Welcome to Acta Agronomica Sinica，

Acta Agronomica Sinica ›› 2023, Vol. 49 ›› Issue (5): 1272-1281.doi: 10.3724/SP.J.1006.2023.24070

• CROP GENETICS & BREEDING·GERMPLASM RESOURCES·MOLECULAR GENETICS • Previous Articles     Next Articles

GmCIPK10, a CBL-interacting protein kinase promotes salt tolerance in soybean

LI Hui1,2(), LU Yi-Ping1, WANG Xiao-Kai1, WANG Lu-Yao1, QIU Ting-Ting1, ZHANG Xue-Ting1, HUANG Hai-Yan1, CUI Xiao-Yu1,*()   

  1. 1College of Agriculture and Forestry Sciences, Linyi University, Linyi 276000, Shandong, China
    2Center for International Education, Philippine Christian University, 1004, the Philippines
  • Received:2022-03-29 Accepted:2022-07-21 Online:2023-05-12 Published:2022-08-18
  • Contact: *E-mail: cuixiaoyu@lyu.edu.cn
  • Supported by:
    National Natural Science Foundation of China(32001459);Natural Science Foundation of Shandong Province(ZR2020QC123)

RichHTML410

30

PDF

2794

Abstract:

Salt stress seriously restricts the yield and quality of soybean. Calcineurin B subunit-interacting protein kinases (CIPKs) play a vital role in response to environmental stresses in plant. However, few study is known about the biological function of soybean CIPKs. In this study, GmCIPK10 was cloned from soybean genome. Bioinformatics analysis exhibited that GmCIPK10 encoded an intron-poor type CIPKs with a serine (Ser)/threonine (Thr) protein kinase domain and a NAF/FISL motif. The relative expression pattern levels showed that the transcript level of GmCIPK10 was increased under NaCl, MV, and H2O2 treatments. Overexpression of GmCIPK10 in Arabidopsis and soybean hairy roots improved salt tolerance of transgenic plants. Further physiological indicator assays demonstrated that GmCIPK10 overexpression could decrease the accumulation of MDA and H2O2, enhance the activity of antioxidant enzymes, and reduce sodium (Na+)/potassium (K+) in transgenic plants under salt stress. In addition, qRT-PCR illustrated that GmCIPK10 promoted the relative expression level of antioxidant- and salt tolerance-related gene in salt stress. The yeast two-hybrid, pull-down, and bimolecular fluorescence complementation experiments confirmed that GmCIPK10 interacts with the Ca2+ sensor GmCBL4. These results provide a reference for investigating the role of the CBL-CIPK signaling pathway in response to salt stress in soybean.

Key words: GmCIPK10, salt tolerance, ROS scavenging, Na+/K+ homeostasis, soybean

Table 1

Primers used in this study"

引物
Primer ID		 正向序列
Forward sequence (5'-3')		 反向序列
Reverse sequence (5'-3')
AtActin GAAATCACAGCACTTGCACC TGGAATGTGCTGAGGGAAGC
GmTubulin GAGGCAAGATGAGCACCAAG ACGGAACATTTCCTGAATGGAG
GmCIPK10 CAAGCCTGTTTTTGCATCTGAAT GATAGTGTGTTTGGATCCCAGC
GmCAT1 AGCTAGCGCAAAGGGTTTCT AAGGTTTCAGGGCTACCACG
GmPOD21 CCGTTTCGTGGGTCAGAAATCT- CCGACGCCTGCTCCGACACTA
GmZAT10 AAGCCTTCTCCTCTTACCAAGCA TCGACGCCGA ACTCGTTGT
GmMYB118 ATCATACTGTTCGGAGTCAC CAGACACTGTAGAGACCTTGTT
GmLEA5 CCGATGTATCGGTAAGAGT AGGCTTTTGA ACCATCTC
GmNHX1 GTCGGGGCACACTTCACTAA GGATGCTGCTTGGACGATGA
GmSALT3 AAGCAGGTGCTTAACGACGA CAAATCTGTTAGCCGCGACG
GmSOS1 ATCGGCTGGGAAAGATTGGG CACCAGGGCCAGCTAGTAAG

Fig. 1

Protein structure and evolutionary relationship of GmCIPK10 protein"

Fig. 2

Relative expression profiles of GmCIPK10 in salt and oxidative stresses GmTubulin is used as an internal control; each group contains three seedlings for three biological replicates. MV: methyl viologen. *: P < 0.05."

