Welcome to Acta Agronomica Sinica，

Acta Agronomica Sinica ›› 2023, Vol. 49 ›› Issue (5): 1272-1281.doi: 10.3724/SP.J.1006.2023.24070

• CROP GENETICS & BREEDING·GERMPLASM RESOURCES·MOLECULAR GENETICS • Previous Articles     Next Articles

GmCIPK10, a CBL-interacting protein kinase promotes salt tolerance in soybean

LI Hui1,2(), LU Yi-Ping1, WANG Xiao-Kai1, WANG Lu-Yao1, QIU Ting-Ting1, ZHANG Xue-Ting1, HUANG Hai-Yan1, CUI Xiao-Yu1,*()   

  1. 1College of Agriculture and Forestry Sciences, Linyi University, Linyi 276000, Shandong, China
    2Center for International Education, Philippine Christian University, 1004, the Philippines
  • Received:2022-03-29 Accepted:2022-07-21 Online:2023-05-12 Published:2022-08-18
  • Contact: *E-mail: cuixiaoyu@lyu.edu.cn
  • Supported by:
    National Natural Science Foundation of China(32001459);Natural Science Foundation of Shandong Province(ZR2020QC123)

RichHTML410

16

PDF

603

Abstract:

Salt stress seriously restricts the yield and quality of soybean. Calcineurin B subunit-interacting protein kinases (CIPKs) play a vital role in response to environmental stresses in plant. However, few study is known about the biological function of soybean CIPKs. In this study, GmCIPK10 was cloned from soybean genome. Bioinformatics analysis exhibited that GmCIPK10 encoded an intron-poor type CIPKs with a serine (Ser)/threonine (Thr) protein kinase domain and a NAF/FISL motif. The relative expression pattern levels showed that the transcript level of GmCIPK10 was increased under NaCl, MV, and H2O2 treatments. Overexpression of GmCIPK10 in Arabidopsis and soybean hairy roots improved salt tolerance of transgenic plants. Further physiological indicator assays demonstrated that GmCIPK10 overexpression could decrease the accumulation of MDA and H2O2, enhance the activity of antioxidant enzymes, and reduce sodium (Na+)/potassium (K+) in transgenic plants under salt stress. In addition, qRT-PCR illustrated that GmCIPK10 promoted the relative expression level of antioxidant- and salt tolerance-related gene in salt stress. The yeast two-hybrid, pull-down, and bimolecular fluorescence complementation experiments confirmed that GmCIPK10 interacts with the Ca2+ sensor GmCBL4. These results provide a reference for investigating the role of the CBL-CIPK signaling pathway in response to salt stress in soybean.

Key words: GmCIPK10, salt tolerance, ROS scavenging, Na+/K+ homeostasis, soybean

Table 1

Primers used in this study"

引物
Primer ID		 正向序列
Forward sequence (5'-3')		 反向序列
Reverse sequence (5'-3')
AtActin GAAATCACAGCACTTGCACC TGGAATGTGCTGAGGGAAGC
GmTubulin GAGGCAAGATGAGCACCAAG ACGGAACATTTCCTGAATGGAG
GmCIPK10 CAAGCCTGTTTTTGCATCTGAAT GATAGTGTGTTTGGATCCCAGC
GmCAT1 AGCTAGCGCAAAGGGTTTCT AAGGTTTCAGGGCTACCACG
GmPOD21 CCGTTTCGTGGGTCAGAAATCT- CCGACGCCTGCTCCGACACTA
GmZAT10 AAGCCTTCTCCTCTTACCAAGCA TCGACGCCGA ACTCGTTGT
GmMYB118 ATCATACTGTTCGGAGTCAC CAGACACTGTAGAGACCTTGTT
GmLEA5 CCGATGTATCGGTAAGAGT AGGCTTTTGA ACCATCTC
GmNHX1 GTCGGGGCACACTTCACTAA GGATGCTGCTTGGACGATGA
GmSALT3 AAGCAGGTGCTTAACGACGA CAAATCTGTTAGCCGCGACG
GmSOS1 ATCGGCTGGGAAAGATTGGG CACCAGGGCCAGCTAGTAAG

Fig. 1

Protein structure and evolutionary relationship of GmCIPK10 protein"

Fig. 2

Relative expression profiles of GmCIPK10 in salt and oxidative stresses GmTubulin is used as an internal control; each group contains three seedlings for three biological replicates. MV: methyl viologen. *: P < 0.05."

