Welcome to Acta Agronomica Sinica,

Acta Agronomica Sinica ›› 2023, Vol. 49 ›› Issue (8): 2088-2096.doi: 10.3724/SP.J.1006.2023.23059

;

• CROP GENETICS & BREEDING · GERMPLASM RESOURCES · MOLECULAR GENETICS • Previous Articles     Next Articles

Characterization and genetic analysis of a new allelic mutant of Miniature1 gene in maize

WANG Juan(), XU Xiang-Bo, ZHANG Mao-Lin, LIU Tie-Shan, XU Qian, DONG Rui, LIU Chun-Xiao, GUAN Hai-Ying, LIU Qiang, WANG Li-Ming(), HE Chun-Mei()   

  1. Maize Research Institute, Shandong Academy of Agricultural Sciences / National Engineering Research Center of Wheat and Maize / Key Laboratory of Biology and Genetic Improvement of Maize in Northern Yellow-Huai River Plain, Ministry of Agriculture and Rural Affairs, Jinan 250100, Shandong, China
  • Received:2022-09-07 Accepted:2023-02-10 Online:2023-08-12 Published:2023-02-28
  • Contact: WANG Li-Ming,HE Chun-Mei E-mail:wqian456@163.com;13605401923@126.com;chunmeihe11@163.com
  • Supported by:
    National Natural Science Foundation of China(32101761);National Natural Science Foundation of China(31971964);Agricultural Science and Technology Innovation Project of the Shandong Academy of Agricultural Sciences(CXGC2022A02)

Abstract:

Grain development is a key determinant for maize grain yield and quality, but the regulatory mechanisms have not been fully revealed. A maize mutant deficient in kernel development was found and selected in our field. The mutant exhibited an incomplete grain filling, reduced embryo and endosperm size, and shriveled mature grains and empty pericarp. Genetic analysis suggested that the mutant phenotype was controlled by a single recessive nuclear gene. The candidate gene was preliminarily mapped to a 1.1 Mb interval on chromosome 2, and further a hAT transposon was inserted into the first exon of Miniature1 (Mn1) gene, which resulting in a frame-shift mutation and down-regulated expression of Mn1. The transposon insertion was fully linked to the defective kernel phenotype of the mutant, which was nominated as mn1-m2. Allelism test of mn1-m2 and mn1-89 suggested that mn1-m2 was a noval allelic mutant of Mn1 gene. In conclusion, we identified a new allelic mutant of Mn1 gene with different mutation site and type, which improved maize germplasm resources and provided new genetic materials for the analysis of the mechanism of Mn1 regulation on kernel development.

Key words: maize, grain filling, Mn1, mutant

Table 1

Molecular markers used for gene mapping"

引物名称
Primer name
正向引物
Forward primer (5′-3′)
反向引物
Reverse primer (5′-3′)
umc2249 AGAAGGTCGTCGTCCTGGAAC GCATAGACTCCCTGACAGCCAC
umc2030 CTTCAGCAACCGGAGACGAG GATGCAGTGTGCCAATAAAGATGA
umc2079 CGGCCTCGCTGTCTTCTAGC ATGATCACGTCGTGCTGGTAGTG
umc2125 CAAGGGTAAGGGCAAGATGGTAGT CTGAGGTCTACCTCGGCCATC
IDP1 TGCACATGTCTGGTACTCGC GTCATGCTGTCCAACACCG
IDP2 TGCGATATCTGTGTTTGCCTTG ACATCCATGCCATGAACTTTGC
IDP3 TGTAGCAGACACTCTCAAGCACAAC CCCTGGGAACCAAATCAGCCACA
IDP4 AGCAGGTCCGAGGAGTTTC CGGGAGACGGTTTGAATG
IDP5 GGAAACAGCAGTAGCAGAGAGA CTCCTAGTACGTGATTGCATCCA

Table 2

Primers used for Mn1 specific InDel markers and RT-PCR"

引物名称
Primer name
正向引物
Forward primer (5′-3′)
反向引物
Reverse primer (5′-3′)
InDel (P1/P2) TGTGATATGGCAGCTAAGAG CGAGGTCCTTGTAGTTGTAG
Mn1 RT-PCR CTGGGCTAACGAGTCCGACT CCACACCGTCCTTGGAATCG
FPGS RT-PCR ATCTCGTTGGGGATGTCTTG AGCACCGTTCAAATGTCTCC

Fig. 1

Morphological analysis of wild type and mn1-m2 mutant A: mature ears of wild type (WT), heterozygous (+/mn1-m2), and homozygous mn1-m2, and arrows indicate the mutant kernels segregated from ears of the heterozygous plants; B: three-week old seedlings; C: mature kernels; D: kernel endosperm and embryo of 25 days after pollination (DAP); E: statistical analysis of hundred-kernel weight. Bar: 5 cm (A) and 1 cm (C-D)."

