Welcome to Acta Agronomica Sinica，

Acta Agronomica Sinica ›› 2023, Vol. 49 ›› Issue (11): 2966-2977.doi: 10.3724/SP.J.1006.2023.21063

;

• CROP GENETICS & BREEDING·GERMPLASM RESOURCES·MOLECULAR GENETICS • Previous Articles     Next Articles

Gene expression characteristics of TaNRT/TaNPF family in wheat cultivars with different nitrogen efficiency

WANG Lu-Lu1(), YI Zi-Bo1, WANG Hao-Zhe1, NAI Fu-Rong2, MA Xin-Ming1, ZHANG Zhi-Yong1,*(), WANG Xiao-Chun1,2,*()   

  1. 1Co-constuction State Key Laboratory of Wheat and Maize Crop Science, Henan Agricultural University, Zhengzhou 450002, Henan, China
    2Department of Biochemistry, College of Life Science, Henan Agricultural University, Zhengzhou 450002, Henan, China
  • Received:2022-09-13 Accepted:2023-04-17 Online:2023-11-12 Published:2023-05-16
  • Contact: 王小纯, E-mail: xiaochun.w@163.com; 张志勇, E-mail: zhiyongzhang@henau.edu.cn
  • Supported by:
    National Natural Science Foundation of China(32071956)

RichHTML416

35

PDF

628

Abstract:

Nitrogen is one of the essential elements for wheat growth and development, and NO3--N is the main form of nitrogen that wheat obtains from soil. NRT/NPF genes family encode membrane transporters, which are mainly involved in NO3--N absorption, transport, and allocation in plants. In order to understand the relationship between NRT/NPF family and nitrogen utilization in wheat, the relative expression characteristic of TaNRT/TaNPF family in flag leaves of N-efficient wheat cultivars Zhoumai 27 (ZM27) and N-inefficient wheat cultivars Aikang 58 (AK58) at flowering stage were studied with the second-generation sequencing technology. The results showed that 386 genes of TaNRT/TaNPF family were identified in the second generation transcriptome database. Compared with AK58, there were 27, 16, and 23 differentially expressed genes in ZM27 in reducing (N120), normal (N225), and excessive (N330) nitrogen treatments. There were 16 (59.26%), 12 (75%), and 19 (82.61%) up-regulated genes in ZM27, respectively. Seven genes were down-regulated in ZM27 in reducing nitrogen treatment. The relative expression level of TaNPF8.1 was the highest and significantly up-regulated by 1.5 times in nitrogen excessive condition. In conclusion, the relative expression of TaNRT/TaNPF family genes was regulated by nitrogen application rate and cultivar. Wheat network database showed that the relative expression of TaNRT/TaNPF family had tissue specificity and chromosomal preference. The highest expression level of TaNPF8.1 in flag leaf was located on chromosome 3A, and the root specific expression TaNRT2.2 and TaNRT3.1 were mainly distributed on chromosome 6. The stem specific expression of TaNPF4.5 was mainly distributed on chromosome 2. The qRT-PCR of TaNRT/TaNPF genes were consistent with the results of the second-generation transcriptome and network data. Interaction analysis of TaNPF8.1, TaNPF4.5, and TaNRT3.1 revealed that NO3--N transport may also require the collaborative participation of transcription factor MYB, chlorophyll A-B binding protein, and chaperone protein. These findings laid a foundation for further studies on the relationship between TaNRT/TaNPF family expression and nitrogen uptake and utilization.

