol, 2011, 159: 606-615.
[18] Xu F, Yang L, Zhang J, Guo X P, Zhang X L, Li G Q. Prevalence of the defoliating pathotype of Verticillium dahliae on cotton in central China and virulence on selected cotton cultivars. J Phytopath, 2012, 160: 369-376.
[19] Tan J F, Tu L L, Deng F L, Hu H Y, Nie Y C, Zhang X L. A genetic and metabolic analysis revealed that cotton fiber cell development was retarded by flavonoid naringenin. Plant Physiol, 2013, 162: 86-95.
doi: 10.1104/pp.112.212142 pmid: 23535943
[20] Hu Q, Zhu L F, Zhang X L, Guan Q Q, Xiao S H, Min L, Zhang X L. GhCPK33 negatively regulates defense against Verticillium dahliae by phosphorylating GhOPR3. Plant Physiol, 2018, 178: 876-889.
[21] Xiao S H, Ming Y Q, Hu Q, Ye Z X, Si H, Liu S M, Zhang X J, Wang W R, Yu Y, Kong J, Klosterman S J, Lindsey K, Zhang X L, Aierxi A, Zhu L F. GhWRKY41 forms a positive feedback regulation loop and increases cotton defence response against Verticillium dahliae by regulating phenylpropanoid metabolism. Plant Biotechnol J, 2023, 21: 961-978.
[22] Li Y, Zhou Y J, Dai P H, Ren Y P, Wang Q, Liu X D. Cotton bsr-k1 modulates lignin deposition participating in plant resistance against Verticillium dahliae and fusarium oxysporum. Plant Growth Regul, 2021, 95: 283-292.
[23] Chen F, Hu Y, Vannozzi A, Wu K C, Cai H Y, Qin Y, Mullis A, Lin Z G, Zhang L S. The WRKY transcription factor family in model plants and crops. Criti Rev Plant Sci, 2017, 36: 311-335.
[24] Anderssen S, Naômé A, Jadot C, Brans A, Tocquin P, Rigali S. AURTHO: autoregulation of transcription factors as facilitator of cis-acting element discovery. Biochim Biophys Acta Gene Regul Mech, 2022, 1865: 194847.
[25] Ng D W, Abeysinghe J K, Kamali M. Regulating the regulators: the control of transcription factors in plant defense signaling. Int J Mol Sci, 2018, 19: 3737-3755.
[26] Wang H L, Cheng X, Yin D M, Chen D L, Luo C, Liu H, Huang C L. Advances in the research on plant WRKY transcription factors responsive to external stresses. Curr Issues Mol Biol, 2023, 45: 2861-2880.
doi: 10.3390/cimb45040187 pmid: 37185711
[27] Bakshi M, Oelmüller R. WRKY transcription factors: jack of many trades in plants. Plant Signal Behav, 2014, 9: e27700.
[28] Long L X, Gu L J, Wang S J, Cai H Y, Wu J H, Wang J M, Yang M S. Progress in the understanding of WRKY transcription factors in woody plants. Int J Biol Macromol, 2023, 242: 124379.
[29] Liu D L, Leib K, Zhao P Y, Kogel K H, Langen G. Phylogenetic analysis of barley WRKY proteins and characterization of HvWRKY1 and -2 as repressors of the pathogen-inducible gene HvGER4c. Mol Genet Genomics, 2014, 289: 1331-1345.
[30] Lippok B, Birkenbihl R P, Rivory G, Brümmer J, Schmelzer E, Logemann E, Somssich I E. Expression of AtWRKY33 encoding a pathogen- or PAMP-responsive WRKY transcription factor is regulated by a composite DNA motif containing W box elements. Mol Plant Microbe Interact, 2007, 20: 420-429.
[31] Huang S X, Gao Y F, Liu J K, Peng X L, Niu X G, Fei Z J, Cao S Q, Liu Y S. Genome-wide analysis of WRKY transcription factors in Solanum lycopersicum. Mol Genet Genomics, 2012, 287: 495-513.
[32] Deng B, Wang W J, Ruan C Q, Deng L L, Yao S X, Zeng K F. Involvement of CsWRKY70 in salicylic acid-induced citrus fruit resistance against Penicillium digitatum. Hortic Res, 2020, 7: 157-169.
[33] Zhou R, Dong Y H, Liu X, Feng S, Wang C X, Ma X M, Liu J N, Liang Q, Bao Y, Xu S Y, Lang X Y, Gai S S, Yang K Q, Fang H C. JrWRKY21 interacts with JrPTI5L to activate the expression of JrPR5L for resistance to Colletotrichum gloeosporioides in walnut. Plant J, 2022, 111: 1152-1166.