Fig. 2

Paraffin section observation of WT and mn1-m2 kernels at 20 DAP A: the endosperm observation of WT kernels at 20 DAP; B: the endosperm observation of mn1-m2 kernels at 20 DAP; C: the magnification of the area marked as red rectangle in (A); D: the magnification of the area marked as red rectangle in (B). Bar: 500 μm (A-B) and 100 μm (C-D)."

Fig. 3

Map-based cloning of mn1-m2 gene The polymorphic SSR and In-Del (IDP) markers were developed between mn1-m2 and B73, using the amplified F2 mapping population and, sequencing of putative genes in the target region, the mn1-m2 locus was finally mapped to Mn1, which encodes a cell wall invertase. An hAT transposon (166 bp) was inserted into the first exon at 18 bp from ATG. The gene marked in red was Mn1. Black boxes represent exons and lines represent introns. n: the number of individuals; Recombinants: the number of recombinants."

Fig. 4

Relative expression level of mn1 and identification of hAT transposon insertion in mn1-m2 mutant A: the relative expression level of Mn1 in 15-DAP kernels of WT and mn1-m2, FPGS: reference gene; B: the schematic diagram shows that primers P1 and P2 of the developed In-Del marker flank the hAT transposon; C: the In-Del marker was completely linked with the mn1-m2 mutant phenotype. The length of the PCR products was 495 bp for WT, and 661 bp for mn1-m2. M: DNA marker DL2000."

Fig. 5

Allelism test of mn1-m2 and mn1-89 A: gene structure of Mn1 and mutant sites of the two mutants; B: the ear phenotype of mutant mn1-m2, mn1-89 and mn1-m2×mn1-89; C: the kernels of WT for mn1-m2; D: the kernels of mn1-m2; E: the kernels of mn1-m2×mn1-89; F: the kernels of mn1-89; G: the kernels of W22. Bar: 5 cm (B) and 1 cm (C-G)."

Fig. 6

Relative expression levels of Mn1 gene in various maize tissues by RT-PCR A: RNA was extracted from young ear, bract, silk, tassel, and flag leaf for detecting Mn1 expression level; B: RNA was extracted from embryo and endosperm of 13, 15, 19, 23, and 29 DAP for detecting Mn1 expression level. FPGS: the reference gene."