Key words: wheat, NRT/NPF, nitrogen use efficiency, different expression, tissue specificity

Table 1

qRT-PCR primer sequences"

基因名称
Gene name		 正向引物序列
Forward sequence (5′-3′)		 反向引物序列
Reverse sequence (5′-3′)
NRT2.2 CCTTGGTATCATCTCCGGGC GAGGGTGACAGGAAGAGTGC
NRT3.1 CCCCCAGCTCTTCTCTTGC TCACCGGCAGCTTGGAGA
NPF4.5 AGCAGCAACCTACAAGCAGT TGGAAGCTCTCACTCCTCCA
NPF5.102D GGAAACCACGCACAGAAGC CGTGGGTGTTTTGTTCCTGTC
NPF5.101A CCCTCGTCCTGTAGCTTGAC CCAGCAGAGGACGCCATTAA
NPF8.13A TCAGAGAACGCAACCACTGT CCTGCAGGCCTTTTGATTCG
NPF8.34A ATTCCTTCTCCCTCCCCGAA GCTGGGATACTCTGCTCGGA
NPF8.34D CCCTTCCCCTTGCTTGCTTA TCGGGGTGGGAGTTGAGTTA
NPF8.31B AACGTGAAAGGGGGAGGGAT GGTTTGCCGTTGTGATTTGC
CHS2 CACCACAATAATCCTTGCTA ACTTATGACCCAATTACTGAAT
PTR1 AAGCGGGCTGATGGTGATGG CGGCGGTGACCAGGTAGAAC
POD70 CTGAGGCGAACAGCGACCTC CGGGCTCAGCTGCTTCTTGT
RPP13 TGGGTTCGGTGGCATAGGGA CCCAAGCCCGTGCTTCGTAT
ATPase CGAGGCCACCAATGACG AGTATGGTTTCAAGAAGGCGTC
TEF TCGTGGTCATTGGCCACG CAGCACAGTCAGCCTGGGAG

Fig. 1

Differentially expression genes of TaNRT/TaNPF family A: data are from the online database (https://www.wheatproteome.org/); blue-white-red indicates the relative expression level from low to high, B: data are from the second-generation transcriptome sequencing."

Fig. 2

Differential expression characteristics of TaNRT/TaNPF family in flag leaves of different cultivars with different nitrogen levels A: the number of TaNRT/TaNPF DEGs. red arrow: the up-regulated gene; green arrow: down-regulated gene. B: the number of up-regulated genes in TaNRT/TaNPF family in different nitrogen levels; C: the number of down-regulated genes in TaNRT/TaNPF family in different nitrogen levels."

Table S1

Analysis of differential gene expression in wheat cultivars with different nitrogen efficiency"

类型
Type		 基因名称
Gene name		 AK58 N120 AK58 N225 AK58 N330 ZM27 N120 ZM27 N225 ZM27 N330
Up-regulated DEGs NPF2.3 TraesCS4A03G1098900 0.14 0.29 0.03 0.69 0.35 0.50
NPF2.11 TraesCS5A03G0008900 2.79 3.03 2.19 5.70 5.64 5.08
TraesCS5B03G0001600 2.39 2.12 2.06 5.86 6.84 5.24
TraesCS5B03G0102800 8.11 6.37 6.52 11.29 11.94 9.35
NPF4.4 TraesCS4A03G0599700 0.28 0.41 0.36 0.73 0.75 1.01
NPF5.1 TraesCS7A03G1119900 2.33 2.78 2.50 3.05 3.92 3.64
TraesCS7D03G1067400 0.50 0.82 0.56 0.64 0.79 1.05
NPF5.8 TraesCS7B03G0265800 0.28 0.39 0.27 0.56 0.50 0.56
TraesCS7D03G0440800 0.60 1.17 0.91 1.28 1.37 1.45
NPF5.10 TraesCS3A03G0903800 0.59 0.75 0.43 0.71 1.01 0.93
NPF5.13 TraesCS2D03G1323700 0.88 1.19 1.23 1.11 1.58 1.93
NPF6.2 TraesCS1B03G0077900 0.33 0.39 0.37 0.19 0.23 0.95
NPF7.3 TraesCS6D03G0593500 0.21 0.29 0.16 0.44 0.37 0.40
NPF8.1 TraesCS3A03G0922900 35.44 37.45 34.96 51.56 52.52 53.18
TraesCS3A03G0923200 3.28 3.04 3.17 5.67 6.21 5.36
TraesCS3D03G0852600 0.82 0.77 0.62 0.72 0.63 0.96
TriticumnewGene_8087 17.36 16.63 15.86 25.28 25.27 24.94
NPF8.3 TraesCS7A03G1290100 0.09 0.13 0.58 1.02 0.54 1.13
TraesCS7B03G0835300 1.98 1.99 1.65 2.60 2.77 2.73
Down-regulated DEGs NRT2.4 TraesCS7B03G0882400 5.31 4.37 4.39 0.19 0.09 0.25
NPF2.11 TraesCS5D03G0010900 2.53 1.53 1.67 1.49 1.42 1.41
NPF4.6 TraesCS5D03G0163200 2.17 1.20 1.82 1.29 0.50 0.44
NPF5.2 TraesCS4D03G0779400 1.79 1.32 1.56 1.07 0.98 1.37
NPF5.10 TraesCS2A03G1350700 1.89 2.30 2.51 0.99 1.33 1.26
TraesCS2B03G1540700 1.55 1.39 1.80 0.94 1.09 1.21
TraesCS3A03G0902900 0.93 0.83 0.89 0.52 0.72 0.64
NPF8.3 TraesCS6B03G1146900 1.10 0.98 1.38 0.54 0.79 0.92
TraesCS7B03G0839000 1.56 1.53 2.33 0.24 0.43 0.56
TraesCS7B03G0839200 7.12 7.14 6.78 4.81 5.00 4.94
NPF8.5 TraesCS2D03G0016800 2.02 1.59 1.79 1.08 1.52 1.51