Fig. 3

Overexpression of GmCIPK10 enhances salt tolerance ability in transgenic Arabidopsis A, B: the phenotypes and primary root length of GmCIPK10-OE and WT Arabidopsis plants with salt treatment (75 mmol L-1 NaCl) for 10 days; C: the expression level of GmCIPK10 genes; D: MDA content; E: H2O2 content; Each group contained four seedlings for three biological replicates; WT: wild type; OE: overexpression. *: P < 0.05."

Fig. 4

Overexpression of GmCIPK10 enhances salt tolerance ability in transgenic soybean hairy roots A, B: the phenotype and survival rate of GmCIPK10-OE and VC soybean plants with salt treatment (200 mmol L-1 NaCl) for 10 days; C: the expression level of GmCIPK10 genes; D: MDA content; E: H2O2 content; F: CAT activity; G: POD activity; H: K+ content; I: Na+ content; J: Na+/K+ ratio of GmCIPK10-OE and VC soybean plants with salt treatment for 7 days; VC: vector control; OE: overexpression; FW: fresh weight; DW: drought weight. *: P < 0.05."

Fig. 5

Relative expression level of GmCIPK10 genes in salt and oxidative stresses Each group contained four seedlings for three biological replicates. VC: vector control; OE: overexpression. *: P < 0.05."

Fig. 6

GmCBL4 interacts with GmCIPK10 A: yeast two-hybrid analysis of GmCBL4 interaction with GmCIPK10; B: pull-down assays of the interaction of GmCBL4 with GmCIPK10; C: BiFC assays of the interaction of GmCBL4 with GmCIPK10. BiFC: bimolecular fluorescence complementation; YFP: yellow fluorescent protein. Bar: 12 μm."

