Welcome to Acta Agronomica Sinica,

Acta Agronomica Sinica ›› 2023, Vol. 49 ›› Issue (7): 1769-1784.doi: 10.3724/SP.J.1006.2023.24180

• CROP GENETICS & BREEDING·GERMPLASM RESOURCES·MOLECULAR GENETICS • Previous Articles     Next Articles

Evolution and relative expression pattern of LRRII-RLK gene family in sugarcane Saccharum spontaneum

DING Hong-Yan1,2(), FENG Xiao-Xi3, WANG Bai-Yu2, ZHANG Ji-Sen1,2,*()   

  1. 1College of Agriculture, Guangxi University, Nanning 530004, Guangxi, China
    2State Key Laboratory of Conservation and Utilization of Agric-Biological Resources, Guangxi University, Nanning 530004, Guangxi, China
    3College of Agriculture, Fujian Agriculture and Forestry University, Fuzhou 350002, Fujian, China
  • Received:2022-08-03 Accepted:2022-11-25 Online:2023-07-12 Published:2022-12-14
  • Contact: *E-mail: zjisen@126.com E-mail:hyding2020@163.com;zjisen@126.com
  • Supported by:
    The National Key Research and Development Program of China(2021YFF1000100);The Science and Technology Planting Project of Guangdong Province(2019B020238001)

Abstract:

It is well-known that LRRII-RLK gene family widely exists in plants. These genes are receptor like kinase (RLK), which play a significant role in plant development and biological stress. Up till now, there is no systematic identification and analysis of the LRRII-RLK gene family in sugarcane. Here, we identified 27 LRRII-RLK genes in Saccharum spontaneum, which were distributed on 17 chromosomes. Phylogenetic tree showed the classification of these genes into three different branches including NIK, SERK, and LRRII-C. Furthermore, we observed the significant amplification in the LRRII-C branch. Next, we characterized the cis-regulatory elements, which identified 32 different types of cis elements in the gene promoters, primarily involved in light response, stress response, regulation of hormone mechanism, and plant growth. Interestingly, SsLRRII-RLK genes were detected to be conserved with 35 collinear gene pairs and multiple conserved motifs. These genes were mainly amplified by segmental replication and had undergone strict purification selection during the evolution, according to their Ka/Ks ratios. Furthermore, the relative expression level of SsLRRII-RLK genes varied in different tissues of sugarcane. Additionally, some genes expressed differently during distinct periods of day and night, suggesting that they were associated with plant growth regulation and photosynthesis. Noticeably, the relative expression pattern of SsLRRII-RLK genes varied significantly under different disease conditions (sugarcane pokkah boeng disease and mosaic disease). In conclusion, these genes might play a role in pathogenesis and viral replication. The results of this study are helpful to further understand the evolutionary process of LRRII-RLK gene in sugarcane. This data provides a preliminary theoretical basis for the functional study of LRRII-RLK gene during photosynthesis, growth and development, and disease conditions in sugarcane.

Key words: Saccharum spontaneum, LRRII-RLK genes, transcriptomics, gene expression analysis, phylogenetic analysis

Table 1

Primers for qPCR study"

基因名称
Gene name
正向引物
Forward sequence (5'-3')
反向引物
Reverse sequence (5'-3')
GAPDH CACGGCCACTGGAAGCA TCCTCAGGGTTCCTGATGCC
SsLRRII-RLK1 AGAGCGCCTACTTGTTTATCC GCTTCCTTGCAGACCAATCTA
SsLRRII-RLK4-2 GGATCATGCTTCTGGAGCTTATTA CTTCTCCTTCAGCAGTCCTTTC
SsLRRII-RLK 5 GGCTATGGGATCATGCTTCTT CCCTTCTCTCTGTAGCTTCTTTAC
SsLRRII-RLK 9-3 GCCTTCGTGGATTCTGTATGA GCCAATCTAGTGGAGGTTCAG
SsLRRII-RLK 14 CTACTTCAGGCGGCTCATTAC GCACCAACAATGCTTCCAATAA
SsLRRII-RLK 16-2 CCAGTGTCCTACAACCTCAATAG GCCTCCACCAGAACAGAAAT

Table 2

Information of LRRII-RLK gene family in Saccharum spontaneum"