Fig. 3

Validation of transcriptome data by qRT-PCR A: the relative expression level of selected differentially expressed genes detected by qRT-PCR; B: FPKM values corresponding to selected genes. AK58: Aikang 58; ZM27: Zhoumai 27; N120: nitrogen reduction 120 kg hm-2; N225: normal nitrogen 225 kg hm-2; N330: excess nitrogen 330 kg hm?2; NPF5.10-1A, NPF5.10-2D, NPF8.1-3A, NPF8.3-1B, NPF8.3-4A, NPF8.3-4D: nitric acid transporter gene; CHS2: Chalcone synthase2-like; PTR1: Peptide transporter1; POD70: Peroxidase70; RPP13: disease resistance protein RPP13."

Fig. 4

Effects of cultivars and nitrogen levels on the relative expression level of TaNRT/TaNPF family genes in different tissues of wheat Blue-white-red indicates gene relative expression level from low to high. TaNPF8.1, TaNPF4.5, TaNRT2.2, TaNRT3.1: nitric acid transporter. Abbreviations are the same as those given in Fig. 3."

Fig. 5

Functional prediction of differentially expressed genes in TaNRT/TaNPF families Blue-white-red indicates gene relative expression level from low to high."

Fig. 6

Distribution of TaNRT/TaNPF genes family on wheat chromosomes A: the distribution of tissue-specific TaNRT/TaNPF gene chromosomes; B: the distribution of TaNRT/TaNPF gene regulated by nitrogen chromosomes."

Fig. 7

Protein-protein interaction (PPI) network of tissue-specific TaNRT/TaNPF Proteins are represented by nodes and interactions by wires. Gray: transcription factors; Yellow: inoraganicion transport and metabolism; Prasinous: aspartic acid protease; Red: light-inducible protein; Purple: Bowman-Birk type proteinase inhibitor; Green: crocetin glucosyltransferase; Black: GPI-anchored protein; Blue: cytochrome; Sapphire: chaperone protein; Rosy: MAH1; Buff: NAD kinase; Reseda: nitric acid transporter; Indipink: Cyanidin 3-O-rutinoside 5-O-glucosyltransferase."