Fig. 3

Overexpression of GmCIPK10 enhances salt tolerance ability in transgenic Arabidopsis A, B: the phenotypes and primary root length of GmCIPK10-OE and WT Arabidopsis plants with salt treatment (75 mmol L-1 NaCl) for 10 days; C: the expression level of GmCIPK10 genes; D: MDA content; E: H2O2 content; Each group contained four seedlings for three biological replicates; WT: wild type; OE: overexpression. *: P < 0.05."

Fig. 4

Overexpression of GmCIPK10 enhances salt tolerance ability in transgenic soybean hairy roots A, B: the phenotype and survival rate of GmCIPK10-OE and VC soybean plants with salt treatment (200 mmol L-1 NaCl) for 10 days; C: the expression level of GmCIPK10 genes; D: MDA content; E: H2O2 content; F: CAT activity; G: POD activity; H: K+ content; I: Na+ content; J: Na+/K+ ratio of GmCIPK10-OE and VC soybean plants with salt treatment for 7 days; VC: vector control; OE: overexpression; FW: fresh weight; DW: drought weight. *: P < 0.05."

Fig. 5

Relative expression level of GmCIPK10 genes in salt and oxidative stresses Each group contained four seedlings for three biological replicates. VC: vector control; OE: overexpression. *: P < 0.05."

Fig. 6

GmCBL4 interacts with GmCIPK10 A: yeast two-hybrid analysis of GmCBL4 interaction with GmCIPK10; B: pull-down assays of the interaction of GmCBL4 with GmCIPK10; C: BiFC assays of the interaction of GmCBL4 with GmCIPK10. BiFC: bimolecular fluorescence complementation; YFP: yellow fluorescent protein. Bar: 12 μm."