[1] Tang R J, Wang C, Li K, Luan S. The CBL-CIPK calcium signaling network: unified paradigm from 20 years of discoveries. Trends Plant Sci, 2020, 25: 604-617.
doi: 10.1016/j.tplants.2020.01.009
[2] Yu Q, An L, Li W. The CBL-CIPK network mediates different signaling pathways in plants. Plant Cell Rep, 2014, 33: 203-214.
doi: 10.1007/s00299-013-1507-1 pmid: 24097244
[3] Ma X, Li Q H, Yu Y N, Qiao Y M, Haq S U, Gong Z H. The CBL-CIPK pathway in plant response to stress signals. Int J Mol Sci, 2020, 21: 5668.
doi: 10.3390/ijms21165668
[4] Luan S. The CBL-CIPK network in plant calcium signaling. Trends Plant Sci, 2009, 14: 37-42.
doi: 10.1016/j.tplants.2008.10.005 pmid: 19054707
[5] Albrecht V, Ritz O, Linder S, Harter K, Kudla J. The NAF domain defines a novel protein-protein interaction module conserved in Ca2+-regulated kinases. EMBO J, 2001, 20: 1051-1063.
doi: 10.1093/emboj/20.5.1051 pmid: 11230129
[6] Kudla J, Xu Q, Harter K, Gruissem W, Luan S. Genes for calcineurin B-like proteins in Arabidopsis are differentially regulated by stress signals. Proc Natl Acad Sci USA, 1999, 96: 4718-4723.
doi: 10.1073/pnas.96.8.4718 pmid: 10200328
[7] Kudla J, Batistic O, Hashimoto K. Calcium signals: the lead currency of plant information processing. Plant Cell, 2010, 22: 541-563.
doi: 10.1105/tpc.109.072686
[8] Quan R, Lin H, Mendoza I, Zhang Y, Cao W, Yang Y, Shang M, Chen S, Pardo J M, Guo Y. SCABP8/CBL10, a putative calcium sensor, interacts with the protein kinase SOS2 to protect Arabidopsis shoots from salt stress. Plant Cell, 2007, 19: 1415-1431.
doi: 10.1105/tpc.106.042291
[9] Pandey G K, Kanwar P, Singh A, Steinhorst L, Pandey A, Yadav A K, Tokas I, Sanyal S K, Kim B G, Lee S C, Cheong Y H, Kudla J, Luan S. Calcineurin B-like protein-interacting protein kinase CIPK21 regulates osmotic and salt stress responses in Arabidopsis. Plant Physiol, 2015, 169: 780-792.
doi: 10.1104/pp.15.00623
[10] Cheong Y H, Pandey G K, Grant J J, Batistic O, Li L, Kim B G, Lee S C, Kudla J, Luan S. Two calcineurin B-like calcium sensors, interacting with protein kinase CIPK23, regulate leaf transpiration and root potassium uptake in Arabidopsis. Plant J, 2007, 52: 223-239.
doi: 10.1111/j.1365-313X.2007.03236.x pmid: 17922773
[11] D’Angelo C, Weinl S, Batistic O, Pandey G K, Cheong Y H, Schültke S, Albrecht V, Ehlert B, Schulz B, Harter K, Luan S, Bock R, Kudla J. Alternative complex formation of the Ca2+- regulated protein kinase CIPK1 controls abscisic acid dependent and independent stress responses in Arabidopsis. Plant J, 2006, 48: 857-872.
doi: 10.1111/tpj.2006.48.issue-6
[12] Yin X, Xia Y, Xie Q, Cao Y, Wang Z, Hao G, Song J, Zhou Y, Jiang X. The protein kinase complex CBL10-CIPK8-SOS1 functions in Arabidopsis to regulate salt tolerance. J Exp Bot, 2020, 71: 1801-1814.
doi: 10.1093/jxb/erz549
[13] Yasuda S, Aoyama S, Hasegawa Y, Sato T, Yamaguchi J. Arabidopsis CBL-interacting protein kinases regulate carbon/nitrogen- nutrient response by phosphorylating ubiquitin ligase ATL31 . Mol Plant, 2017, 10: 605-618.
doi: 10.1016/j.molp.2017.01.005
[14] Xiang Y, Huang Y, Xiong L. Characterization of stress-responsive CIPK genes in rice for stress tolerance improvement. Plant Physiol, 2007, 144: 1416-1428.