基因编号
No. of genes
基因
Gene name
染色体
Chr.
氨基酸数
NA
分子量
MW (kD)
等电点
pI
不稳定系数
Instability
index
平均疏水性
Grand average of hydropathicity
复制类型
Replication
type
Sspon.01G0025910-4D SsLRRII-RLK-1 1D 629 69.86 5.31 31.89 -0.130 4
Sspon.01G0025910-2B SsLRRII-RLK-1-2 1B 384 41.90 6.83 30.59 0.105 4
Sspon.03G0036270-1B SsLRRII-RLK-2 3B 417 45.56 8.85 35.51 -0.022 4
Sspon.03G0036270-2C SsLRRII-RLK-2-2 3C 417 45.51 8.85 35.15 -0.021 4
Sspon.03G0036270-3D SsLRRII-RLK-2-3 3D 410 44.65 7.10 26.89 -0.053 4
Sspon.04G0004390-1A SsLRRII-RLK-3 4A 661 72.62 7.87 38.30 -0.010 4
Sspon.04G0004390-2D SsLRRII-RLK-3-2 4D 626 68.61 7.25 39.69 -0.037 4
Sspon.04G0009850-1A SsLRRII-RLK-4 4A 578 63.63 5.57 44.60 -0.181 4
Sspon.04G0009850-3D SsLRRII-RLK-4-2 4D 625 68.62 5.57 44.03 -0.147 4
Sspon.04G0013270-1A SsLRRII-RLK-5 4A 606 67.54 5.13 35.40 -0.184 4
Sspon.04G0014480-3D SsLRRII-RLK-6 4D 715 79.13 5.68 38.88 -0.107 4
Sspon.05G0010060-2C SsLRRII-RLK-7 5C 458 50.37 5.98 46.82 -0.237 4
Sspon.05G0010060-1A SsLRRII-RLK-7-2 5A 543 60.94 7.06 45.11 -0.243 4
Sspon.06G0005550-1A SsLRRII-RLK-8 6A 982 105.55 10.63 46.16 -0.211 4
Sspon.06G0010230-1A SsLRRII-RLK-9 6A 580 64.21 5.84 43.90 -0.243 4
Sspon.06G0010230-2B SsLRRII-RLK-9-2 6B 586 64.37 5.66 44.92 -0.166 4
Sspon.06G0010230-3C SsLRRII-RLK-9-3 6C 584 64.62 5.77 43.86 -0.221 3
Sspon.06G0016870-1A SsLRRII-RLK-10 6A 581 65.10 5.89 38.07 -0.211 4
Sspon.06G0016880-1A SsLRRII-RLK-11 6A 925 102.95 8.20 45.98 -0.382 4
Sspon.06G0016880-2B SsLRRII-RLK-11-2 6B 619 69.48 5.57 38.08 -0.120 2
Sspon.06G0016880-1P SsLRRII-RLK-12 6B 624 70.00 5.64 38.47 -0.107 4
Sspon.06G0005060-3C SsLRRII-RLK-13 6C 591 66.41 6.35 34.31 -0.092 4
Sspon.06G0035390-1D SsLRRII-RLK-14 6D 473 52.30 8.63 32.14 -0.084 4
Sspon.07G0011930-3D SsLRRII-RLK-15 7D 497 54.79 5.45 39.04 -0.049 4
Sspon.08G0009990-1A SsLRRII-RLK-16 8A 336 37.00 8.70 33.67 -0.025 4
Sspon.08G0009990-2C SsLRRII-RLK-16-2 8C 581 63.95 6.89 39.18 -0.130 1
Sspon.08G0009990-3D SsLRRII-RLK-16-3 8D 551 60.66 7.95 39.71 -0.132 4

Fig. 1

Phylogenetic tree of LRRII-RLKs inform Saccharum spontaneum (Ss) and presentative species including Arabidopsis thaliana (AT), Oryza sativa (Os), and Sorghum bicolor (Sb)"

Fig. 2

Phylogenetic relationships of LRRII-RLK proteins in 17 plant species Linear scale Time Mya (millions of years ago) was shown at the tree’s bottom. Seventeen plants including Saccharum spontaneum, Oryza sativa, Brachypodium distachyon, Sorghum bicolor, Solanum tuberosum, Solanum lycopersicum, Gossypium hirsutum, Arabidopsis thaliana, Raphanus sativus, Citrus sinensis, Citrus clementina, Cucumis sativus, Fragaria vesca, Pyrus bretschneideri, Malus domestica, Prunus mume, and Prunus persica."

Fig. 3

Analysis of conserved motifs and gene structure of LRRII-RLK gene family in Saccharum spontaneum A: SsLRRII-RLK genes structure analysis, different colored boxes indicate different gene structures, black lines indicate introns. B: SsLRRII-RLK proteins conserved motif analysis, different colored boxes indicate different conserved motifs, and black lines indicate amino acid sequences."

Fig. 4

Cis-elements analysis of LRRII-RLK genes in Saccharum spontaneum"

Fig. 5

Distribution and syntenic analysis of SsLRRII-RLK genes in Saccharum spontaneum The internal line indicates the collinearity within SsLRRII-RLK genes."

Fig. 6

Synteny analysis between Saccharum spontaneum and Sorghum bicolor species The grey lines in the background indicate the collinear blocks within two genomes. The red lines indicate the LRRII-RLK syntenic gene pairs."

Fig. 7

Ka/Ks value distribution of all LRRII-RLK orthologous gene pairs between Saccharum spontaneum and Sorghum bicolor * and ** mean significant difference at the 0.05 and 0.01 probability levels, respectively."

