Welcome to Acta Agronomica Sinica，

Acta Agronomica Sinica ›› 2022, Vol. 48 ›› Issue (5): 1119-1128.doi: 10.3724/SP.J.1006.2022.12022

• CROP GENETICS & BREEDING · GERMPLASM RESOURCES · MOLECULAR GENETICS • Previous Articles     Next Articles

Functional studies of rice blast resistance related gene OsSAMS1

YANG De-Wei1,2(), WANG Xun1(), ZHENG Xing-Xing1, XIANG Xin-Quan1, CUI Hai-Tao1, LI Sheng-Ping1,*(), TANG Ding-Zhong1,*()   

  1. 1College of Agriculture, Fujian Provincial Key Laboratory of Crop Breeding by Design, Plant Immunity Center, Fujian Agriculture and Forestry University, Fuzhou 350002, Fujian, China
    2Institute of Rice, Fujian Academy of Agricultural Sciences, Fuzhou 350018, Fujian, China
  • Received:2021-04-02 Accepted:2021-09-09 Online:2022-05-12 Published:2021-10-18
  • Contact: LI Sheng-Ping,TANG Ding-Zhong E-mail:dewei-y@163.com;1448293617@qq.com;lishun1981@126.com;dztang@fafu.edu.cn
  • About author:First author contact:**Contributed equally to this work
  • Supported by:
    Special Fund for Agro-scientific Research in the Public Interest of Fujian Province(2020R11010016-3);Natural Science Foundation of Fujian Province(2019J01424);Major Science and Technology Projects of Fujian Province(2020NZ08016)

RichHTML398

49

PDF

692

Abstract:

Rice blast is one of the most devastating diseases in rice, which causes great economic losses to agricultural production. It has been reported that S-Adenosyl-l-Mmethionine Synthetase 1 (OsSAMS1) is involved in the process of senescence in rice. Transcriptome sequencing analysis showed that the relative expression level of OsSAMS1 was significantly increased after inoculation with Magnaporthe oryzae (M. oryzae). However, it remains unclear whether OsSAMS1 is involved in rice immunity. To verify this, we constructed the knock-out mutants of OsSAMS1 in the wild type variety ZH11. The results showed that OsSAMS1 was mainly expressed in rice leaves, and its expression was significantly induced by M. oryzae inoculation. Subcellular localization revealed that OsSAMS1 was distributed in the plasma membrane, cytoplasm, and nucleus. Compared to the wild type, the two knockout mutants, ossams1-1 and ossams1-2, displayed enhanced susceptibility upon M. oryzae infection, and the expression of pathogenesis-related (PR) genes was significantly inhibited. In addition, ethylene synthesis-related genes were also dramatically decreased in both two mutants. These results suggested that OsSAMS1 was involved in rice immune response and positively regulated rice blast resistance, which lays a foundation for further revealing the molecular mechanism of OsSAMS1 in plant immunity and provides genetic resources for rice breeding of blast resistance.

Key words: rice, rice blast disease, OsSAMS1, ethylene, function research

Table 1

Primers of OsSAMS1 used in the study"

引物名称
Primer name		 前引物
Forward sequence (5′-3′)		 后引物
Reverse sequence (5′-3′)
PR1a CGTGTCGGCGTGGGTGT GGCGAGTAGTTGCAGGTGATG
PR5 CAACAGCAACTACCAAGTCGTCTT CAAGGTGTCGTTTTATTCATCAACTTT
PR6 CAACAGCAACTACCAAGTCGTCTT CAAGGTGTCGTTTTATTCATCAACTTT
PR10 CCCTGCCGAATACGCCTAA CTCAAACGCCACGAGAATTTG
OsACS1 ACCAAGATGTCCAGCTTCGG GAGGAGGTACTGCGTCTGGG
OsACS2 GGAATAAAGCTGCTGCCGAT TGAGCCTGAAGTCGTTGAAGC
OsACS4 GATGTTGCGCTGGAGAGGATA TTCCCAATTGTTGCTTTGCA
OsACS6 ACAATCAGGCAAAGAAGCGAG TTGGATATGAGAACCCCACGA
SAMS1-GFP ATTTGGAGAGGACAGGGTACCATGGCCGCACTTGATACCTTC AGTGTCGACTCTAGAGGATCCGGCAGAAGGCTTCTCCCACT
SAMS1-qRT-PCR TTCTCTGGCAAGGACCCAAC GGACACCGATGGCGTATGAT
Ubiquitin AACCAGCTGAGGCCCAAGA ACGATTGATTTAACCAGTCCATGA
gRNAs-sams1-1 GTGAGACCTGCACCAAGACA GAGATGAGGACGGTGTGGAC
gRNAs-sams1-2 GTGAGACCTGCACCAAGACA GAGATGAGGACGGTGTGGAC