[1] Olsen O A. ENDOSPERM DEVELOPMENT: cellularization and cell fate specification. Annu Rev Plant Physiol Plant Mol Biol, 2001, 52: 233-267.
doi: 10.1146/arplant.2001.52.issue-1
[2] Bommert P, Werr W. Gene expression patterns in the maize caryopsis: clues to decisions in embryo and endosperm development. Gene, 2001, 271: 131-142.
pmid: 11418234
[3] Clark J K, Sheridan F. Mutations of maize. Plant Cell, 1991, 3: 935-951.
doi: 10.2307/3869156
[4] Sheridan W F, Clark J K. Mutational analysis of morphogenesis of the maize embryo. Plant J, 1993, 3: 347-358.
doi: 10.1111/j.1365-313X.1993.tb00186.x
[5] Kesavan M, Song J T, Seo H S. Seed size: a priority trait in cereal crops. Physiol Plant, 2013, 147: 113-120.
doi: 10.1111/j.1399-3054.2012.01664.x pmid: 22680622
[6] Martin A, Lee J, Kichey T, Gerentes D, Zivy M, Tatout C, Dubois F, Balliau T, Valot B, Davanture M, Tercé-Laforgue T, Quilleré I, Coque M, Gallais A, Gonzalez-Moro M, Bethencourt L, Habash D Z, Lea P J, Charcosset A, Perez P, Murigneux A, Sakakibara H, Edwards K J, Hirel B. Two cytosolic glutamine synthetase isoforms of maize are specifically involved in the control of grain production. Plant Cell, 2006, 18: 3252-3274.
doi: 10.1105/tpc.106.042689 pmid: 17138698
[7] Li Q, Li L, Yang X H, Warburton M L, Bai G H, Dai J R, Li J S, Yan J B. Relationship, evolutionary fate and function of two maize co-orthologs of rice GW2 associated with kernel size and weight. BMC Plant Biol, 2010, 10: 143.
doi: 10.1186/1471-2229-10-143
[8] Li Q, Yang X, Bai G H, Warburton M L, Mahuku G, Gore M, Dai J R, Li J S, Yan J B. Cloning and characterization of a putative GS3 ortholog involved in maize kernel development. Theor Appl Genet, 2010, 120: 753-763.
doi: 10.1007/s00122-009-1196-x
[9] Manavski N, Guyon V, Meurer J, Wienand U, Brettschneider R. An essential pentatricopeptide repeat protein facilitates 5’ maturation and translation initiation of rps3 mRNA in maize mitochondria. Plant Cell, 2012, 24: 3087-3105.
doi: 10.1105/tpc.112.099051
[10] Li X J, Zhang Y F, Hou M, Sun F, Shen Y, Xiu Z H, Wang X, Chen Z L, Sun S S, Small I, Tan B C. Small kernel 1 encodes a pentatricopeptide repeat protein required for mitochondrial nad7 transcript editing and seed development in maize (Zea mays) and rice (Oryza sativa). Plant J, 2014, 79: 797-809.
doi: 10.1111/tpj.2014.79.issue-5
[11] Sosso D, Luo D, Li Q B, Sasse J, Yang J, Gendrot G, Suzuki M, Koch K E, McCarty D R, Chourey P S, Rogowsky P M, Ross-Ibarra J, Yang B, Frommer W B. Seed filling in domesticated maize and rice depends on SWEET-mediated hexose transport. Nat Genet, 2015, 47: 1489-1493.
doi: 10.1038/ng.3422 pmid: 26523777
[12] Manoli A, Sturaro A, Trevisan S, Quaggiotti S, Nonis A. Evaluation of candidate reference genes for qPCR in maize. J Plant Physiol, 2012, 169: 807-815.
doi: 10.1016/j.jplph.2012.01.019
[13] Miller M E, Chourey P S. The maize invertase-deficient miniature-1 seed mutation is associated with aberrant pedicel and endosperm development. Plant Cell, 1992, 4: 297-305.
doi: 10.2307/3869541
[14] Cheng W H, Taliercio E W, Chourey P S. The Míniature1 seed locus of maize encodes a cell walI invertase required for normal development of endosperm and maternal cells in the pedicel. Plant Cell, 1996, 8: 971-983.
doi: 10.2307/3870209
[15] Carlson S J, Shanker S, Chourey P S. A point mutation at the miniature1 seed locus reduces levels of the encoded protein, but not its mRNA, in maize. Mol Gen Genet, 2000, 263: 367-373.
doi: 10.1007/s004380051180
[16] Dai D W, Ma Z Y, Song R T. Maize kernel development. Mol Breed, 2021, 41: 2.
doi: 10.1007/s11032-020-01195-9