Table 3

Divergence time based on Ks estimation for the orthologous genes of LRRII-RLK from Sorghum bicolor and Saccharum spontaneum"

基因编号
Number of genes
基因名
Gene name
同义突变频率Ks
Synonymous
分歧时间
Divergence time (Mya)
Sspon.03G0036270-1B-Sobic.003G051100 SsLRRII-RLK-2-SbLRRII-RLK1 0.1065600 4.512
Sspon.03G0036270-2C-Sobic.003G051100 SsLRRII-RLK-2-2-SbLRRII-RLK1 0.1075050 8.270
Sspon.04G0004390-2D-Sobic.004G252200 SsLRRII-RLK-3-2-SbLRRII-RLK5 0.0616391 4.741
Sspon.04G0009850-3D-Sobic.004G189900 SsLRRII-RLK-4-2-SbLRRII-RLK4 0.0675914 5.199
Sspon.04G0013270-1A-Sobic.004G128200 SsLRRII-RLK-5-SbLRRII-RLK3 0.0586529 4.512
Sspon.04G0014480-3D-Sobic.004G104800 SsLRRII-RLK-6-SbLRRII-RLK2 0.0743093 5.716
Sspon.06G0005550-1A-Sobic.007G142900 SsLRRII-RLK-8-SbLRRII-RLK12 0.2812260 21.633
Sspon.06G0010230-1A-Sobic.007G059600 SsLRRII-RLK-9-SbLRRII-RLK9 0.0693491 5.335
Sspon.06G0010230-2B-Sobic.007G059600 SsLRRII-RLK-9-2-SbLRRII-RLK9 0.1305250 10.040
Sspon.06G0016880-1A-Sobic.005G182400 SsLRRII-RLK-11-SbLRRII-RLK7 0.0387034 2.977
Sspon.06G0016880-2B-Sobic.005G182400 SsLRRII-RLK-11-2-SbLRRII-RLK7 0.0373593 2.874
Sspon.08G0009990-2C-Sobic.010G115300 SsLRRII-RLK-16-2-SbLRRII-RLK15 0.0964024 7.416
Sspon.08G0009990-3D-Sobic.010G115300 SsLRRII-RLK-16-3-SbLRRII-RLK15 0.0919244 7.071
Sspon.06G0035390-1D-Sobic.005G182400 SsLRRII-RLK-14-SbLRRII-RLK7 0.1044750 8.037

Fig. 8

Relative expression profiles of SsLRRII-RLK genes in different tissues, leaf gradients, and day-night rhythms in sugarcane Sd: seedling stage; PM: pre-mature; M: mature; SL: seeding leaf; SS: seeding stem; LR: leaf roll; LF: leaf; BZ: basal zone; TZ: translational zone; MZ1: maturing zone 1; MZ2: maturing zone 2."

Fig. 9

Verification for the relative expression pattern of SsLRRII-RLKs genes by qRT-PCR"

Fig. 10

Heat map of LRRII-RLK genes in sugarcane infected with different diseases (pokkah boeng disease and sugarcane mosaic disease) P1: CK; P2: inchoate; P3: advanced. S1: CK; S2: CK detoxify; S3: post-infection."