Fig. 1

Relative expression profiles of OsSAMS1 after M. oryzae infection A: transcriptome sequencing analysis of rice samples before and 12, 24, and 36 hours after M. oryzae infection showed that the relative expression level of OsSAMS1 was induced by M. oryzae infection; B: qRT-PCR analysis of the rice samples before and 12, 24, 48, and 72 hours after M. oryzae infection showed that the relative expression level of OsSAMS1 was increased and reached the highest level at 24 hours after infection compared to the control."

Fig. 2

Relative expression patterns of OsSAMS1 The relative expression levels of OsSAMS1 in roots, stems, and leaves of two-week old, four-week old and six-week old seedlings, spikelets of 0.5-1.0 cm, 1-3 cm, 3-5 cm, and 5-10 cm length, germinating and mature seeds and callus were analyzed by qRT-PCR. The error bar represents the standard deviation (SD) of the value from three independent biological samples."

Fig. 3

Determination of ossams1-1 (A) and ossams1-2 (B) knockout transgenic lines"

Fig. 4

Morphological phenotypes of ZH11, ossams1-1, and ossams1-2 The phenotypes of ZH11, ossams1-1, and ossams1-2 at filling stage were observed; bar: 10 cm."

Table 2

Comparison of the main agronomic traits between knockout lines and parents"

性状Trait ZH11 ossams1-1 ossams1-2
株高 Plant height (cm) 99.82 ± 1.86 85.94 ± 1.76** 86.12 ± 1.92**
穗长 Panicle length (cm) 23.15 ± 1.32 18.85 ± 1.41* 18.96 ± 1.31*
有效穗数 Number of effective panicle 9.20 ± 1.04 7.84 ± 1.02* 8.11 ± 1.01*
每穗颖花数 Spikelets per panicle 144.46 ± 4.26 122.26 ± 5.16* 120.16 ± 5.06*
结实率 Seed setting rate (%) 95.32 ± 1.16 96.12 ± 1.06 96.02 ± 1.32
千粒重 Thousand-grain weight (g) 26.62 ± 0.46 26.22 ± 0.52 26.82 ± 0.51
粒长 Grain length (mm) 7.92 ± 0.11 7.89 ± 0.12 7.88 ± 0.11
粒宽 Grain width (mm) 3.62 ± 0.08 3.68 ± 0.09 3.60 ± 0.06

Fig. 5

Compared with ZH11, ossams1-1 and ossams1-2 were more susceptible to M. oryzae A: the plants of ossams1-1 and ossams1-2 produced more diseased lesions compared to the ZH11 plants after inoculation with Guy11 using the spraying method; B: the analysis of the fungal biomass in the diseased leaves. *: P < 0.05, **: P < 0.01, Student’s t-test."

Fig. 6

Relative expression patterns of PR genes in ossams1-1, ossams1-2, and ZH11 A, B, C and D represent the expression changes of PR1a, PR5, PR6, and PR10 in ossams1-1, ossams1-2 and ZH11 after inoculation with Guy11. Asterisks represent significant differences relative to wild-type ZH11 plants (*: P < 0.05, **: P < 0.01, Student’s t-test)."

Fig. 7

Relative expression patterns of ethylene synthesis related genes in ossams1 mutants and the wild-type ZH11 after inoculation with M. oryzae A, B, C, and D represent the expression changes of OSACS1, OSACS2, OSACS4 and OSACS6, in ossams1 mutants and the wild-type ZH11 after inoculation with M. oryzae respectively (*: P < 0.05, **: P < 0.01, Student’s t-test)."

Fig. 8

Subcellular localization of OsSAMS1 The expression of OsSAMS1-GFP in N. benthamiana cells was observed by laser confocal microscopy. The results showed that OsSAMS1-GFP expressed in the nucleus, cytoplasm and cell membrane; bar: 20 μm."

