Welcome to Acta Agronomica Sinica，

Acta Agronomica Sinica ›› 2019, Vol. 45 ›› Issue (1): 1-9.doi: 10.3724/SP.J.1006.2019.82032

• CROP GENETICS & BREEDING · GERMPLASM RESOURCES · MOLECULAR GENETICS •     Next Articles

Identification and mapping of round seed related gene in rice (Oryza sativa L.)

Ya-Ping CHEN,Rong MIAO,Xi LIU,Ben-Jia CHEN,Jie LAN,Teng-Fei MA,Yi-Hua WANG,Shi-Jia LIU,Ling JIANG()   

  1. State Key Laboratory of Crop Genetics and Germplasm Enhancement / Research Center of Jiangsu Plant Gene Engineering, Nanjing Agricultural University, Nanjing 210095, Jiangsu, China
  • Received:2018-06-07 Accepted:2018-10-08 Online:2018-11-01 Published:2018-11-09
  • Contact: Ling JIANG E-mail:jiangling@njau.edu.cn
  • Supported by:
    This study was supported by the National Key Research and Development Program of China(2016YFD0100101-08);the Key Projects of National Natural Science Foundation(91535302);the National University Student Innovation Program(201710307014)

RichHTML341

66

PDF

1088

Abstract:

It is significant to clarify the genetic and molecular mechanism of genes related to rice grain size for rice yield. A mutant round seed (rs) was screened from japonica variety “Ningjing 3” mutagenized by ethyl methane sulfonate (EMS). Genetic analysis revealed that the phenotype of rs was controlled by a single recessive nuclear gene. Scanning electron microscope observation indicated that the change of cell number was responsible for the mutant phenotype of rs. Compared with the wild type, the expression of cell cycle related-genes increased significantly in rs. RS was located in the 589 kb region of chromosome 3, between markers RM3413 and N3-5. The RS mutation affected BR signal pathway, and changed the expression of grain size-related genes. This research contributes to elucidating the molecular mechanism of rice grain development.

Key words: rice (Oryza sativa L.), round seed mutant, phenotypic analysis, gene mapping

Table 1

Molecular markers for fine-mapping"

标记
Marker		 正向引物序列
Forward primer sequence (5°→3°)		 反向引物序列
Reverse primer sequence (5°→3°)
N3-5 GTCTGTGCGCTCCTTGTTCTAGC CCTGGACCAATTTGTATGGTTGG
N3-9 GATGCAGTAGGAACACCAAACAGC ATCGAGTACCAAGTGCCTGTGC
N3-10 GGTTTGGGAGCCCATAATCT CTGGGCTTCTTTCACTCGTC
RM3413 TTAGAGGAGATGATGGTGCAACG AGCAGCCATTGAATGTGTTTGG
RM14282 CCCAAACACAAACACAAAGAGAGC AACACGCAGGTCCTCTTGAACC
I3-2 TACTTTAATTTTGCAGCTC TTTTACCCCACTCCATCT

Table 2

Comparison of agronomic traits between wild type and rs"

性状 Trait 野生型 Wild type 突变体 rs
粒长 Grain length (mm) 7.50±0.009 6.39±0.023**
粒宽 Grain width (mm) 3.13±0.021 3.58±0.003**
长/宽比 Length/width ratio 2.42±0.013 1.80±0.009**
粒厚 Grain thickness (mm) 1.14±0.025 1.28±0.062**
千粒重 1000-grain weight (g) 25.45±0.890 22.51±0.252**
株高 Plant height (cm) 91.40±2.633 90.50±2.121
穗长 Panicle length (cm) 17.35±0.803 17.19±0.709
分蘖数 Number of tillers 11.00±2.160 10.1±2.025
结实率 Seed setting rate (%) 72.69±2.430 56.90±4.270**

Table 3

Genetic analysis of the mutant rs"

杂交组合
Cross-combination		 总株数
Total number
of plants		 正常表现
Wild-type
phenotype		 突变表现
Mutant
phenotype		 χ2(3:1)
rs/WT 174 135 39 0.62
WT/rs 207 161 46 0.85

Fig. 1

Phenotypes of the wild type and the rs mutant A: plants of the wild type and the rs mutant at heading stage. Bar = 10 cm. B, C: grain phenotypes of the wild type and rs. Bar = 6 mm. D, F: comparisons of grain length, width, and the 1000-grain weight. ** Significant difference at P = 0.01 level between the wild type and the mutant rs."