[1] Shiu S H. Plant receptor-like kinase gene family: diversity, function, and signaling. Sci STKE, 2001, 2001: re22.
[2] Shiu S H, Bleecker A B. Receptor-like kinases from Arabidopsis form a monophyletic gene family related to animal receptor kinases. Proc Natl Acad Sci USA, 2001, 98: 10763-10768.
doi: 10.1073/pnas.181141598 pmid: 11526204
[3] Shiu S H, Karlowski W M, Pan R, Tzeng Y H, Mayer K F, Li W H. Comparative analysis of the receptor-like kinase family in Arabidopsis and rice. Plant Cell, 2004, 16: 1220-1234.
doi: 10.1105/tpc.020834
[4] Sun X, Wang G L. Genome-wide identification, characterization and phylogenetic analysis of the rice LRR-kinases. PLoS One, 2011, 6: e16079.
doi: 10.1371/journal.pone.0016079
[5] Shiu S H, Bleecker A B. Receptor-like kinases from Arabidopsis form a monophyletic gene family related to animal receptor kinases. Proc Natl Acad Sci USA, 2001, 98: 10763-10768.
doi: 10.1073/pnas.181141598 pmid: 11526204
[6] Tang P, Ying Z, Sun X, Tian D, Yang S, Jing D. Disease resistance signature of the leucine-rich repeat receptor-like kinase genes in four plant species. Plant Sci, 2010, 179: 399-406.
doi: 10.1016/j.plantsci.2010.06.017
[7] Fischer I, Diévart A, Droc G, Dufayard J F, Chantret N. Evolutionary dynamics of the leucine-rich repeat receptor-like kinase (LRR-RLK) subfamily in angiosperms. Plant Physiol, 2016, 170: 1595-1610.
doi: 10.1104/pp.15.01470 pmid: 26773008
[8] Nikolaev S V, Penenko A V, Lavreha V V, Mjolsness E D, Kolchanov N A. A model study of the role of proteins CLV1, CLV2, CLV3, and WUS in regulation of the structure of the shoot apical meristem. Russ J Dev Biol, 2007, 38: 383-388.
doi: 10.1134/S1062360407060069
[9] Gómez-Gómez L, Boller T. FLS2: an LRR receptor-like kinase involved in the perception of the bacterial elicitor flagellin in Arabidopsis. Mol Cell, 2000, 5: 1003-1011.
doi: 10.1016/s1097-2765(00)80265-8 pmid: 10911994
[10] Zipfel C, Kunze G, Chinchilla D, Caniard A, Jones J D G, Boller T, Felix G. Perception of the bacterial PAMP EF-Tu by the receptor EFR restricts Agrobacterium-mediated transformation. Cell, 2006, 125: 749-760.
doi: 10.1016/j.cell.2006.03.037 pmid: 16713565
[11] Jia L, Wen J, Lease K A, Doke J T, Walker J C. BAK1, an Arabidopsis LRR receptor-like protein kinase, interacts with BRI1 and modulates brassinosteroid signaling. Cell, 2002, 110: 213-222.
doi: 10.1016/s0092-8674(02)00812-7 pmid: 12150929
[12] Chinchilla D, Shan L, He P, De Vries S, Kemmerling B. One for all: the receptor-associated kinase BAK1. Trends Plant Sci, 2009, 14: 535-541.
doi: 10.1016/j.tplants.2009.08.002 pmid: 19748302
[13] Mariano A C, Andrade M O, Santos A A, Carolino S, Oliveira M L, Baracat-Pereira M C, Brommonshenkel S H, Fontes E. Identification of a novel receptor-like protein kinase that interacts with a geminivirus nuclear shuttle protein. Virology, 2004, 318: 24-31.
doi: 10.1016/j.virol.2003.09.038 pmid: 14972531
[14] Zorzatto C, Machado J P, Lopes K V, Nascimento K J, Pereira W A, Brustolini O J, Reis P A, Calil I P, Deguchi M, Sachetto-Martins G, Gouveia B C, Loriato V A, Silva M A, Silva F F, Santos A A, Chory J, Fontes E P. NIK1-mediated translation suppression functions as a plant antiviral immunity mechanism. Nature, 2015, 520: 679-682.
doi: 10.1038/nature14171
[15] Fontes E P, Santos A A, Luz D F, Waclawovsky A J, Chory J. The geminivirus nuclear shuttle protein is a virulence factor that suppresses transmembrane receptor kinase activity. Genes Dev, 2004, 18: 2545-2556.
doi: 10.1101/gad.1245904
[16] Santos A A, Lopes K V, Apfata J A, Fontes E P. NSP-interacting kinase, NIK: a transducer of plant defence signalling. J Exp Bot, 2010, 61: 3839-3845.
doi: 10.1093/jxb/erq219 pmid: 20624762
[17] Ali A, Khan M, Sharif R, Mujtaba M, Gao S J. Sugarcane Omics: an update on the current status of research and crop improvement. Plants (Basel), 2019, 8: 344.
doi: 10.3390/plants8090344
[18] Zhang J, Zhang X, Tang H, Zhang Q, Hua X, Ma X, Zhu F, Jones T, Zhu X, Bowers J. Allele-defined genome of the autopolyploid sugarcane Saccharum spontaneum L. Nat Genet, 2018, 50: 1565-1573.