[1] Tang R J, Wang C, Li K, Luan S. The CBL-CIPK calcium signaling network: unified paradigm from 20 years of discoveries. Trends Plant Sci, 2020, 25: 604-617.
doi: 10.1016/j.tplants.2020.01.009
[2] Yu Q, An L, Li W. The CBL-CIPK network mediates different signaling pathways in plants. Plant Cell Rep, 2014, 33: 203-214.
doi: 10.1007/s00299-013-1507-1 pmid: 24097244
[3] Ma X, Li Q H, Yu Y N, Qiao Y M, Haq S U, Gong Z H. The CBL-CIPK pathway in plant response to stress signals. Int J Mol Sci, 2020, 21: 5668.
doi: 10.3390/ijms21165668
[4] Luan S. The CBL-CIPK network in plant calcium signaling. Trends Plant Sci, 2009, 14: 37-42.
doi: 10.1016/j.tplants.2008.10.005 pmid: 19054707
[5] Albrecht V, Ritz O, Linder S, Harter K, Kudla J. The NAF domain defines a novel protein-protein interaction module conserved in Ca2+-regulated kinases. EMBO J, 2001, 20: 1051-1063.
doi: 10.1093/emboj/20.5.1051 pmid: 11230129
[6] Kudla J, Xu Q, Harter K, Gruissem W, Luan S. Genes for calcineurin B-like proteins in Arabidopsis are differentially regulated by stress signals. Proc Natl Acad Sci USA, 1999, 96: 4718-4723.
doi: 10.1073/pnas.96.8.4718 pmid: 10200328
[7] Kudla J, Batistic O, Hashimoto K. Calcium signals: the lead currency of plant information processing. Plant Cell, 2010, 22: 541-563.
doi: 10.1105/tpc.109.072686
[8] Quan R, Lin H, Mendoza I, Zhang Y, Cao W, Yang Y, Shang M, Chen S, Pardo J M, Guo Y. SCABP8/CBL10, a putative calcium sensor, interacts with the protein kinase SOS2 to protect Arabidopsis shoots from salt stress. Plant Cell, 2007, 19: 1415-1431.
doi: 10.1105/tpc.106.042291
[9] Pandey G K, Kanwar P, Singh A, Steinhorst L, Pandey A, Yadav A K, Tokas I, Sanyal S K, Kim B G, Lee S C, Cheong Y H, Kudla J, Luan S. Calcineurin B-like protein-interacting protein kinase CIPK21 regulates osmotic and salt stress responses in Arabidopsis. Plant Physiol, 2015, 169: 780-792.
doi: 10.1104/pp.15.00623
[10] Cheong Y H, Pandey G K, Grant J J, Batistic O, Li L, Kim B G, Lee S C, Kudla J, Luan S. Two calcineurin B-like calcium sensors, interacting with protein kinase CIPK23, regulate leaf transpiration and root potassium uptake in Arabidopsis. Plant J, 2007, 52: 223-239.
doi: 10.1111/j.1365-313X.2007.03236.x pmid: 17922773
[11] D’Angelo C, Weinl S, Batistic O, Pandey G K, Cheong Y H, Schültke S, Albrecht V, Ehlert B, Schulz B, Harter K, Luan S, Bock R, Kudla J. Alternative complex formation of the Ca2+- regulated protein kinase CIPK1 controls abscisic acid dependent and independent stress responses in Arabidopsis. Plant J, 2006, 48: 857-872.
doi: 10.1111/tpj.2006.48.issue-6
[12] Yin X, Xia Y, Xie Q, Cao Y, Wang Z, Hao G, Song J, Zhou Y, Jiang X. The protein kinase complex CBL10-CIPK8-SOS1 functions in Arabidopsis to regulate salt tolerance. J Exp Bot, 2020, 71: 1801-1814.
doi: 10.1093/jxb/erz549
[13] Yasuda S, Aoyama S, Hasegawa Y, Sato T, Yamaguchi J. Arabidopsis CBL-interacting protein kinases regulate carbon/nitrogen- nutrient response by phosphorylating ubiquitin ligase ATL31 . Mol Plant, 2017, 10: 605-618.
doi: 10.1016/j.molp.2017.01.005
[14] Xiang Y, Huang Y, Xiong L. Characterization of stress-responsive CIPK genes in rice for stress tolerance improvement. Plant Physiol, 2007, 144: 1416-1428.
doi: 10.1104/pp.107.101295 pmid: 17535819