[1] Kaur G, Asthir B, Bains N S. Nitrogen nutrition, its assimilation and remobilization in diverse wheat genotypes. Int J Agric Biol, 2015, 17: 531-538.
[2] Wang Y Y, Cheng Y H, Chen K E, Tsay Y F. Nitrate transport, signaling, and use efficiency. Annu Rev Plant Biol, 2018, 69: 27-66.
[3] Tegeder M, Rentsch D. Uptake and partitioning of amino acids and peptides. Mol Plant, 2010, 3: 997-1011.
doi: 10.1093/mp/ssq047 pmid: 21081651
[4] Causin H F, Barneix A J. Regulation of NH4+ uptake in wheat plants: effect of root ammonium concentration and amino acids. Plant Soil, 1993, 151: 211-218.
doi: 10.1007/BF00016286
[5] Wang H D, Wan Y F, Peter B, Robert K, Ma H X, Malcolm J. Phylogeny and gene expression of the complete nitrate transporter1/peptide transporter family in Triticum aestivum. J Exp Bot, 2020, 15: 15-30.
doi: 10.1093/jxb/15.1.15
[6] Li B, Qiu J, Jayakannan M, Bo X, Roy S J. AtNPF2.5 modulates chloride (Cl) efflux from roots of Arabidopsis thaliana. Front Plant Sci, 2017, 7: 2013-2030.
[7] Léran S, Varala K, Boyer J C, Chiurazzi M, Benot L. A unified nomenclature of nitrate transporter1/peptide transporter family members in plants. Trends Plant Sci, 2014, 19: 5-9.
doi: 10.1016/j.tplants.2013.08.008
[8] Krouk G, Lacombe B, Bielach A, Perrine-Walker F, Malinska K, Mounier E, Hoyerova K, Tillard P, Leon S, Ljung K. Nitrate- regulated auxin transport by NRT1.1 defines a mechanism for nutrient sensing in plants. Dev Cell, 2010, 18: 927-937.
doi: 10.1016/j.devcel.2010.05.008
[9] Tsay Y F, Chiu C C, Tsai C B, Ho C H, Hsu P K. Nitrate transporters and peptide transporters. FEBS Lett, 2007, 581: 2290-2300.
doi: 10.1016/j.febslet.2007.04.047
[10] Geiger D, Scherzer S, Mumm P, Stange A, Marten I, Bauer H, Ache P, Matschi S, Liese A, Khaled A S, Romeis T, Hedrich R. Activity of guard cell anion channel SLAC1 is controlled by drought stress signaling kinase-phosphatase pair. Proc Natl Acad Sci USA, 2009, 106: 21425-21430.
doi: 10.1073/pnas.0912021106
[11] Chopin F, Orsel M, Dorbe M F, Chardon F, Daniel-Vedele F. The Arabidopsis AtNRT2.7 nitrate transporter controls nitrate content in seeds. Plant Cell, 2007, 19: 1590-1602.
doi: 10.1105/tpc.107.050542
[12] Lezhneva L, Kiba T, Feriabourrelier A B, Lafouge F, Boutetmercey S, Zoufan P, Sakakibara H, Vedele F, Krapp A. The Arabidopsis nitrate transporter NRT2.5 plays a role in nitrate acquisition and remobilization in nitrogen-starved plants. Plant J, 2015, 80: 230-241.
doi: 10.1111/tpj.12626
[13] Okamoto M, Kumar A, Li W B, Wang Y, Siddiqi M Y, Crawford N M, Glass A D M. High-affinity nitrate transport in roots of Arabidopsis depends on expression of the NAR2-Like gene AtNRT3.1. Plant Physiol, 2006, 140: 1036-1046.
pmid: 16415212
[14] Ho C H, Lin S H, Hu H C, Tsay Y F. CHL 1 functions as a nitrate sensor in plants. Cell, 2018, 138: 1184-1194.
doi: 10.1016/j.cell.2009.07.004