doi: 10.1038/s41588-018-0237-2
[19] Viklund H K, Elofsson A. Best alpha-helical transmembrane protein topology predictions are achieved using hidden Markov models and evolutionary information. Protein Sci, 2004, 13: 1908-1917.
pmid: 15215532
[20] Price M N, Dehal P S, Arkin A P. FastTree 2: approximately maximum-likelihood trees for large alignments. PLoS One, 2010, 5: e9490.
doi: 10.1371/journal.pone.0009490
[21] Yuan Y, Yang X, Feng M, Ding H, Khan M T, Zhang J, Zhang M. Genome-wide analysis of R2R3-MYB transcription factors family in the autopolyploid Saccharum spontaneum: an exploration of dominance expression and stress response. BMC Genomics, 2021, 22: 1-18.
doi: 10.1186/s12864-020-07350-y
[22] Katoh K, Standley D M. Katoh K, Standley D M. MAFFT multiple sequence alignment software version 7: improvements in performance and usability. Mol Biol Evol, 2013, 30: 772-780.
doi: 10.1093/molbev/mst010 pmid: 23329690
[23] Sun J, Li L, Wang P, Zhang S, Wu J. Genome-wide characterization, evolution, and expression analysis of the leucine-rich repeat receptor-like protein kinase (LRR-RLK) gene family in Rosaceae genomes. BMC Genomics, 2017, 18: 763.
doi: 10.1186/s12864-017-4155-y pmid: 29017442
[24] Magalhães D M, Scholte L, Silva N V, Oliveira G C, Zipfel C, Takita M A, Souza A D. LRR-RLK family from two Citrus species: genome-wide identification and evolutionary aspects. BMC Genomics, 2016, 17: 623.
doi: 10.1186/s12864-016-2930-9 pmid: 27515968
[25] Yuan N, Rai K M, Balasubramanian V K, Upadhyay S K, Luo H, Mendu V. Genome-wide identification and characterization of LRR-RLKs reveal functional conservation of the SIF subfamily in cotton (Gossypium hirsutum). BMC Plant Biol, 2018, 18: 185.
doi: 10.1186/s12870-018-1395-1
[26] Wang J, Hu T, Wang W, Hu H, Wei Q, Bao C. Investigation of evolutionary and expressional relationships in the function of the leucine-rich repeat receptor-like protein kinase gene family (LRR-RLK) in the radish (Raphanus sativus L.). Sci Rep, 2019, 9: 6937.
doi: 10.1038/s41598-019-43516-9
[27] Wei Z, Wang J, Yang S, Song Y. Identification and expression analysis of the LRR-RLK gene family in tomato (Solanum lycopersicum) Heinz 1706. Genome, 2015, 58: 121-134.
doi: 10.1139/gen-2015-0035 pmid: 26207619
[28] Li X, Ahmad S, Guo C, Yu J, Cao S, Gao X, Li W, Li H, Guo Y. Identification and characterization of LRR-RLK family genes in potato reveal their involvement in peptide signaling of cell fate decisions and biotic/abiotic stress responses. Cells, 2018, 7: 120.
doi: 10.3390/cells7090120
[29] Yu J, Zhang B, Liu S, Guo W, Gao Y, Sun H. Genome-wide characterization, evolution and expression analysis of the leucine-rich repeat receptor-like kinase (LRR-RLK) gene family in cucumbers. Plant Prot Sci, 2022, 58: 125-138.
doi: 10.17221/131/2021-PPS
[30] Hu B, Jin J, Guo A Y, Zhang H, Luo J, Gao G. GSDS 2.0: an upgraded gene feature visualization server. Bioinformatics, 2015, 31: 1296-1297.
doi: 10.1093/bioinformatics/btu817 pmid: 25504850
[31] Bailey T L, Boden M, Buske F A, Frith M, Grant C E, Clementi L, Ren J, Li W W, Noble W S. MEME SUITE: tools for motif discovery and searching. Nucleic Acids Res, 2009, 37: W202-W208.
[32] Wang Y, Tang H, Debarry J D, Tan X, Li J, Wang X, Lee T H, Jin H, Marler B, Guo H. MCScanX: a toolkit for detection and evolutionary analysis of gene synteny and collinearity. Nucleic Acids Res, 2012, 40: e49.
doi: 10.1093/nar/gkr1293
[33] Krzywinski M, Schein J, Birol I, Connors J, Gascoyne R, Horsman D, Jones S J, Marra M A. Circos: an information aesthetic for comparative genomics. Genome Res, 2009, 19: 1639-1645.
doi: 10.1101/gr.092759.109 pmid: 19541911
[34] Tang H, Bowers J E, Wang X, Ming R, Alam M, Paterson A H. Synteny and collinearity in plant genomes. Science, 2008, 320: 486-488.
doi: 10.1126/science.1153917 pmid: 18436778
[35] Wang D, Zhang Y, Zhang Z, Zhu J, Yu J. KaKs_Calculator 2.0: a toolkit incorporating gamma-series methods and sliding window strategies. Genom Proteom Bioinf, 2010, 8: 77-80.
doi: 10.1016/S1672-0229(10)60008-3 pmid: 20451164