[15] M , X , Gai W X, Li Y, Yu Y N, Ali M, Gong Z H. The CBL-interacting protein kinase CaCIPK13 positively regulates defense mechanisms against cold stress in pepper. J Exp Bot, 2022, 73: 1655-1667.
doi: 10.1093/jxb/erab505
[16] Lu L, Chen X, Zhu L, Li M, Zhang J, Yang X, Wang P, Lu Y, Cheng T, Shi J, Yi Y, Chen J. NtCIPK9: a calcineurin B-like protein-interacting protein kinase from the halophyte Nitraria tangutorum, enhances Arabidopsis salt tolerance. Front Plant Sci, 2020, 11: 1112.
doi: 10.3389/fpls.2020.01112 pmid: 32973820
[17] Chen L, Ren F, Zhou L, Wang Q Q, Zhong H, Li X B. The Brassica napus calcineurin B-like 1/CBL-interacting protein kinase 6 (CBL1/CIPK6) component is involved in the plant response to abiotic stress and ABA signaling. J Exp Bot, 2012, 63: 6211-6222.
doi: 10.1093/jxb/ers273
[18] Cui X Y, Du Y T, Fu J D, Yu T F, Wang C T, Chen M, Chen J, Ma Y Z, Xu Z S. Wheat CBL-interacting protein kinase 23 positively regulates drought stress and ABA responses. BMC Plant Biol, 2018, 18: 93.
doi: 10.1186/s12870-018-1306-5
[19] Ma X, Li Y, Gai W X, Li C, Gong Z H. The CaCIPK3 gene positively regulates drought tolerance in pepper. Hortic Res, 2021, 8: 216.
doi: 10.1038/s41438-021-00651-7
[20] Lu L, Chen X, Wang P, Lu Y, Zhang J, Yang X, Cheng T, Shi J, Chen J. CIPK11: a calcineurin B-like protein-interacting protein kinase from Nitraria tangutorum, confers tolerance to salt and drought in Arabidopsis. BMC Plant Biol, 2021, 21: 123.
doi: 10.1186/s12870-021-02878-x pmid: 33648456
[21] Li R, Zhang J, Wu G, Wang H, Chen Y, Wei J. HbCIPK2, a novel CBL-interacting protein kinase from halophyte Hordeum brevisubulatum, confers salt and osmotic stress tolerance. Plant Cell Environ, 2012, 35: 1582-1600.
doi: 10.1111/pce.2012.35.issue-9
[22] Wang Y, Li T, John S J, Chen M, Chang J, Yang G, He G. A CBL-interacting protein kinase TaCIPK27 confers drought tolerance and exogenous ABA sensitivity in transgenic Arabidopsis. Plant Physiol Biochem, 2018, 123: 103-113.
doi: 10.1016/j.plaphy.2017.11.019
[23] Xu M, Li H, Liu Z N, Wang X H, Xu P, Dai S J, Cao X, Cui X Y. The soybean CBL-interacting protein kinase, GmCIPK2, positively regulates drought tolerance and ABA signaling. Plant Physiol Biochem, 2021, 167: 980-989.
doi: 10.1016/j.plaphy.2021.09.026
[24] Wang F, Chen H W, Li Q T, Wei W, Li W, Zhang W K, Ma B, Bi Y D, Lai Y C, Liu X L, Man W Q, Zhang J S, Chen S Y. GmWRKY27 interacts with GmMYB174 to reduce expression of GmNAC29 for stress tolerance in soybean plants. Plant J, 2015, 83: 224-236.
doi: 10.1111/tpj.12879
[25] Yu T F, Liu Y, Fu J D, Ma J, Fang Z W, Chen J, Zheng L, Lu Z W, Zhou Y B, Chen M, Xu Z S, Ma Y Z. The NF-Y-PYR module integrates the abscisic acid signal pathway to regulate plant stress tolerance. Plant Biotechnol J, 2021, 19: 2589-2605.
doi: 10.1111/pbi.v19.12
[26] Deng X, Hu W, Wei S, Zhou S, Zhang F, Han J, Chen L, Li Y, Feng J, Fang B, Luo Q, Li S, Liu Y, Yang G, He G. TaCIPK29, a CBL-interacting protein kinase gene from wheat, confers salt stress tolerance in transgenic tobacco. PLoS One, 2013, 8: e69881.
doi: 10.1371/journal.pone.0069881
[27] Sun T, Wang Y, Wang M, Li T, Zhou Y, Wang X, Wei S, He G, Yang G. Identification and comprehensive analyses of the CBL and CIPK gene families in wheat (Triticum aestivum L). BMC Plant Biol, 2015, 15: 269.
doi: 10.1186/s12870-015-0657-4