Fig. 9

Phylogenetic analysis of OsSAMS1 in plants Blast analysis was used to search for the homologous proteins of OsSAMS1 in NCBI, RGAP, and TAIR protein database, and two homologous proteins encoded by LOC_Os01g18860 and LOC_ Os01g22010 in rice, two homologous proteins AtSAM1 and AtSAM2 in Arabidopsis, and the SAMS1 protein in maize, sorghum, panicum, and setaria were obtained. Then phylogenetic analysis was performed with MEGA7.0 software."

[1] Zhang N, Luo J, Rossman A Y, Aoki T, Chuma I, Crous P W, Dean R, de Vries R P, Donofrio N, Hyde K D, Lebrun M H, Talbot N J, Tharreau D, Tosa Y, Valent B, Wang Z H, Xu J R. Generic names in Magnaporthales. IMA Fung, 2016, 7:155-159.
[2] Li W T, Chern M S, Yin J J, Wang J, Chen X W. Recent advances in broad-spectrum resistance to the rice blast disease. Curr Opin Plant Biol, 2019, 50:114-120.
doi: 10.1016/j.pbi.2019.03.015
[3] Deng Y W, Zhai K R, Xie Z, Yang D Y, Zhu X D, Liu J Z, Wang X, Qin P, Yang Y Z, Zhang G M, Li Q, Zhang J F, Wu S Q, Milazzo J, Mao B Z, Wang E T, Xie H A, Tharreau D, He Z H. Epigenetic regulation of antagonistic receptors confers rice blast resistance with yield balance. Science, 2017, 355:962-965.
doi: 10.1126/science.aai8898
[4] Yang D W, Li S P, Lu L, Fang J B, Wang W, Cui H T, Tang D Z. Identification and application of the Pigm-1 gene in rice disease-resistance breeding. Plant Biol, 2020, 22:1022-1029.
doi: 10.1111/plb.v22.6
[5] Zhou B, Qu S H, Liu G F, Dolan M, Sakai H, Lu G D, Bellizzi M, Wang G L. The eight amino-acid differences within three leucine-rich repeats between Pi2 and Piz-t resistance proteins determine the resistance specificity to Magnaporthe grisea. Mol Plant Microbe Interact, 2006, 19:1216-1228.
doi: 10.1094/MPMI-19-1216
[6] Zhu X Y, Chen S, Yang J Y, Zhou S C, Zeng L X, Han J L, Su J, Wang, Pan Q H. The identification of Pi50(t), a new member of the rice blast resistance Pi2/Pi9 multigene family. Theor Appl Genet, 2012, 124:1295-1304.
doi: 10.1007/s00122-012-1787-9
[7] Jiang N, Li Z Q, Wu J, Wang Y, Wu L Q, Wang S H, Wang D, Wen T, Liang Y, Sun P Y, Liu J L, Dai L Y, Wang Z L, Wang C, Luo M Z, Liu X L, Wang G L. Molecular mapping of the Pi2/9 allelic gene Pi2-2 conferring broad-spectrum resistance to Magnaporthe oryzae in the rice cultivar Jefferson. Rice, 2012, 5:29.
doi: 10.1186/1939-8433-5-29 pmid: 27234247
[8] Su J, Wang W J, Han J L, Chen S, Wang C Y, Zeng L X, Feng A Q, Yang J Y, Zhou B, Zhu X Y. Functional divergence of duplicated genes results in a novel blast resistance gene Pi50 at the Pi2/9 locus. Theor Appl Genet, 2015, 128:2213-2225.
doi: 10.1007/s00122-015-2579-9
[9] Deng Y W, Zhai K R, Xie Z, Yang D Y, Zhu X D, Liu J Z, Wang X, Qin P, Yang Y Z, Zhang G M, Li Q, Zhang J F, Wu S Q, Milazzo J, Mao B Z, Wang E T, Xie H A, Tharreau D, He Z H. Epigenetic regulation of antagonistic receptors confers rice blast resistance with yield balance. Science, 2017, 355:962-965.
doi: 10.1126/science.aai8898
[10] Dodds P N, Rathjen J P. Plant immunity: towards an integrated view of plant-pathogen interactions. Nat Rev Genet, 2010, 11:539-548.