doi: 10.1104/pp.107.101295 pmid: 17535819
[15] M , X , Gai W X, Li Y, Yu Y N, Ali M, Gong Z H. The CBL-interacting protein kinase CaCIPK13 positively regulates defense mechanisms against cold stress in pepper. J Exp Bot, 2022, 73: 1655-1667.
doi: 10.1093/jxb/erab505
[16] Lu L, Chen X, Zhu L, Li M, Zhang J, Yang X, Wang P, Lu Y, Cheng T, Shi J, Yi Y, Chen J. NtCIPK9: a calcineurin B-like protein-interacting protein kinase from the halophyte Nitraria tangutorum, enhances Arabidopsis salt tolerance. Front Plant Sci, 2020, 11: 1112.
doi: 10.3389/fpls.2020.01112 pmid: 32973820
[17] Chen L, Ren F, Zhou L, Wang Q Q, Zhong H, Li X B. The Brassica napus calcineurin B-like 1/CBL-interacting protein kinase 6 (CBL1/CIPK6) component is involved in the plant response to abiotic stress and ABA signaling. J Exp Bot, 2012, 63: 6211-6222.
doi: 10.1093/jxb/ers273
[18] Cui X Y, Du Y T, Fu J D, Yu T F, Wang C T, Chen M, Chen J, Ma Y Z, Xu Z S. Wheat CBL-interacting protein kinase 23 positively regulates drought stress and ABA responses. BMC Plant Biol, 2018, 18: 93.
doi: 10.1186/s12870-018-1306-5
[19] Ma X, Li Y, Gai W X, Li C, Gong Z H. The CaCIPK3 gene positively regulates drought tolerance in pepper. Hortic Res, 2021, 8: 216.
doi: 10.1038/s41438-021-00651-7
[20] Lu L, Chen X, Wang P, Lu Y, Zhang J, Yang X, Cheng T, Shi J, Chen J. CIPK11: a calcineurin B-like protein-interacting protein kinase from Nitraria tangutorum, confers tolerance to salt and drought in Arabidopsis. BMC Plant Biol, 2021, 21: 123.
doi: 10.1186/s12870-021-02878-x pmid: 33648456
[21] Li R, Zhang J, Wu G, Wang H, Chen Y, Wei J. HbCIPK2, a novel CBL-interacting protein kinase from halophyte Hordeum brevisubulatum, confers salt and osmotic stress tolerance. Plant Cell Environ, 2012, 35: 1582-1600.
doi: 10.1111/pce.2012.35.issue-9
[22] Wang Y, Li T, John S J, Chen M, Chang J, Yang G, He G. A CBL-interacting protein kinase TaCIPK27 confers drought tolerance and exogenous ABA sensitivity in transgenic Arabidopsis. Plant Physiol Biochem, 2018, 123: 103-113.
doi: 10.1016/j.plaphy.2017.11.019
[23] Xu M, Li H, Liu Z N, Wang X H, Xu P, Dai S J, Cao X, Cui X Y. The soybean CBL-interacting protein kinase, GmCIPK2, positively regulates drought tolerance and ABA signaling. Plant Physiol Biochem, 2021, 167: 980-989.
doi: 10.1016/j.plaphy.2021.09.026
[24] Wang F, Chen H W, Li Q T, Wei W, Li W, Zhang W K, Ma B, Bi Y D, Lai Y C, Liu X L, Man W Q, Zhang J S, Chen S Y. GmWRKY27 interacts with GmMYB174 to reduce expression of GmNAC29 for stress tolerance in soybean plants. Plant J, 2015, 83: 224-236.
doi: 10.1111/tpj.12879
[25] Yu T F, Liu Y, Fu J D, Ma J, Fang Z W, Chen J, Zheng L, Lu Z W, Zhou Y B, Chen M, Xu Z S, Ma Y Z. The NF-Y-PYR module integrates the abscisic acid signal pathway to regulate plant stress tolerance. Plant Biotechnol J, 2021, 19: 2589-2605.
doi: 10.1111/pbi.v19.12
[26] Deng X, Hu W, Wei S, Zhou S, Zhang F, Han J, Chen L, Li Y, Feng J, Fang B, Luo Q, Li S, Liu Y, Yang G, He G. TaCIPK29, a CBL-interacting protein kinase gene from wheat, confers salt stress tolerance in transgenic tobacco. PLoS One, 2013, 8: e69881.
doi: 10.1371/journal.pone.0069881