[15] Nour-Eldin H H, Andersen T G, Burow M, Madsen S R, Jφrgensen M E, Olsen C E, Dreyer I, Hedrich R, Geiger D, Halkier B A. NRT/PTR transporters are essential for translocation of glucosinolate defence compounds to seeds. Nature, 2012, 488: 531-534.
doi: 10.1038/nature11285
[16] Segonzac C, Boyer J C, Ipotesi E, Szponarski W, Tillard P, Touraine B, Sommerer N, Rossignol M, Gibrat R. Nitrate efflux at the root plasma membrane: identification of an Arabidopsis excretion transporter. Plant Cell, 2007, 19: 3760-3777.
doi: 10.1105/tpc.106.048173 pmid: 17993627
[17] Chiba Y, Shimizu T, Miyakawa S, Kanno Y, Koshiba T, Kamiya Y, Seo M. Identification of Arabidopsis thaliana NRT1/PTR family (NPF) proteins capable of transporting plant hormones. J Plant Res, 2015, 128: 679-686.
doi: 10.1007/s10265-015-0710-2
[18] Tal I, Zhang Y, Jorgensen M E, Pisanty O, Barbosa I C, Zourelidou M, Regnault T, Crocoll C, Olsen C E, Weinstain R. The Arabidopsis NPF3 protein is a GA transporter. Nat Commun, 2016, 7: 11486-11496.
doi: 10.1038/ncomms11486
[19] Kanno Y, Kamiya Y, Mitsunori S. Nitrate does not compete with abscisic acid as a substrate of AtNPF4.6/NRT1.2/AIT1 in Arabidopsis. Plant Signal Behav, 2013, 8: 26624-26626.
doi: 10.4161/psb.26624 pmid: 24084651
[20] He Y N, Peng J S, Cai Y, Liu D F, Guan Y, Yi H Y, Gong J M. Tonoplast-localized nitrate uptake transporters involved in vacuolar nitrate efflux and reallocation in Arabidopsis. Sci Rep, 2017, 7: 6417-6426.
doi: 10.1038/s41598-017-06744-5
[21] Li J Y, Fu Y L, Pike S M, Bao J, Tian W, Zhang Y, Chen C Z, Zhang Y, Li H M, Huang J. The Arabidopsis nitrate transporter NRT1.8 functions in nitrate removal from the xylem sap and mediates cadmium tolerance. Plant Cell, 2010, 22: 1633-1646.
doi: 10.1105/tpc.110.075242
[22] Komarova N Y, Thor K, Gubler A, Meier S, Dietrich D, Weichert A, Grotemeyer S M, Tegeder M, Rentsch D. AtPTR1 and AtPTR5 transport dipeptides in planta. Plant Physiol, 2008, 148: 856-869.
doi: 10.1104/pp.108.123844 pmid: 18753286
[23] Xia X, Fan X, Wei J, Feng H, Xu G. Rice nitrate transporter OsNPF2.4 functions in low-affinity acquisition and long-distance transport. J Exp Bot, 2014, 66: 317-323.
doi: 10.1093/jxb/eru425
[24] Li S B, Qian Q, Fu Z M, Zeng D L, Meng X P, Kyozuka J, Maekawa M, Zhu X D, Zhang J, Li J Y, Wang Y F. Short panicle1 encodes a putative PTR family transporter and determines rice panicle size. Plant J, 2009, 58: 592-605.
doi: 10.1111/tpj.2009.58.issue-4
[25] Hu B, Wang W, Ou S, Tang J, Li H, Che R, Zhang Z, Chai X, Wang H, Wang Y. Variation in NRT1.1B contributes to nitrate-use divergence between rice subspecies. Nat Genet, 2015, 47: 834-838.
doi: 10.1038/ng.3337
[26] Jie O, Cai Z, Xia K, Wang Y, Duan J, Zhang M. Identification and analysis of eight peptide transporter homologs in rice. Plant Sci, 2010, 179: 374-382.
doi: 10.1016/j.plantsci.2010.06.013
[27] Zhong T, Yi C, Fei C, Ji Y, Zhao F J. OsPTR7 (OsNPF8.1), a putative peptide transporter in rice, is involved in dimethylarsenate accumulation in rice grain. Plant Cell Physiol, 2017, 58: 904-913.