[17] Gutiérrez-Marcos J F, Dal Prà M, Giulini A, Costa L M, Gavazzi G, Cordelier S, Sellam O, Tatout C, Paul W, Perez P, Dickinson H G, Consonni G. Empty pericarp4encodes a mitochondrion- targeted pentatricopeptide repeat protein necessary for seed development and plant growth in maize. Plant Cell, 2007, 19: 196-210.
doi: 10.1105/tpc.105.039594 pmid: 17259266
[18] Yang Y Z, Ding S, Wang H C, Sun F, Huang W L, Song S, Xu C, Tan B C. The pentatricopeptide repeat protein EMP9 is required for mitochondrial ccmB and rps4 transcript editing, mitochondrial complex biogenesis and seed development in maize. New Phytol, 2017, 214: 782-795.
doi: 10.1111/nph.14424 pmid: 28121385
[19] Ren X M, Pan Z Y, Zhao H L, Zhao J L, Cai M J, Li J, Zhang Z X, Qiu F Z. Empty pericarp 11 serves as a factor for splicing of mitochondrial nad1 intron and is required to ensure proper seed development in maize. J Exp Bot, 2017, 68: 4571-4581.
doi: 10.1093/jxb/erx212
[20] Xiu Z H, Sun F, Shen Y, Zhang X Y, Jiang R C, Bonnard G, Zhang J H, Tan B C. EMPTY PERICARP 16 is required for mitochondrial nad2 intron 4 cis-splicing, complex I assembly and seed development in maize. Plant J, 2016, 85: 507-519.
doi: 10.1111/tpj.13122
[21] Yi F, Gu W, Li J F, Chen J, Hu L, Cui Y, Zhao H M, Guo Y, Lai J S, Song W B. Miniature Seed6, encoding an endoplasmic reticulum signal peptidase, is critical in seed development. Plant Physiol, 2021, 185: 985-1001.
doi: 10.1093/plphys/kiaa060
[22] Li B, Liu H, Zhang Y, Kang T, Zhang L, Tong J H, Xiao L T, Zhang H X. Constitutive expression of cell wall invertase genes increases grain yield and starch content in maize. Plant Biotechnol J, 2013, 11: 1080-1091.
doi: 10.1111/pbi.12102 pmid: 23926950
[23] Fridman E, Carrari F, Liu Y S, Fernie A R, Zamir D. Zooming in on a quantitative trait for tomato yield using interspecific introgressions. Science, 2004, 305: 1786-1789.
doi: 10.1126/science.1101666 pmid: 15375271
[24] Wang E T, Wang J J, Zhu X D, Hao W, Wang L Y, Li Q, Zhang L X, He W, Lu B R, Lin H X, Ma H, Zhang G Q, He Z H. Control of rice grain-filling and yield by a gene with a potential signature of domestication. Nat Genet, 2008, 40: 1370-1374.
doi: 10.1038/ng.220 pmid: 18820698
[25] Chourey P S, Jain M, Li Q B, Carlson S J. Genetic control of cell wall invertase in developing endosperm of maize. Planta, 2006, 223: 159-167.
doi: 10.1007/s00425-005-0039-5 pmid: 16025339
[26] Liu J, Huang J, Guo H, Lan L, Wang H Z, Xu Y C, Yang X H, Li W Q, Tong H, Xiao Y J, Pan Q C, Qiao F, Raihan M S, Liu H J, Zhang X H, Yang N, Wang X Q, Deng M, Jin M L, Zhao L J, Luo X, Zhou Y, Li X, Zhan W, Liu N N, Wang H, Chen G S, Li Q, Yan J B. The conserved and unique genetic architecture of kernel size and weight in maize and rice. Plant Physiol, 2017, 175: 774-785.
doi: 10.1104/pp.17.00708 pmid: 28811335
[27] Vilhar B, Kladnik A, Blejec A, Chourey P S, Dermastia M. Cytometrical evidence that the loss of seed weight in the miniature1 seed mutant of maize is associated with reduced mitotic activity in the developing endosperm. Plant Physiol, 2002, 129: 23-30.
[1] Liang Jin-Yu, Yin Jia-De, Wang Hong-Li, Zhang Guo-Ping, Hou Hui-Zhi, Dong Bo, Ma Ming-Sheng. Estimation of leaf nitrogen content in dryland forage maize using UAV-based hyperspectral imaging and machine learning [J]. Acta Agronomica Sinica, 2026, 52(6): 1788-1801.
[2] Yang Yang, Chang Shi-Hui, Tian Hong-Li, Yi Hong-Mei, Wang Lu, Ren Jie, Fan Ya-Ming, Liu Ya-Wei, Wang Feng-Ge, Zhao Jiu-Ran. Genetic diversity analysis of nationally approved maize varieties in different ecological regions [J]. Acta Agronomica Sinica, 2026, 52(5): 1352-1364.