[27] Sun T, Wang Y, Wang M, Li T, Zhou Y, Wang X, Wei S, He G, Yang G. Identification and comprehensive analyses of the CBL and CIPK gene families in wheat (Triticum aestivum L). BMC Plant Biol, 2015, 15: 269.
doi: 10.1186/s12870-015-0657-4
[28] Zhu K, Chen F, Liu J, Chen X, He T, Cheng Z M. Evolution of an intron-poor cluster of the CIPK gene family and expression in response to drought stress in soybean. Sci Rep, 2016, 6: 28225.
doi: 10.1038/srep28225 pmid: 27311690
[29] Luo Q, Wei Q, Wang R, Zhang Y, Zhang F, He Y, Zhou S, Feng J, Yang G, He G. BdCIPK31, a calcineurin B-like protein- interacting protein kinase, regulates plant response to drought and salt stress. Front Plant Sci, 2017, 8: 1184.
doi: 10.3389/fpls.2017.01184
[30] Chen X, Huang Q, Zhang F, Wang B, Wang J, Zheng J. ZmCIPK21, a maize CBL-interacting kinase, enhances salt stress tolerance in Arabidopsis thaliana. Int J Mol Sci, 2014, 15: 14819-14834.
doi: 10.3390/ijms150814819
[31] Su Y, Guo A, Huang Y, Wang Y, Hua J. GhCIPK6a increases salt tolerance in transgenic upland cotton by involving in ROS scavenging and MAPK signaling pathways. BMC Plant Biol, 2020, 20: 421.
doi: 10.1186/s12870-020-02548-4 pmid: 32928106
[32] Li M, Chen R, Jiang Q, Sun X, Zhang H, Hu Z. GmNAC06, a NAC domain transcription factor enhances salt stress tolerance in soybean. Plant Mol Biol, 2021, 105: 333-345.
doi: 10.1007/s11103-020-01091-y pmid: 33155154
[33] Chen Y, Han Y, Kong X, Kang H, Ren Y, Wang W. Ectopic expression of wheat expansin gene TaEXPA2 improved the salt tolerance of transgenic tobacco by regulating Na+/K+ and antioxidant competence. Physiol Plant, 2017, 159: 161-177.
doi: 10.1111/ppl.2017.159.issue-2
[34] Yang L, Han Y, Wu D, Yong W, Liu M, Wang S, Liu W, Lu M, Wei Y, Sun J. Salt and cadmium stress tolerance caused by overexpression of the Glycine max Na+/H+ antiporter (GmNHX1) gene in duckweed (Lemna turionifera 5511). Aquat Toxicol, 2017, 192, 127-135.
[35] Qu Y, Guan R, Bose J, Henderson S W, Wege S, Qiu L, Gilliham M. Soybean CHX-type ion transport protein GmSALT3 confers leaf Na+ exclusion via a root derived mechanism, and Cl- exclusion via a shoot derived process. Plant Cell Environ, 2021, 44: 856-869.
doi: 10.1111/pce.v44.3
[36] Deng J, Yang X, Sun W, Miao Y, He L, Zhang X. The calcium sensor CBL2 and its interacting kinase CIPK6 are involved in plant sugar homeostasis via interacting with tonoplast sugar transporter TST2. Plant Physiol, 2020, 183: 236-249.
doi: 10.1104/pp.19.01368
[1] LIU Ting-Xuan, GU Yong-Zhe, ZHANG Zhi-Hao, WANG Jun, SUN Jun-Ming, QIU Li-Juan. Mapping soybean protein QTLs based on high-density genetic map [J]. Acta Agronomica Sinica, 2023, 49(6): 1532-1541.
[2] SHU Ze-Bing, LUO Wan-Yu, PU Tian, CHEN Guo-Peng, LIANG Bing, YANG Wen-Yu, WANG Xiao-Chun. Optimization of field configuration technology of strip intercropping of fresh corn and fresh soybean based on high yield and high efficiency [J]. Acta Agronomica Sinica, 2023, 49(4): 1140-1150.
[3] WU Zong-Sheng, XU Cai-Long, LI Rui-Dong, XU Yi-Fan, SUN Shi, HAN Tian-Fu, SONG Wen-Wen, WU Cun-Xiang. Effects of wheat straw mulching on physical properties of topsoil and yield formation in soybean [J]. Acta Agronomica Sinica, 2023, 49(4): 1052-1064.