doi: 10.1093/pcp/pcx029 pmid: 28340032
[28] Liu B H, Wu J Y, Yang S Q, Schiefelbein J, Gan Y B. Nitrate regulation of lateral root and root hair development in plants. J Exp Bot, 2020, 71: 4405-4414.
doi: 10.1093/jxb/erz536 pmid: 31796961
[29] 韦一昊. 小麦谷氨酰胺合成酶同工酶的定位、表达与功能研究. 河南农业大学博士学位论文,河南郑州, 2021.
Wei Y H. Localization, Expression and Function of Glutamine Synthase Isoenzyme in Wheat. PhD Dissertation of Henan Agricultural University, Zhengzhou, Henan, China, 2021.
[30] Li B J, Zhang B Q, Wang J Y, Tsai W C, Lu H C, Zou L H, Wan X, Zhang D Y, Qiao H J, Liu Z J. New insight into the molecular mechanism of colour differentiation among floral segments in orchids. Commun Biol, 2020, 3: 1-13.
doi: 10.1038/s42003-019-0734-6
[31] Kim T J, Park S Y, Lim S H, Yeo Y, Cho H S, Ha S H. Comparative metabolic profiling of pigmented rice (Oryza sativa L.)cultivars reveals primary metabolites are correlated with secondary metabolites. J Cereal Sci, 2013, 57: 14-20.
doi: 10.1016/j.jcs.2012.09.012
[32] Li J, Zhao S, Yu X, Du W, Ruan C. Role of Xanthoceras sorbifolium MYB44 in tolerance to combined drought and heat stress via modulation of stomatal closure and ROS homeostasis. New Phytol, 2021, 162: 410-420.
[33] Tegeder M, Masclaux-Daubresse C. Source and sink mechanisms of nitrogen transport and use. New Phytol, 2018, 217: 35-53.
doi: 10.1111/nph.14876 pmid: 29120059
[1] Mao Jia-Qi, Huang Peng-Yu, Zhao Jia-Jia, Zheng Xing-Wei, Wu Bang-Bang, Hao Yu-Qiong, Qu Fei, Liu Cheng, Ma Peng-Tao, Zheng Jun. Evaluation of powdery mildew resistance in wheat cultivars and molecular detection of resistance genes in Shanxi province, China [J]. Acta Agronomica Sinica, 2026, 52(6): 1669-1681.
[2] Hu Chuan, Zhao Kai-Nan, Huang Xiu-Li, Wu Jin-Zhi, Ren Kai-Ming, Wang He-Zheng, Fu Guo-Zhan, Huang Ming, Li You-Jun. Effects of tillage methods and nitrogen rates on yield and quality of dryland wheat under one-off irrigation [J]. Acta Agronomica Sinica, 2026, 52(6): 1830-1846.
[3] Chen Xue-Yan, He Hua-Chuan, Li Zheng-Jia, Dong Xin-Pan, Li Ou-Qi, Liu Xiao-Yun, Li Dan-Ping, Chen Zhi-Wei, Liu Guo-Xia, Lyu Sheng-Yuan, Wu Yin-Ying, Zhao Zhen-Dong, Cao Xin-You, Wan He-Ping. Dynamic changes in root organic acid secretion and its transcriptional regulatory mechanisms in ‘Jimai 60’ seedlings under combined salinity-alkalinity stress in hydroponics [J]. Acta Agronomica Sinica, 2026, 52(6): 1859-1875.
[4] Gao Pei-Yang, Li Jin-Xuan, Dong Yu-Kui, Shi Yu, Zhang Zhen, Zhang Yong-Li. Response of wheat tillering and spike formation to nitrogen rate under supplementary irrigation based on soil moisture content [J]. Acta Agronomica Sinica, 2026, 52(6): 1847-1858.
[5] Zhang Xian-Feng, Guo Li-Jian, Li Kang-Chun, Kong Bin-Xue, Liu Yu-Fang, Che Zhuo, Yang De-Long. Identification of the ABHD6 gene family and development of functional markers for grain weight in wheat [J]. Acta Agronomica Sinica, 2026, 52(6): 1711-1727.