[34] Wang W J, Li T, Chen Q, Yao S X, Zeng K F. Transcriptional regulatory mechanism of a variant transcription factor CsWRKY23 in citrus fruit resistance to Penicillium digitatum. Food Chem, 2023, 413: 135573.
[35] Zhang S L, Dong L J, Zhang X, Fu X H, Zhao L, Wu L Z, Wang X F, Liu J F. The transcription factor GhWRKY70 from Gossypium hirsutum enhances resistance to verticillium wilt via the jasmonic acid pathway. BMC Plant Biol, 2023, 23: 141-156.
[36] Wang Y Q, Cui X, Yang B, Xu S T, Wei X Y, Zhao P Y, Niu F F, Sun M T, Wang C, Cheng H, Jiang Y Q. WRKY55 transcription factor positively regulates leaf senescence and the defense response by modulating the transcription of genes implicated in the biosynthesis of reactive oxygen species and salicylic acid in Arabidopsis. Development, 2020, 147: 189647.
[37] Ulker B, Shahid M M, Somssich I E. The WRKY70 transcription factor of Arabidopsis influences both the plant senescence and defense signaling pathways. Planta, 2007, 226: 125-137.
[38] Rekhter D, Lüdke D, Ding Y, Feussner K, Zienkiewicz K, Lipka V, Wiermer M, Zhang Y, Feussner I. Isochorismate-derived biosynthesis of the plant stress hormone salicylic acid. Science, 2019, 365: 498-502.
doi: 10.1126/science.aaw1720 pmid: 31371615
[39] Li Z, Liu H M, Ding Z H, Yan J P, Yu H Y, Pan R H, Hu J, Guan Y J, Hua J. Low temperature enhances plant immunity via salicylic acid pathway genes that are repressed by ethylene. Plant Physiol, 2020, 182: 626-639.
doi: 10.1104/pp.19.01130 pmid: 31694900
[40] Liao R J, Wei X C, Zhao Y Y, Xie Z Q, Nath U K, Yang S J, Su H N, Wang Z Y, Li L, Tian B M, Wei F, Yuan Y X, Zhang X W. Bra-miR167a targets ARF8 and negatively regulates Arabidopsis thaliana immunity against plasmodiophora brassicae. Int J Mol Sci, 2023, 24: 11850-11866.
[41] Yang J, Wang Y F, Liu L, Liu L N, Wang C M, Wang C M, Li C Y. Effects of exogenous salicylic acid and pH on pathogenicity of biotrophy-associated secreted protein 1 (BAS1)-overexpressing strain, Magnaporthe oryzae. Environ Sci Pollut Res Int, 2019, 26: 13725-13737.
[42] Elsharkawy M M, Omara R I, Mostafa Y S, Alamri S A, Hashem M, Alrumman S A, Ahmad A A. Mechanism of wheat leaf rust control using chitosan nanoparticles and salicylic acid. J Fungi, 2022, 8: 304-321.
[1] Peng Jia-Luo, Li Ying, Li Dan-Dan, Yang Jun-Ning, Guo Xue-Feng, Zhang Wen-Jiao, Yu Xiao-Xue, Zhou Ya-Rong, Wang Zhen-Yu, Wang Cai-Xiang, Ma Xiong-Feng, Su Jun-Ji. Identification of class I LBD family members in upland cotton and function and haplotype analyses of GhLBD6 in regulating flowering period [J]. Acta Agronomica Sinica, 2026, 52(6): 1682-1697.
[2] Zhao Jia-Xue, Zhou Long-Hao, Guo Qi-Yuan, Shang Lun-Xiao, Wang Han, Liu Zhi-Tao, Chen Xi, Zhang Xiao-Pei, Song Xian-Liang, Ahmedov Miraziz Baltaevich, Mao Li-Li. Long-term stubble return and subsoiling enhance cotton yields in coastal saline-alkali soils by improving soil conditions and photosynthetic characteristics [J]. Acta Agronomica Sinica, 2026, 52(5): 1548-1560.
[3] Zhang Xi, Wang Guang-En, Li Shao-Qi, Liu Yi, Li Jun-Lan, Qian Yu-Yuan. Transcriptome sequencing-based analysis on the formation mechanism of fiber micronaire differences between two sister lines derived from Gossypium hirsutum-G. barbadense hybrid [J]. Acta Agronomica Sinica, 2026, 52(5): 1442-1458.