[36] Gaut B S, Morton B R, Mccaig B C, Clegg M T. Substitution rate comparisons between grasses and palms: synonymous rate differences at the nuclear gene Adh parallel rate differences at the plastid gene rbcL. Proc Natl Acad Sci USA, 1996, 93: 10274-10279.
doi: 10.1073/pnas.93.19.10274 pmid: 8816790
[37] Chen Y, Zhang Q, Hu W, Zhang X, Wang L, Hua X, Yu Q, Ming R, Zhang J. Evolution and expression of the fructokinase gene family in Saccharum. BMC Genomics, 2017, 18: 197.
doi: 10.1186/s12864-017-3535-7 pmid: 28222695
[38] Zhang Q, Hua X, Liu H, Yuan Y, Shi Y, Wang Z, Zhang M, Ming R, Zhang J. Evolutionary expansion and functional divergence of sugar transporters in Saccharum (S. spontaneum and S. officinarum). Plant J, 2021, 105: 884-906.
doi: 10.1111/tpj.v105.4
[39] Li Z, Hua X, Zhong W, Yuan Y, Wang Y, Wang Z, Ming R, Zhang J. Genome-wide identification and expression profile analysis of WRKY family genes in the autopolyploid Saccharum spontaneum. Plant Cell Physiol, 2019, 61: 616-630.
doi: 10.1093/pcp/pcz227
[40] Livak K J, Schmittgen T D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods, 2001, 25: 402-408.
doi: 10.1006/meth.2001.1262 pmid: 11846609
[41] Ling H, Wu Q, Guo J, Xu L, Que Y. Comprehensive selection of reference genes for gene expression normalization in sugarcane by real time quantitative RT-PCR. PLoS One, 2015, 10: e0118444.
doi: 10.1371/journal.pone.0118444
[42] Swift M L. GraphPad prism, data analysis, and scientific graphing. J Chem Inf Comput Sci, 1997, 37: 411-412.
doi: 10.1021/ci960402j
[43] Wang P, Moore B M, Panchy N L, Meng F, Lehti-Shiu M D, Shiu S H. Factors influencing gene family size variation among related species in a plant family, Solanaceae. Genome Biol Evol, 2018, 10: 2596-2613.
doi: 10.1093/gbe/evy193 pmid: 30239695
[44] Zhang J, Zhang Q, Li L, Tang H, Zhang Q, Chen Y, Arrow J, Zhang X, Wang A, Miao C. Recent polyploidization events in three Saccharum founding species. Plant Biotechnol J, 2019, 17: 264-274.
doi: 10.1111/pbi.2019.17.issue-1
[45] Goswami D, Handique P J, Deka S. Rhamnolipid biosurfactant against Fusarium sacchari—the causal organism of pokkah boeng disease of sugarcane. J Basic Microbiol, 2014, 54: 548-557.
doi: 10.1002/jobm.v54.6
[46] Xu S, Wang J, Wang H, Bao Y, Li Y, Govindaraju M, Yao W, Chen B, Zhang M. Molecular characterization of carbendazim resistance of Fusarium species complex that causes sugarcane pokkah boeng disease. BMC Genomics, 2019, 20: 115.
doi: 10.1186/s12864-019-5479-6 pmid: 30732567
[47] Singh A, Chauhan S S, Singh A, Singh S B. Deterioration in sugarcane due to pokkah boeng disease. Sugar Technol, 2006, 8: 187-190.
doi: 10.1007/BF02943659
[48] Yang Z N, Mirkov T E. Sequence and relationships of sugarcane mosaic and sorghum mosaic virus strains and development of RT-PCR-Based RFLPs for strain discrimination. Phytopathology, 1997, 87: 932-939.
doi: 10.1094/PHYTO.1997.87.9.932 pmid: 18945064
[49] Xu D L, Park J W, Mirkov T E, Zhou G H. Viruses causing mosaic disease in sugarcane and their genetic diversity in southern China. Arch Virol, 2008, 153: 1031-1039.
doi: 10.1007/s00705-008-0072-3 pmid: 18438601
[50] Chauhan R P, Rajakaruna P, Verchot J. Complete genome sequence of nine isolates of canna yellow streak virus reveals its relationship to the sugarcane mosaic virus (SCMV) subgroup of potyviruses. Arch Virol, 2015, 160: 837-844.
doi: 10.1007/s00705-014-2327-5 pmid: 25567205
[51] Zhou F, Guo Y, Qiu L J. Genome-wide identification and evolutionary analysis of leucine-rich repeat receptor-like protein kinase genes in soybean. BMC Plant Biol, 2016, 16: 58.
doi: 10.1186/s12870-016-0744-1 pmid: 26935840
[52] Santos A, Lopes K, Apfata J, Fontes E. NSP-interacting kinase, NIK: a transducer of plant defence signalling. J Exp Bot, 2010, 2010, 61: 3839-3845.
doi: 10.1093/jxb/erq219 pmid: 20624762
[53] Hu H, Xiong L, Yang Y. Rice SERK1 gene positively regulates somatic embryogenesis of cultured cell and host defense response against fungal infection. Planta, 2005, 222: 107-117.
doi: 10.1007/s00425-005-1534-4 pmid: 15968510