[3] Yang Xin-Yu, Cui Wen-Tao, Dilinigeer Alimu, Wang Kai-Xiang, Wu Peng-Hao, Ren Jiao-Jiao. Genome-wide association and genomic selection analysis of the number of leaves above the ear in maize [J]. Acta Agronomica Sinica, 2026, 52(5): 1573-1590.
[4] Han Ya-Xin, He Guan-Hua, Zhang Xiao-Qiong, Zhang Deng-Feng, Li Yong-Xiang, Liu Xu-Yang, Wang Tian-Yu, Li Yu, Zou Hua-Wen, Li Chun-Hui. Identification of maize lateral root density genes resources through integrated RNA-seq and BSA-seq analyses [J]. Acta Agronomica Sinica, 2026, 52(5): 1341-1352.
[5] Zhang Zhen, Feng Lian-Jie, Shi Yu, Yu Zhen-Wen, Zhang Yong-Li. Yield formation of wheat with different ear types under water-saving supplementary irrigation conditions [J]. Acta Agronomica Sinica, 2026, 52(5): 1522-1535.
[6] Sun Shu-Feng, Xu Zhen-Nan, Huang Jia-Xin, Weng Jian-Feng, Li Xin-Hai. Genome-wide identification of the maize MAPK gene family and its response to Fusarium verticillioides infection [J]. Acta Agronomica Sinica, 2026, 52(5): 1291-1308.
[7] Zhang Ning-Ning, Teng Yu-Fei, Ren Na-Na, Wei Xing-Zhuo, Yan Shu-Hao, Fan Ke-Xin, Wang Yong-Hong, Chen Wen-Kang, Zhang Xing-Hua, Zhu Wan-Chao, Xu Shu-Tu, Xue Ji-Quan. Phenotypic evaluation and plasticity analysis of drought resistance in 201 maize inbred lines [J]. Acta Agronomica Sinica, 2026, 52(5): 1309-1325.
[8] Zhang Ying-Xing, Bheel Chander Kumar, Song Yu-Zhen, Wang Yue, Cao Yue, Khound Rituraj, Santra Dipak Kumar, Cao Xiao-Ning, Wang Rui-Yun. Screening and phenotypic characterization of EMS-induced mutants with elite agronomic traits in broomcorn millet [J]. Acta Agronomica Sinica, 2026, 52(5): 1388-1400.
[9] Zhang Hong-Rong, Wang Fei-Er, Li Pan, Qiu Hai-Long, Zhu Jing, Zhao Lian-Hao, Nan Yun-You, He Wei, Fan Zhi-Long, Hu Fa-Long, Chai Qiang, Yin Wen. Photosynthetic characteristics of 20% reduced irrigation combined with 25% organic substitution for chemical fertilizer in increasing silage maize yield [J]. Acta Agronomica Sinica, 2026, 52(5): 1487-1500.
[10] Shang Yun-Qiu, Zhao Zhu, Chen Huan, Ding Yong-Gang, Qiao Yu-Qiang, Li Wei, Zhang Xiang-Qian, Cao Cheng-Fu, Du Shi-Zhou. Effects of long-term tillage practices on grain-filling and yield formation in rain-fed wheat [J]. Acta Agronomica Sinica, 2026, 52(4): 1236-1250.
[11] Cai Hong-Wei, Yu Ai-Zhong, Jiang Ke-Qiang, Wang Peng-Fei, Wang Yu-Long, Huo Jian-Zhe, Pang Xiao-Neng, Yin Bo, Shang Yong-Pan. Key mechanisms underlying the enhancement of sweet maize yield through partial substitution of chemical fertilizers with organic manure in arid irrigation districts [J]. Acta Agronomica Sinica, 2026, 52(4): 1166-1180.
[12] Tian Hong-Li, Yang Yang, Fan Ya-Ming, Yi Hong-Mei, Guo Dan-Dan, Wang Feng-Ge, Zhao Jiu-Ran. A novel set of tri-allelic variant SNP loci suitable for maize variety identification [J]. Acta Agronomica Sinica, 2026, 52(4): 993-1005.
[13] Meng Cheng, Wang Zhe. Genome-wide identification and expression analysis of the ZmPFK gene family under biotic and abiotic stresses in maize [J]. Acta Agronomica Sinica, 2026, 52(3): 764-779.
[14] Li Xin-Hao, Xing Meng-Ke, Zhou Zi-Hui, Li Si-Ye, Ren Hao, Wang Hong-Zhang, Lai Hua-Jiang. Exogenous melatonin enhances heat tolerance of maize at the seedling stage by coordinating light and dark reactions [J]. Acta Agronomica Sinica, 2026, 52(3): 839-856.
[15] Guo Xiang-Yang, Tu Liang, Wang Dong, Liu Peng-Fei, Wang An-Gui, Yi Qiang, Ren Hong, Li Gang, Zhu Yun-Fang, Wu Xun, Jiang Yu-Lin, Tian Feng, Chen Ze-Hui. Application and prospects of Suwan germplasm in maize breeding in China [J]. Acta Agronomica Sinica, 2026, 52(3): 655-664.
Viewed
Full text


Abstract

Cited

  Shared   
  Discussed   
No Suggested Reading articles found!