[28] Zhu K, Chen F, Liu J, Chen X, He T, Cheng Z M. Evolution of an intron-poor cluster of the CIPK gene family and expression in response to drought stress in soybean. Sci Rep, 2016, 6: 28225.
doi: 10.1038/srep28225 pmid: 27311690
[29] Luo Q, Wei Q, Wang R, Zhang Y, Zhang F, He Y, Zhou S, Feng J, Yang G, He G. BdCIPK31, a calcineurin B-like protein- interacting protein kinase, regulates plant response to drought and salt stress. Front Plant Sci, 2017, 8: 1184.
doi: 10.3389/fpls.2017.01184
[30] Chen X, Huang Q, Zhang F, Wang B, Wang J, Zheng J. ZmCIPK21, a maize CBL-interacting kinase, enhances salt stress tolerance in Arabidopsis thaliana. Int J Mol Sci, 2014, 15: 14819-14834.
doi: 10.3390/ijms150814819
[31] Su Y, Guo A, Huang Y, Wang Y, Hua J. GhCIPK6a increases salt tolerance in transgenic upland cotton by involving in ROS scavenging and MAPK signaling pathways. BMC Plant Biol, 2020, 20: 421.
doi: 10.1186/s12870-020-02548-4 pmid: 32928106
[32] Li M, Chen R, Jiang Q, Sun X, Zhang H, Hu Z. GmNAC06, a NAC domain transcription factor enhances salt stress tolerance in soybean. Plant Mol Biol, 2021, 105: 333-345.
doi: 10.1007/s11103-020-01091-y pmid: 33155154
[33] Chen Y, Han Y, Kong X, Kang H, Ren Y, Wang W. Ectopic expression of wheat expansin gene TaEXPA2 improved the salt tolerance of transgenic tobacco by regulating Na+/K+ and antioxidant competence. Physiol Plant, 2017, 159: 161-177.
doi: 10.1111/ppl.2017.159.issue-2
[34] Yang L, Han Y, Wu D, Yong W, Liu M, Wang S, Liu W, Lu M, Wei Y, Sun J. Salt and cadmium stress tolerance caused by overexpression of the Glycine max Na+/H+ antiporter (GmNHX1) gene in duckweed (Lemna turionifera 5511). Aquat Toxicol, 2017, 192, 127-135.
[35] Qu Y, Guan R, Bose J, Henderson S W, Wege S, Qiu L, Gilliham M. Soybean CHX-type ion transport protein GmSALT3 confers leaf Na+ exclusion via a root derived mechanism, and Cl- exclusion via a shoot derived process. Plant Cell Environ, 2021, 44: 856-869.
doi: 10.1111/pce.v44.3
[36] Deng J, Yang X, Sun W, Miao Y, He L, Zhang X. The calcium sensor CBL2 and its interacting kinase CIPK6 are involved in plant sugar homeostasis via interacting with tonoplast sugar transporter TST2. Plant Physiol, 2020, 183: 236-249.
doi: 10.1104/pp.19.01368
[1] Tang Kuan-Qiang, Li Gong-Yun, Song Mei-Yi, Zhao Xue, Chang Chun-Ling. Genome-wide association analysis and prediction model construction for soybean plant height [J]. Acta Agronomica Sinica, 2026, 52(6): 1743-1756.
[2] Yao Shu, Guo Kai-Yue, Zhai Hui-Hui, Yao Jia-Hui, Deng Wen-Qi, Yan Ling, Huang Chi, Gao Yang, Yu Yan-Ran, Zhao Zhen-Bang, Li Ying-Hui, Wang Xiao-Bo, Li Jia-Jia. Comprehensive evaluation of low-iron tolerance and screening of elite germplasm at the soybean seedling stage [J]. Acta Agronomica Sinica, 2026, 52(5): 1373-1387.
[3] Wang Ling, Hu Hao, Song Jia-Feng, Cheng Jie-Lan, Chen Ying, Zheng Ting-Ting, Lyu Zhao-Yan, Zhu Xiao-Biao, Hou Hua-Lan. Cloning and functional validation of UDP-glycosyltransferase gene StUGT52 in potato [J]. Acta Agronomica Sinica, 2026, 52(3): 665-676.
[4] Niu Li, Wang Yong-Sheng, Wang Chang-Jie, Zhang Hong, Meng Ya-Xiong, Li Bao-Chun, Yang Ke, Ma Xiao-Le, Yao Li-Rong, Si Er-Jing, Wang Hua-Jun, Wang Jun-Cheng. Identification and analysis of the NAC gene family in barley (Hordeum vulgare L.) and functional validation of HvNAC38 in salt tolerance [J]. Acta Agronomica Sinica, 2026, 52(3): 688-707.