[54] Kim C, Wang X, Lee T H, Jakob K, Lee G J, Paterson A H. Comparative analysis of Miscanthus and Saccharum reveals a shared whole-genome duplication but different evolutionary fates. Plant Cell, 2014, 26: 2420-2429.
doi: 10.1105/tpc.114.125583
[55] Sakamoto T, Deguchi M, Brustolini O J, Santos A A, Silva F F, Fontes E P. The tomato RLK superfamily: phylogeny and functional predictions about the role of the LRRII-RLK subfamily in antiviral defense. BMC Plant Biol, 2012, 12: 229.
doi: 10.1186/1471-2229-12-229 pmid: 23198823
[56] Cannon S B, Mitra A, Baumgarten A, Young N D, May G. The roles of segmental and tandem gene duplication in the evolution of large gene families in Arabidopsis thaliana. BMC Plant Biol, 2004, 4: 10.
doi: 10.1186/1471-2229-4-10
[57] Zhang Z, Li X. Genome-wide identification of AP2/ERF superfamily genes and their expression during fruit ripening of Chinese jujube. Sci Rep, 2018, 8: 15612.
doi: 10.1038/s41598-018-33744-w pmid: 30353116
[58] Guo B, Wei Y, Xu R, Lin S, Luan H, Lyu C, Zhang X, Song X, Xu R. Genome-wide analysis of APETALA2/ethylene-responsive factor (AP2/ERF) gene family in barley (Hordeum vulgare L.). PLoS One, 2016, 11: e0161322.
doi: 10.1371/journal.pone.0161322
[59] Niehrs C, Pollet N. Synexpression groups in eukaryotes. Nature, 1999, 402: 483-487.
doi: 10.1038/990025
[60] He K, Gou X, Yuan T, Lin H, Asami T, Yoshida S, Russell S D, Li J. BAK1 and BKK1 regulate brassinosteroid-dependent growth and brassinosteroid-independent cell-death pathways. Curr Biol, 2007, 17: 1109-1115.
doi: 10.1016/j.cub.2007.05.036 pmid: 17600708
[61] Jin Y L, Tang R J, Wang H H, Jiang C M, Bao Y, Yang Y, Liang M X, Sun Z C, Kong F J, Li B. Overexpression of Populus trichocarpa CYP85A3 promotes growth and biomass production in transgenic trees. Plant Biotechnol J, 2017, 15: 1309-1321.
doi: 10.1111/pbi.12717 pmid: 28258966
[62] Lakhssassi N, Liu S, Bekal S, Zhou Z, Colantonio V, Lambert K, Barakat A, Meksem K. Characterization of the soluble NSF attachment protein gene family identifies two members involved in additive resistance to a plant pathogen. Sci Rep, 2017, 7: 45226.
doi: 10.1038/srep45226 pmid: 28338077
[63] Pérez-Pérez J, Esteve-Bruna D, González-Bayón R, Kangasj R S, Caldana C, Hannah M A, Willmitzer L, Micol P. Functional redundancy and divergence within the Arabidopsis RETICULATA-RELATED gene family. Plant Physiol, 2013, 162: 589-603.
doi: 10.1104/pp.113.217323 pmid: 23596191
[64] Lakhssassi N, Doblas V G, Rosado A, Del Valle A E, Posé D, Jimenez A J, Castillo A G, Valpuesta V, Borsani O, Botella M A. The Arabidopsis TETRATRICOPEPTIDE THIOREDOXIN-LIKE gene family is required for osmotic stress tolerance and male sporogenesis. Plant Physiol, 2012, 158: 1252-1266.
doi: 10.1104/pp.111.188920 pmid: 22232384
[65] Ni Z, Kim E D, Ha M, Lackey E, Liu J, Zhang Y, Sun Q, Chen Z J. Altered circadian rhythms regulate growth vigour in hybrids and allopolyploids. Nature, 2009, 457: 327-331.
doi: 10.1038/nature07523
[66] Michael T P, Salome P A, Yu H J, Spencer T R, Sharp E L, McPeek M A, Alonso J M, Ecker J R, McClung C R. Enhanced fitness conferred by naturally occurring variation in the circadian clock. Science, 2003, 302: 1049-1053.
doi: 10.1126/science.1082971 pmid: 14605371
[67] Giuliano G, Hoffman N E, Ko K, Scolnik P A, Cashmore A R. A light-entrained circadian clock controls transcription of several plant genes. EMBO J, 1988, 7: 3635-3642.
doi: 10.1002/j.1460-2075.1988.tb03244.x pmid: 3208743
[68] Green R M, Tingay S, Wang Z Y, Tobin E M. Circadian rhythms confer a higher level of fitness to Arabidopsis plants. Plant Physiol, 2002, 129: 576-584.
doi: 10.1104/pp.004374
[69] Chen X, Zuo S, Schwessinger B, Chern M, Canlas P E, Ruan D, Zhou X, Wang J, Daudi A, Petzold C J, Heazlewood J L, Ronald P C. An XA21-associated kinase (OsSERK2) regulates immunity mediated by the XA21 and XA3 immune receptors. Mol Plant, 2014, 7: 874-892.
doi: 10.1093/mp/ssu003 pmid: 24482436