[4] Zhou Qi-Xiang, Zhu Yan, Wang Chu-Bo, Zhu Bo-Lin, Li Jun-Bo, Song Li-Bing. Modeling the effects of climate change on cotton phenology and potential yield in Xinjiang based on the DSSAT model [J]. Acta Agronomica Sinica, 2026, 52(2): 590-602.
[5] LI Yi-Qian, XU Shou-Zhen, LIU Ping, MA Qi, XIE Bin, CHEN Hong. Genome-wide association study of yield components using a 40K SNP array and identification of a stable locus for boll weight in upland cotton (Gossypium hirsutum L.) [J]. Acta Agronomica Sinica, 2025, 51(8): 2128-2138.
[6] GUO Dong-Cai, LYU Tao, CAI Yong-Sheng, MAI WU-LU-DA·AI He-Mai-Ti, CHEN Quan-Jia, QU Yan-Ying, ZHENG Kai. Meta-analysis of QTL and identification of candidate genes for fiber quality in cotton [J]. Acta Agronomica Sinica, 2025, 51(6): 1445-1466.
[7] XIA Qi, GUO Ying, WANG Kun-Mei, WANG Si-Yi, JU Jian-Ye, PENG Ya-Wen, LIU Zhong-Song, XIA Shi-Tou. Correlation between salicylic acid and anthocyanins accumulation in seeds of different varieties in Brassica napus [J]. Acta Agronomica Sinica, 2025, 51(5): 1189-1197.
[8] WANG Ya-Wen, QI Zheng-Yang, YOU Jia-Qi, NIE Xin-Hui, CAO Juan, YANG Xi-Yan, TU Li-Li, ZHANG Xian-Long, WANG Mao-Jun. Preparation of cotton 60K functional locus gene chip and its application to genetic research [J]. Acta Agronomica Sinica, 2025, 51(5): 1178-1188.
[9] MENG Fan-Qi, FANG Meng-Ying, LUO Yi, LU Lin, DONG Xue-Rui, WANG Ya-Fei, GUO Li-Na, YAN Peng, DONG Zhi-Qiang, ZHANG Feng-Lu. Effect of ethephon betaine salicylic acid mixture on heat resistance and yield of summer maize [J]. Acta Agronomica Sinica, 2025, 51(5): 1299-1311.
[10] DING Jun-Feng, XU Ying-Fei, ZHANG Xiang, CHEN Yuan, CHEN De-Hua. Effects of the plant growth regulator IBA on the survival and growth of substrate- grown transplanted cotton seedlings [J]. Acta Agronomica Sinica, 2025, 51(12): 3331-3341.
[11] HALIHASHI Yibati, ZHANG Yan, LI Qing-Jun, XU Xin-Peng, HE Ping. Study on smart fertilizer recommendation methods based on yield response and agronomic efficiency for cotton [J]. Acta Agronomica Sinica, 2025, 51(11): 3052-3064.
[12] ZHAO Hai-Hong, LI Meng-Yuan, LIU Jin-Jing, WANG Yuan-Yuan, DU Lei, WANG Juan, DONG Cheng-Guang, LI Cheng-Qi. Detection of QTNs and QTN-by-environment interactions for plant height in upland cotton (G. hirsutum L.) using the 3VmrMLM method [J]. Acta Agronomica Sinica, 2025, 51(10): 2619-2631.
[13] LI Ya-Wei, XU Ying-Ying, ZUO Chun-Yang, LIU Ruo-Nan, LIANG Ya-Jun, KONG Jie, ZHANG Xian-Long, MIN Ling. Construction of a meiotic progression identification system in cotton and analysis of its response to high-temperature stress [J]. Acta Agronomica Sinica, 2025, 51(10): 2570-2580.
[14] CHEN Jia-Wei, LIN Yan, ZHANG Ming-Xing, ZHOU Shi-Jing, RAO Li-Qun, ZHOU Chi, LI Xin. Effects of Bacillus velezensis YCH92 on the rhizosphere microbial community and yield of cotton [J]. Acta Agronomica Sinica, 2025, 51(10): 2821-2835.
[15] XIE Zhang-Shu, XIE Xue-Fang, TU Xiao-Ju, LIU Ai-Yu, DONG He-Zhong, ZHOU Zhong-Hua. Research progress in phytohormone regulation of square and boll shedding in cotton [J]. Acta Agronomica Sinica, 2025, 51(1): 1-29.
Viewed
Full text


Abstract

Cited

  Shared   
  Discussed   
No Suggested Reading articles found!