[6] Zhai Sheng-Nan, Cao Xin-You, Li Hao-Sheng, Li Ji-Hu, Li Fa-Ji, Liu Jin-Dong, Xia Xian-Chun, Lyu Ying-Ying, Ma Rui-Feng, Wang Ying, Geng Hong-Wei, Liu Jian-Jun. Analysis of the genetic effects of allelic variation at the Pod-A1, Pod-D1, and Pod-2D loci on peroxidase activity in wheat grains [J]. Acta Agronomica Sinica, 2026, 52(6): 1593-1603.
[7] Xi Qian-Hui, Xu Zi-Yuan, Liu Meng-Meng, Wang Hong-Yi, Lang Kai-Lin, Jing Zhen-Hai, Chen Feng, Zhao Lei. Genome-wide association study and candidate gene prediction of grain copper content in wheat [J]. Acta Agronomica Sinica, 2026, 52(6): 1604-1617.
[8] Wang Zhuang-Zhuang, Wu Zi-Jun, Zhang Yong-Xin, Zhang Xin-Yuan, Yuan Li-Xue, Chen Ru-Xue, Liu Shi-Ju, Duan Jian-Zhao, Feng Wei, Wang Tong-Chao, Wang Yong-Hua. Optimized water-nitrogen synergy enhances winter wheat yield and nitrogen use efficiency in clay-loam fluvo-aquic soils of southeastern Henan, China [J]. Acta Agronomica Sinica, 2026, 52(5): 1501-1521.
[9] He Wan-Long, Geng Hong-Wei, Zhang Fei-Fei, Mikereayi·Ababaikere , Luo Zi-Yang, Li Peng-Cheng, Zhou Zhao-Yu, Cheng Yu-Kun. Development of a deep learning-based image recognition system for major wheat diseases [J]. Acta Agronomica Sinica, 2026, 52(5): 1401-1417.
[10] Zhang Zhen, Feng Lian-Jie, Shi Yu, Yu Zhen-Wen, Zhang Yong-Li. Yield formation of wheat with different ear types under water-saving supplementary irrigation conditions [J]. Acta Agronomica Sinica, 2026, 52(5): 1522-1535.
[11] Hou Si-Yu, Wang Guo-Cui, Wei Jin-Gui, Xie Wei-Xin, Yin Wen, Fan Zhi-Long, Chai Qiang, Hu Fa-Long. Effects of green manure combined with chemical nitrogen fertilizer on dry matter accumulation and yield formation of wheat in arid irrigation areas of northwestern China [J]. Acta Agronomica Sinica, 2026, 52(4): 1208-1219.
[12] Shang Yun-Qiu, Zhao Zhu, Chen Huan, Ding Yong-Gang, Qiao Yu-Qiang, Li Wei, Zhang Xiang-Qian, Cao Cheng-Fu, Du Shi-Zhou. Effects of long-term tillage practices on grain-filling and yield formation in rain-fed wheat [J]. Acta Agronomica Sinica, 2026, 52(4): 1236-1250.
[13] Qiao Yu-Xin, Li Cheng-Yue, Kang Xiao-Yu, Zhang Xin-Qi, Jia Shao-Hui, Liu Qian, Cao Ya-Li, Shi Xin-Rui, Hao Xing-Yu, Li Ping. Study on the effects of long-term no-tillage straw mulching on wheat yield improvement in dryland areas based on the APSIM model [J]. Acta Agronomica Sinica, 2026, 52(4): 1181-1192.
[14] Li Can, Zhang Xi-Wei, Zhu Bo-Tao, Zhang Pei-Pei. Functional characterization of wheat GSK kinase TaSK41 and screening for interacting proteins [J]. Acta Agronomica Sinica, 2026, 52(3): 677-687.
[15] Hou Jie, Fu Duo-Duo, Wu Hai-Feng, Hao Yu-Qiong, Zheng Xing-Wei, Wu Bang-Bang, Zhou Kai, Li Xiao-Hua, Zheng Jun, Zhao Jia-Jia. Chromosome diversity and its effects in wheat landraces from Shanxi province, China [J]. Acta Agronomica Sinica, 2026, 52(3): 746-763.
Viewed
Full text


Abstract

Cited
  Shared   
  Discussed   
No Suggested Reading articles found!
Add: No. 80 Xueyuan South Rd, Beijing 100081, P. R. China E-mail: zwxb301@caas.cn
Supported by Beijing Magtech Co.Ltd