[5] Li Shi-Qing, Wang Qian, Wang Su-Hua, Zhang Yao-Wen, Wang Li-Xia. Evaluation of salt tolerance at the seedling stage and related gene mining in mung bean germplasm resources [J]. Acta Agronomica Sinica, 2026, 52(2): 376-388.
[6] Huang Li-Xia, Zhang Wei-Wei, Zhen Yi-Yue, Wang Qiu-Bao, Tian Hong-Ling, Li Guo-Dong, Liu Long-Long, Zhang Li-Jun. Evaluation of salinity tolerance and germplasm screening of buckwheat during germination under salt stress [J]. Acta Agronomica Sinica, 2026, 52(2): 459-479.
[7] Qi Qing-Song, Niu Xiang-Yu, Liu Bing-Ke, Kang Lu, Wang Chen, Feng De-Shun. Salt tolerance identification, screening and salt tolerance index evaluation of wheat-Thinopyrum intermedium radiation mutagenesis germplasm at germination and seedling stage [J]. Acta Agronomica Sinica, 2026, 52(2): 389-404.
[8] Zhang Qing, Yang Yu, Guo Qian, Yue Pei-Yao, Yin Cong-Cong, Niu Jing-Ping, Zhao Jin-Zhong, Du Wei-Jun, Yue Ai-Qin. Cloning and functional analysis of the soybean GmARA6a gene in response to salt stress [J]. Acta Agronomica Sinica, 2026, 52(2): 480-493.
[9] Wang Fei-Fei, Zhang Sheng-Zhong, Yang Gui-Hua, Miao Hua-Rong, Hu Xiao-Hui, Zhang Ze-Lin, Liu Sha-Sha, Qiao Li-Xian, Shan Shi-Hua, Chen Jing. Comprehensive evaluation of salt tolerance and identification of elite salt-tolerant germplasm in 331 peanut accessions at seedling stage [J]. Acta Agronomica Sinica, 2026, 52(1): 279-294.
[10] WANG Ke-Jing, LI Xiang-Hua. Endangerment assessment of the perennial species G. tabacina and G. tomentella of the genus Glycine Willd. in China [J]. Acta Agronomica Sinica, 2025, 51(8): 2009-2019.
[11] MENG Ran, LI Zhao-Jia, FENG Wei, CHEN Yue, LIU Lu-Ping, YANG Chun-Yan, LU Xue-Lin, WANG Xiu-Ping. Comprehensive evaluation of salt tolerance at different growth stages of soybean and screening of salt-tolerant germplasm [J]. Acta Agronomica Sinica, 2025, 51(8): 1991-2008.
[12] HE Hong-Li, ZHANG Yu-Han, YANG Jing, CHENG Yun-Qing, ZHAO Yang, LI Xing-Nuo, SI Hong-Liang, ZHANG Xing-Zheng, YANG Xiang-Dong. Creation and physiological analysis of an e1-as gene mutant in soybean [J]. Acta Agronomica Sinica, 2025, 51(8): 2228-2239.
[13] HU Meng, SHA Dan, ZHANG Sheng-Rui, GU Yong-Zhe, ZHANG Shi-Bi, LI Jing, SUN Jun-Ming, QIU Li-Juan, LI Bin. QTL mapping and candidate gene screening for branch number in soybean [J]. Acta Agronomica Sinica, 2025, 51(7): 1747-1756.
[14] WANG Qiong, ZOU Dan-Xia, CHEN Xing-Yun, ZHANG Wei, ZHANG Hong-Mei, LIU Xiao-Qing, JIA Qian-Ru, WEI Li-Bin, CUI Xiao-Yan, CHEN Xin, WANG Xue-Jun, CHEN Hua-Tao. Genome-wide association analysis and candidate genes prediction of flowering time and maturity date traits in soybean (Glycine max L.) [J]. Acta Agronomica Sinica, 2025, 51(6): 1558-1568.
[15] YIN Cong-Cong, LI Rui-Qi, YUE Pei-Yao, LI Chen, NIU Jing-Ping, ZHAO Jin-Zhong, DU Wei-Jun, YUE Ai-Qin. Establishment and application of a visual detection method for soybean mosaic virus SC15 based on closed dumbbell mediated isothermal amplification [J]. Acta Agronomica Sinica, 2025, 51(5): 1248-1260.
Viewed
Full text


Abstract

Cited
  Shared   
  Discussed   
No Suggested Reading articles found!
Add: No. 80 Xueyuan South Rd, Beijing 100081, P. R. China E-mail: zwxb301@caas.cn
Supported by Beijing Magtech Co.Ltd