[4] LIU Shan-Shan, PANG Ting, YUAN Xiao-Ting, LUO Kai, CHEN Ping, FU Zhi-Dan, WANG Xiao-Chun, YANG Feng, YONG Tai-Wen, YANG Wen-Yu. Effects of row spacing on root nodule growth and nitrogen fixation potential of different nodulation characteristics soybeans in intercropping [J]. Acta Agronomica Sinica, 2023, 49(3): 833-844.
[5] YANG Shuo, WU Yang-Chun, LIU Xin-Lei, TANG Xiao-Fei, XUE Yong-Guo, CAO Dan, WANG Wan, LIU Ting-Xuan, QI Hang, LUAN Xiao-Yan, QIU Li-Juan. Fine mapping of qPRO-20-1 related to high protein content in soybean [J]. Acta Agronomica Sinica, 2023, 49(2): 310-320.
[6] WANG Hui, WU Zhi-Yi, ZHANG Yu-E, YU De-Yue. Transcriptional expression profiling of soybean genes under sulfur-starved conditions by RNA-seq [J]. Acta Agronomica Sinica, 2023, 49(1): 105-118.
[7] LIANG Zheng, KE Mei-Yu, CHEN Zhi-Wei, CHEN Xu, GAO Zhen. Function of GmPIN2 family gene in regulating root development in soybean [J]. Acta Agronomica Sinica, 2023, 49(1): 24-35.
[8] BAI Zhi-Yuan, CHEN Xiang-Yang, ZHENG A-Xiang, ZHANG Li, ZOU Jun, ZHANG Da-Tong, CHEN Fu, YIN Xiao-Gang. Spatial-temporal variations for agronomic and quality characters of soybeans varieties (strains) tested in America from 1991 to 2019 [J]. Acta Agronomica Sinica, 2023, 49(1): 177-187.
[9] QI Yang-Yang, DOU Ru-Na, ZHAO Cai-Tong, ZHANG Zhi, LI Wen-Bin, JIANG Zhen-Feng. Analysis of key genes involved in GA pathway responding to temperature and exogenous GA related to internode development in soybean [J]. Acta Agronomica Sinica, 2023, 49(1): 62-72.
[10] LIU Cheng, ZHANG Ya-Xuan, CHEN Xian-Lian, HAN Wei, XING Guang-Nan, HE Jian-Bo, ZHANG Jiao-Ping, ZHANG Feng-Kai, SUN Lei, LI Ning, WANG Wu-Bin, GAI Jun-Yi. Wild segments associated with 100-seed weight and their candidate genes in a wild chromosome segment substitution line population [J]. Acta Agronomica Sinica, 2022, 48(8): 1884-1893.
[11] HUAI Yuan-Yuan, ZHANG Sheng-Rui, WU Ting-Ting, AZAM Muhammad, LI Jing, SUN Shi, HAN Tian-Fu, LI Bin, SUN Jun-Ming. Potential evaluation of molecular markers related to major nutritional quality traits in soybean breeding [J]. Acta Agronomica Sinica, 2022, 48(8): 1957-1976.
[12] XIA Xiu-Zhong, ZHANG Zong-Qiong, YANG Xing-Hai, ZHUANG Jie, ZENG Yu, DENG Guo-Fu, SONG Guo-Xian, HUANG Yu-Xiao, NONG Bao-Xuang, LI Dan-Ting. Genome wide association study of salt tolerance at the germination stage for core Germplasm of rice landrace in Guangxi, China [J]. Acta Agronomica Sinica, 2022, 48(8): 2007-2015.
[13] KE Dan-Xia, HUO Ya-Ya, LIU Yi, LI Jin-Ying, LIU Xiao-Xue. Functional analysis of GmTGA26 gene under salt stress in soybean [J]. Acta Agronomica Sinica, 2022, 48(7): 1697-1708.
[14] YANG Huan, ZHOU Ying, CHEN Ping, DU Qing, ZHENG Ben-Chuan, PU Tian, WEN Jing, YANG Wen-Yu, YONG Tai-Wen. Effects of nutrient uptake and utilization on yield of maize-legume strip intercropping system [J]. Acta Agronomica Sinica, 2022, 48(6): 1476-1487.
[15] CHEN Ling-Ling, LI Zhan, LIU Ting-Xuan, GU Yong-Zhe, SONG Jian, WANG Jun, QIU Li-Juan. Genome wide association analysis of petiole angle based on 783 soybean resources (Glycine max L.) [J]. Acta Agronomica Sinica, 2022, 48(6): 1333-1345.
Viewed
Full text