[11] Wang W, Feng B M, Zhou J M, Tang D Z. Plant immune signaling: advancing on two frontiers. J Integr Plant Biol, 2020, 62:2-24.
doi: 10.1111/jipb.v62.1
[12] 杨德卫, 李生平, 崔海涛, 邹声浩, 王伟. 寄主植物与病原菌免疫反应的分子遗传基础. 遗传, 2020, 42:278-286.
Yang D W, Li S P, Cui H T, Zou S H, Wang W. Molecular genetic mechanisms of interaction between host plants and pathogens. Hereditas(Beijing), 2020, 42:278-286 (in Chinese with English abstract).
[13] Jones J D G, Dangl J L. The plant immune system. Nature, 2006, 444:323-329.
doi: 10.1038/nature05286
[14] Yuan M, Jiang Z, Bi G, Nomura K, Liu M, Wang Y, Cai B, Zhou J M, He S Y, Xin X F. Pattern-recognition receptors are required for NLR-mediated plant immunity. Nature, 2021, 592:105-109.
[15] Ngou B P M, Ahn H K, Ding P T, Jones J D G. Mutual potentiation of plant immunity by cell-surface and intracellular receptors. Nature, 2021, 592:110-115.
[16] Li W T, Chern M S, Yin J J, Wang J, Chen X W. Recent advances in broad-spectrum resistance to the rice blast disease. Curr Opin Plant Biol, 2019, 50:114-120
doi: 10.1016/j.pbi.2019.03.015
[17] Hayafune M, Berisio R, Marchetti R, Silipo A, Kayama M, Desaki Y, Arima S, Squeglia F, Ruggiero A, Tokuyasu K, Molinaro A, Kaku H, Shibuya N. Chitin-induced activation of immune signaling by the rice receptor CEBiP relies on a unique sandwich-type dimerization. Proc Natl Acad Sci USA, 2014, 111:404-413.
[18] Yamaguchi K, Yamada K, Ishikawa K, Yoshimura S, Hayashi N, Uchihashi K, Ishihama N, Kishi-Kaboshi M, Takahashi A, Tsuge S, Ochiai H, Tada Y, Shimamoto K, Yoshioka H, Kawasaki T. A receptor-like cytoplasmic kinase targeted by a plant pathogen effector is directly phosphorylated by the chitin receptor and mediates rice immunity. Cell Host Microb, 2013, 13:347-357.
doi: 10.1016/j.chom.2013.02.007
[19] Yamada K, Yamaguchi K, Yoshimura S, Terauchi A, Kawasaki T. Conservation of chitin-induced MAPK signaling pathways in rice and Arabidopsis. Plant Cell Physiol, 2017, 58:993-1002.
doi: 10.1093/pcp/pcx042 pmid: 28371870
[20] Wang C, Wang G, Zhang C, Zhu P K, Dai H L, Yu N, He Z H, Xu L, Wang E T. OsCERK1-mediated chitin perception and immune signaling requires receptor-like cytoplasmic kinase 185 to activate an MAPK cascade in rice. Mol Plant, 2017, 10:619-633.
doi: 10.1016/j.molp.2017.01.006
[21] Pennisi E. Armed and dangerous. Science, 2010, 327:804-805.
doi: 10.1126/science.327.5967.804
[22] Mine A, Seyerth C, Kracher B, Berens M L, Becker D, Tsuda K. The defense phytohormone signaling network enables rapid, high-amplitude transcriptional reprogramming during eector- triggered immunity. Plant Cell, 2018, 30:1199-1219.
doi: 10.1105/tpc.17.00970
[23] Meng J J, Wang L S, Wang J Y, Zhao X W, Cheng J K, Yu W X, Jin D, Li Q, Gong Z Z. Methionine adenosyltransferase4 mediates DNA and histone methylation. Plant Physiol, 2018, 177:652-670.
doi: 10.1104/pp.18.00183
[24] Yan, X J, Ma L, Pang H Y, Wang P, Lei L, Cheng Y X, Cheng J K, Guo Y, Li Q Z. Methionine synthase1 is involved in chromatin silencing by maintaining dna and histone methylation. Plant Physiol, 2019, 181:249-261.
doi: 10.1104/pp.19.00528