[70] Chaparro-Garcia A, Wilkinson R C, Gimenez-Ibanez S, Findlay K, Coffey M D, Zipfel C, Rathjen J P, Kamoun S, Schornack S. The receptor-like kinase SERK3/BAK1 is required for basal resistance against the late blight pathogen Phytophthora infestans in Nicotiana benthamiana. PLoS One, 2011, 6: e16608.
doi: 10.1371/journal.pone.0016608
[1] Wang Ya, Zhao Yi-Ting, Wang Zhou, Yang Jun-Fang, Zhang Hong-Bin, Cao Yue. Integrated transcriptomic-metabolomic analysis of wax biosynthesis in castor bean (Ricinus communis L.) [J]. Acta Agronomica Sinica, 2026, 52(6): 1774-1787.
[2] Yang Zong-Tao, Yang Ting, Wang Yu-Tong, Ai Jing, Li Yan-Ye, Liu Jia-Yong, Deng Jun, Zhao Yong, Zhang Yue-Bin. Identification and expression analysis of the CLC gene family in sugarcane [J]. Acta Agronomica Sinica, 2026, 52(3): 722-734.
[3] Tian Jia-Chun, Ge Xia, Li Shou-Qiang, Li Mei, Tian Shi-Long, Zhang Ya-Qian, Cheng Jian-Xin, Li Yu-Mei. Mechanism of low O2 and high CO2 storage environment delaying aging of potato tuber [J]. Acta Agronomica Sinica, 2026, 52(1): 262-278.
[4] Jing Xiu-Qing, Cai Yong-Duo, Deng Ning, Zhao Xiao-Dong, Zhai Fei-Hong, Zeng Qun. Identification and expression pattern analysis of RopGEF family genes in Chenopodium quinoa [J]. Acta Agronomica Sinica, 2026, 52(1): 28-43.
[5] XU Jing, BI Jing-Nan, YIN Xiang-Zhen, ZHAO Jian-Xin, ZHAO Xu-Hong, PAN Li-Juan, CHEN Na, JIANG Xiao, MA Jun-Qing, YIN Dong-Mei, CHI Xiao-Yuan. Heterologous expression of peanut ω-3 fatty acid desaturase genes in Arabidopsis thaliana and transcriptome analysis [J]. Acta Agronomica Sinica, 2025, 51(12): 3251-3265.
[6] WANG Tian-Ning, FENG Ya-Lan, JU Ji-Hao, WU Yi, ZHANG Jun, MA Chao. Whole genome identification and analysis of GRFs transcription factor family in wheat and its ancestral species [J]. Acta Agronomica Sinica, 2024, 50(4): 897-813.
[7] LI Yan, FANG Yu-Hui, WANG Yong-Xia, PENG Chao-Jun, HUA Xia, QI Xue-Li, HU Lin, XU Wei-Gang. Transcriptomics profile of transgenic OsPHR2 wheat under different phosphorus stress [J]. Acta Agronomica Sinica, 2024, 50(2): 340-353.
[8] YIN Xiang-Zhen, ZHAO Jian-Xin, HAO Cui-Cui, PAN Li-Juan, CHEN Na, XU Jing, JIANG Xiao, ZHAO Xu-Hong, WANG En-Qi, CAO Huan, YU Shan-Lin, CHI Xiao-Yuan. Cloning and expression analysis of transcription factor AhWRI1s in peanut [J]. Acta Agronomica Sinica, 2024, 50(12): 3155-3164.
[9] WANG Ling, ZHANG Yan-Ping, QI Yan-Ni, WANG Lei, LI Yu-Xiao, TAN Mei-Lian, WANG Wei. Divergent evolutionary pattern of P5CS gene family and drought tolerance verification of LusP5CS1 in linseed [J]. Acta Agronomica Sinica, 2024, 50(10): 2515-2527.
[10] WANG Heng-Bo, FENG Chun-Yan, ZHANG Yi-Xing, XIE Wan-Jie, DU Cui-Cui, WU Ming-Xing, ZHANG Ji-Sen. Genome-wide identification of NAP transcription factors subfamily in Saccharum spontaneum and functional analysis of SsNAP2a involvement in leaf senescence [J]. Acta Agronomica Sinica, 2024, 50(1): 110-125.
[11] DU Cui-Cui, WU Ming-Xing, ZHANG Ya-Ting, XIE Wan-Jie, ZHANG Ji-Sen, WANG Heng-Bo. Cloning and functional analysis of sucrose transporter protein SsSWEET11 gene in sugarcane (Saccharum spontaneum L.) [J]. Acta Agronomica Sinica, 2023, 49(9): 2385-2397.
[12] WANG Hui-Wei, ZHANG Xiang-Ge, LI Chun-Xin, XU Xin-Ran, HU Hai-Yan, ZHU Ya-Jing, WANG Yan, ZHANG Xin-You. Evaluation of salt tolerance in Cyperus esculentus and transcriptomic analysis of seedling roots under salt stress [J]. Acta Agronomica Sinica, 2023, 49(7): 1882-1894.
[13] ZHAO Mei-Cheng, DIAO Xian-Min. Phylogeny of wild Setaria species and their utilization in foxtail millet breeding [J]. Acta Agronomica Sinica, 2022, 48(2): 267-279.
[14] LIN Huan-Tai, ZHANG Tian-Jie, SHI Meng-Ting, GUO Yan-Fang, GAO San-Ji, WANG Jin-Da. Genome-wide analysis of terpene synthase (TPS) gene family and its expression under biological stress in Saccharum spontaneum [J]. Acta Agronomica Sinica, 2022, 48(12): 3029-3044.
[15] JIA Xiao-Xia, QI En-Fang, MA Sheng, HUANG Wei, ZHENG Yong-Wei, BAI Yong-Jie, WEN Guo-Hong. Genome-wide identification and expression analysis of potato PYL gene family [J]. Acta Agronomica Sinica, 2022, 48(10): 2533-2545.
Viewed
Full text


Abstract

Cited

  Shared   
  Discussed   
No Suggested Reading articles found!