Abstract

Cited
  Shared   
  Discussed   
[1] Li Shaoqing, Li Yangsheng, Wu Fushun, Liao Jianglin, Li Damo. Optimum Fertilization and Its Corresponding Mechanism under Complete Submergence at Booting Stage in Rice[J]. Acta Agronomica Sinica, 2002, 28(01): 115 -120 .
[2] Wang Lanzhen;Mi Guohua;Chen Fanjun;Zhang Fusuo. Response to Phosphorus Deficiency of Two Winter Wheat Cultivars with Different Yield Components[J]. Acta Agron Sin, 2003, 29(06): 867 -870 .
[3] YANG Jian-Chang;ZHANG Jian-Hua;WANG Zhi-Qin;ZH0U Qing-Sen. Changes in Contents of Polyamines in the Flag Leaf and Their Relationship with Drought-resistance of Rice Cultivars under Water Deficiency Stress[J]. Acta Agron Sin, 2004, 30(11): 1069 -1075 .
[4] Yan Mei;Yang Guangsheng;Fu Tingdong;Yan Hongyan. Studies on the Ecotypical Male Sterile-fertile Line of Brassica napus L.Ⅲ. Sensitivity to Temperature of 8-8112AB and Its Inheritance[J]. Acta Agron Sin, 2003, 29(03): 330 -335 .
[5] Wang Yongsheng;Wang Jing;Duan Jingya;Wang Jinfa;Liu Liangshi. Isolation and Genetic Research of a Dwarf Tiilering Mutant Rice[J]. Acta Agron Sin, 2002, 28(02): 235 -239 .
[6] WANG Li-Yan;ZHAO Ke-Fu. Some Physiological Response of Zea mays under Salt-stress[J]. Acta Agron Sin, 2005, 31(02): 264 -268 .
[7] TIAN Meng-Liang;HUNAG Yu-Bi;TAN Gong-Xie;LIU Yong-Jian;RONG Ting-Zhao. Sequence Polymorphism of waxy Genes in Landraces of Waxy Maize from Southwest China[J]. Acta Agron Sin, 2008, 34(05): 729 -736 .
[8] HU Xi-Yuan;LI Jian-Ping;SONG Xi-Fang. Efficiency of Spatial Statistical Analysis in Superior Genotype Selection of Plant Breeding[J]. Acta Agron Sin, 2008, 34(03): 412 -417 .
[9] WANG Yan;QIU Li-Ming;XIE Wen-Juan;HUANG Wei;YE Feng;ZHANG Fu-Chun;MA Ji. Cold Tolerance of Transgenic Tobacco Carrying Gene Encoding Insect Antifreeze Protein[J]. Acta Agron Sin, 2008, 34(03): 397 -402 .
[10] ZHENG Xi;WU Jian-Guo;LOU Xiang-Yang;XU Hai-Ming;SHI Chun-Hai. Mapping and Analysis of QTLs on Maternal and Endosperm Genomes for Histidine and Arginine in Rice (Oryza sativa L.) across Environments[J]. Acta Agron Sin, 2008, 34(03): 369 -375 .
Add: No. 80 Xueyuan South Rd, Beijing 100081, P. R. China E-mail: zwxb301@caas.cn
Supported by Beijing Magtech Co.Ltd