[25] Chen Y, Xu Y Y, Luo W, Li W X, Chen N, Zhang D J, Chong K. The F-box protein OsFBK12 targets OsSAMS1 for degradation and affects pleiotropic phenotypes, including leaf senescence, in rice. Plant Physiol, 2013, 163:1673-1685.
doi: 10.1104/pp.113.224527
[26] Bustin S A, Benes V, Garson J A, Hellemans J, Huggett J, Kubista M, Mueller R, Nolan T, Pfaffl M W, Shipley G L, Vandesompe J, Wittwer C T. The MIQE guidelines: minimum information for publication of quantitative real-time PCR experiments. Clin Chem, 2009, 55:611-622.
doi: 10.1373/clinchem.2008.112797
[27] Park C H, Chen S B, Shirsekar G, Zhou B, Khang C H, Songkumarn P, Afzal A J, Ning Y S, Wang R S, Bellizzi M, Valent B, Wang G L. The Magnaporthe oryzae effector AvrPiz-t targets the RING E3 ubiquitin ligase APIP6 to suppress pathogen-associated molecular pattern-triggered immunity in rice. Plant Cell, 2012, 24:4748-4762.
doi: 10.1105/tpc.112.105429
[28] Yang D W, Cheng C P, Zheng X H, Ye X F, Ye N, Huang F H. Identification and fine mapping of a major QTL, qHD19, that plays pleiotropic roles in regulating the heading date in rice. Mol Breed, 2020, 40:30.
doi: 10.1007/s11032-020-1109-x
[29] Schwessinger B, Ronald P C. Plant innate immunity: perception of conserved microbial signatures. Annu Rev Plant Biol, 2012, 63:451-482.
doi: 10.1146/annurev-arplant-042811-105518 pmid: 22404464
[30] Yang C, Li W, Cao J D, Meng F W, Yu Y Q, Huang J K, Jiang L, Liu M X, Zhang Z G, Chen X W, Miyamoto K, Yamane H, Zhang J S, Chen S Y, Liu J. Activation of ethylene signaling pathways enhances disease resistance by regulating ROS and phytoalexin production in rice. Plant J, 2017, 89:338-353.
doi: 10.1111/tpj.13388
[31] Mao D, Feng Y, Jian L, Poel B V, Tan D, Li J L, Liu Y Q, Li X S, Dong M Q, Chen L B, Li D P, Luan S. FERONIA receptor kinase interacts with S-adenosylmethionine synthetase and suppresses S-adenosylmethionine production and ethylene biosynthesis in Arabidopsis. Plant Cell Environ, 2016, 38:2566-2574.
doi: 10.1111/pce.12570
[32] Ji D C, Cui X M, Qin G Z, Chen T, Tian S P. SlFERL interacts with S-adenosylmethionine synthetase to regulate fruit ripening. Plant Physiol, 2020, 184:2168-2181.
doi: 10.1104/pp.20.01203
[33] Li W X, Han Y Y, Tao F, Chong K. Knockdown of SAMS genes encoding S-adenosyl-L-methionine synthetases causes methylation alterations of DNAs and histones and leads to late flowering in rice. J Plant Physiol, 2011, 168:1837-1843.
doi: 10.1016/j.jplph.2011.05.020
[34] Iwai T, Miyasaka A, Seo S, Ohashi Y. Contribution of ethylene biosynthesis for resistance to blast fungus infection in young rice plants. Plant Physiol, 2006, 142:1202-1215.
doi: 10.1104/pp.106.085258
[35] Tintor N, Ross A, Kanehara K, Yamada K, Fan L, Kemmerling B, Nürnberger T, Tsuda K, Saijo Y. Layered pattern receptor signaling via ethylene and endogenous elicitor peptides during Arabidopsis immunity to bacterial infection. Proc Natl Acad Sci USA, 2013, 110:6211-6216.
doi: 10.1073/pnas.1216780110
[36] Helliwell E E, Wang Q, Yang Y N. Transgenic rice with inducible ethylene production exhibits broad-spectrum disease resistance to the fungal pathogens Magnaporthe oryzae and Rhizoctonia solani. Plant Biotechnol J, 2013, 11:33-42.
doi: 10.1111/pbi.12004 pmid: 23031077
[37] Singh M P, Lee F N, Counce P A, Gibbons J H. Mediation of partial resistance to rice blast through anaerobic induction of ethylene. Phytopathology, 2004, 94:819-825.
doi: 10.1094/PHYTO.2004.94.8.819
[38] Seo Y S, Chern M, Bartley L E, Han M, Jung K H, Lee I, Walia H, Richter T, Xu X, Cao P, Bai W, Ramanan R, Amonpant F, Arul L, Canlas P E, Ruan R, Park C J, Chen X, Hwang S, Jeon J S, Ronald P C. Towards establishment of a rice stress response interactome. PLoS Genet, 2011, 7:e1002020.
[39] Gong B, Li X VandenLangenberg K M, Wen D, Sun S S, Wei M, Li Y, Yang F J, Shi Q H, Wang X F. Overexpression of S-adenosyl-L-methionine synthetase increased tomato tolerance to alkali stress through polyamine metabolism. Plant Biotechnol J, 2014, 12:694-708.
doi: 10.1111/pbi.2014.12.issue-6
[40] Mao D D, Yu F, Li J, Van de Poel B, Tan D, Li J L, Liu Y Q, Li X S, Dong M Q, Chen L B, Li D P, Luan S. FERONIA receptor kinase interacts with S-denosylmethionine synthetase and suppresses S-denosylmethionine production and ethylene biosynthesis in Arabidopsis. Plant Cell Environ, 2015, 38:2566-2574.
doi: 10.1111/pce.12570
[41] Chen Y, Zou T, McCormick S. S-adenosylmethionine synthetase 3 is important for pollen tube growth. Plant Physiol, 2016, 172:244-253.
doi: 10.1104/pp.16.00774
[42] Shen B, Li C, Tarczynski M C. High free-methionine and decreased lignin content result from a mutation in the Arabidopsis S-adenosyl-L-methionine synthetase 3 gene. Plant J, 2002, 29:371-380.
pmid: 11844113
[43] Li W X, Han Y Y, Tao F, Chong K. Knockdown of SAMS genes encoding S-adenosyl-l-methionine synthetases causes methylation alterations of DNAs and histones and leads to late flowering in rice. J Plant Physiol, 2011, 168:1837-1843.
doi: 10.1016/j.jplph.2011.05.020
[1] Hu Zhao, Qian Run, Xie Feng-Pu, Ying Su-Ping. Genome-wide identification and expression analysis of the SPX gene family in rice under phosphorus treatment [J]. Acta Agronomica Sinica, 2026, 52(6): 1902-1912.
[2] Zou Yi-Mei, Xu Min, Wang Hai-Yang, Yao Hui, Wang Jia-Feng, Liu Hao, Ren Dai-Sheng. Analysis of transcription factor regulatory networks in two-line male sterile rice seedling roots in response to salt stress [J]. Acta Agronomica Sinica, 2026, 52(6): 1728-1742.
[3] Yan An, Jiang Kun-Wei, Wang Rong-Yuan, Tian Lin, Zhang Lu, Wang Yun, Xu Jian-Long. Identification and cloning of SVN7 controlling small vascular bundle number in the rice flag leaf [J]. Acta Agronomica Sinica, 2026, 52(5): 1364-1372.
[4] Yang Ying, Hao Yu-Wan, Zhang Xue-Ning, Fang Jia-Lu, Ma Yue-Hua, Yang Wei-Long, Sun Wen-Qing, Wang Xin-Chao, Wang Yu-Chun, Huang Jian-Yan. Molecular mechanism of CsERF9-mediated regulation of anthracnose resistance in tea plant [J]. Acta Agronomica Sinica, 2026, 52(4): 1103-1115.
[5] Chen Wei, Wei Wan-Juan, Zhao Qi-Bing, Chang Dong-Wei, Yu Ling-Bo, Zhai Peng-Fei, Feng Zhi-Ming, Chen Zong-Xiang, Ren Yang-Tao, Yang Peng, Liu Hai-Lang, Li Zhen-Fu, Yang Yong-Le, Jin Yan-Gang, Zuo Shi-Min. Developing new germplasm of high-quality and early-maturing rice by editing Hd6 via CRISPR/Cas9 [J]. Acta Agronomica Sinica, 2026, 52(4): 1046-1056.
[6] Shi Shao-Jie, Liu Kai, Chen Zi-Yi, Wang Hui-Ying, Li San-He, Zhou Lei, You Ai-Qing. Cloning and functional analysis of the dwarf and multi-tiller gene DMT1 in rice [J]. Acta Agronomica Sinica, 2026, 52(4): 1022-1034.
[7] Liu Chang-You, Wang Shen, Shi Hui-Ying, Shen Ying-Chao, Sun Lei, Wang Yan, Zhang Zhi-Xiao, Su Qiu-Zhu, Tian Jing, Fan Bao-Jie. QTL mapping for bruchid resistance in an adzuki bean distant hybridization population using rice bean genetic resources [J]. Acta Agronomica Sinica, 2026, 52(3): 936-944.
[8] Ye Fan, Li Shuai, Li Si-Yu, Chen Yun, Dou Chao-Yin, Liu Li-Jun. Effects of water-saving irrigation on rice yield and population quality in Northeast China [J]. Acta Agronomica Sinica, 2026, 52(3): 895-907.
[9] Liu Ning, Fan Ping, Wang Cheng, Chen Qi-Qi, Cheng Qing-Yue, Tie Xia-Na, Tang Jing-Sha, Liu Bin-Bin, Xie Hong-Kun, Wang Jia-Yue, Shi Yuan-Qing, Ma Jun. Effects of reduced nitrogen application combined with organic fertilizer on yield formation and nitrogen utilization in mechanically transplanted rice [J]. Acta Agronomica Sinica, 2026, 52(3): 866-880.
[10] Qin Yi-Yan, Fu Yao, Su Chang, Li Na, Xu Jing-Ru, Cheng Xiao-Ran, Zhang Qi, Zhao Ming-Hui. Functional analysis of OsST41 regulating salt tolerance in rice seedlings [J]. Acta Agronomica Sinica, 2026, 52(3): 802-812.
[11] Zhu Jin-Juan, Wang Hui-Ping, Yang Guo-Dong, Wang Yu-Cheng, Yang Chen, Wang Bin, Agustiani Nurwulan, Tu Jun-Ming, Bi Jun-Guo, Cui Ke-Hui, Huang Jian-Liang, Peng Shao-Bing, Yuan Shen. Effects of water management and variety type on grain yield and quality in ratoon rice [J]. Acta Agronomica Sinica, 2026, 52(1): 295-315.
[12] WANG Chan, WU Ying-Ying, LI Wen-Qi, LI Xia, WANG Fang-Quan, ZHOU Tong, YANG Jie. Development of functional markers of rice stripe disease resistance gene STV11 based on HRM technique [J]. Acta Agronomica Sinica, 2025, 51(9): 2547-2556.
[13] GUO Bao-Wei, WANG Wang, WANG Kai, WANG Yan, ZENG Xin, JING Xiu, WANG Jing, NI Xin-Hua, XU Ke, ZHANG Hong-Cheng. Population dynamic characteristics and formation mechanisms of super high-yielding of two types of glutinous rice in the middle and lower reaches of the Yangtze Rive [J]. Acta Agronomica Sinica, 2025, 51(9): 2433-2453.
[14] CHEN Hui-Ying, HE Jia-Xin, ZHU Bin, HUANG Shi-Xuan, ZHOU Xing-You, WU Jun-Quan, YANG Mei-Yan. Whole genome analysis and biological characterization of phage vB_XaS_ HDB2 infected with Xanthomonas oryzae pv. oryzae [J]. Acta Agronomica Sinica, 2025, 51(8): 2087-2099.
[15] YANG Hai-Yang, WU Lin-Xuan, LI Bo-Wen, SHI Han-Feng, YUAN Xi-Long, LIU Jin-Zhao, CAI Hai-Rong, CHEN Shi-Yi, GUO Tao, WANG Hui. OsWRI3, identified based on QTL mapping, regulates seed shattering in rice [J]. Acta Agronomica Sinica, 2025, 51(7): 1712-1724.
Viewed
Full text


Abstract

Cited
  Shared   
  Discussed   
No Suggested Reading articles found!
Add: No. 80 Xueyuan South Rd, Beijing 100081, P. R. China E-mail: zwxb301@caas.cn
Supported by Beijing Magtech Co.Ltd