Fig. 2

Histological analysis of spikelet hulls A, B; scanning electron microscope analysis of the outer surfaces of glumes. Bar=200 μm. C, D: comparison of cell length and width in outer glumes. E, F: comparison of cell number in outer glumes. Data are given as means ± SD. *P = 0.05; **P = 0.01."

Fig. 3

Expression levels of cell cycle-related genesCycA2;1, CycD4, E2F2, CycT1, CDKB, CDKA1, CycA2;2, Cdc20, and CycA2;3 Values are mean±SD (n = 3). * and ** indicate significant differences between WT and rs at P = 0.05 and P = 0.01 by Student’s t-test."

Fig. 4

Fine mapping of the RS gene The black circle means the centromere; the thick vertical line means a co-segregate marker; the number under the markers means the number of extreme individuals."

Fig. 5

Response test to 2,4-epiBL in the wild type and rs A: performance of lamina joint to 2,4-epiBL in wild-type (up) and rs (down). B: changes of lamina inclination to 2,4-epiBL. C: expression levels of BR synthesis and signal transduction pathway genes in the wild type and rs. ** Significant difference at the 0.01 level between wild type and rs."

Fig. 6

Expression levels of grain shape-related genes in wild type (WT) and rs"

[1] Xing Y, Zhang Q . Genetic and molecular bases of rice yield. Annu Rev Plant Biol, 2010,61:421-442.
doi: 10.1146/annurev-arplant-042809-112209 pmid: 20192739
[2] Mao H, Sun S, Yao J, Wang C, Yu S, Xu C, Li X, Zhang Q . Linking differential domain functions of the GS3 protein to natural variation of grain size in rice. Proc Natl Acad Sci USA, 2010,107:19579-19584.
doi: 10.1073/pnas.1014419107
[3] Song X J, Huang W, Shi M, Zhu M Z, Lin H X . A QTL for rice grain width and weight encodes a previously unknown RING- type E3 ubiquitin ligase. Nat Genet, 2007,39:623-630.
doi: 10.1038/ng2014 pmid: 17417637
[4] Hu J, Wang Y, Fang Y, Zeng L, Xu J, Yu H, Shi Z, Pan J, Zhang D, Kang S, Zhu L, Dong G, Guo L, Zeng D, Zhang G, Xie L, Xiong G, Li J, Qian Q . A rare allele of GS2 enhances grain size and grain yield in rice. Mol Plant, 2015,8:1455-1465.
doi: 10.1016/j.molp.2015.07.002 pmid: 26187814
[5] Wu W, Liu X, Wang M, Meyer R S, Luo X, Ndjiondjop M N, Tan L, Zhang J, Wu J, Cai H, Sun C, Wang X, Wing RA, Zhu Z . A single-nucleotide polymorphism causes smaller grain size and loss of seed shattering during African rice domestication. Nat Plants, 2017,3:17064-17071.
doi: 10.1038/nplants.2017.64 pmid: 28481332
[6] Wang Y, Xiong G, Hu J, Jiang L, Yu H, Xu J, Fang Y, Zeng L, Xu E, Xu J, Ye W, Meng X, Liu R, Chen H, Jing Y, Wang Y, Zhu X, Li J, Qian Q . Copy number variation at the GL7 locus contributes to grain size diversity in rice. Nat Genet, 2015,47:944-952.
doi: 10.1038/ng.3346 pmid: 26147619
[7] Xu C, Liu Y, Li Y, Xu X, Xu C, Li X, Xiao J, Zhang Q . Differential expression of GS5 regulates grain size in rice. J Exp Bot, 2015,66:2611-2634.
doi: 10.1093/jxb/erv058 pmid: 25711711
[8] Li J, Chu H, Zhang Y, Mou T, Wu C, Zhang Q, Xu J . The rice HGW gene encodes a ubiquitin-associated (UBA) domain protein that regulates heading date and grain weight. PLoS One, 2012,7:e34231.
doi: 10.1371/journal.pone.0034231 pmid: 22457828
[9] Wang E, Wang J, Zhu X, Hao W, Wang L, Li Q, Zhang L, He W, Lu B, Lin H, Ma H, Zhang G, He Z . Control of rice grain-filling and yield by a gene with a potential signature of domestication. Nat Genet, 2008,40:1370-1374.
doi: 10.1038/ng.220 pmid: 18820698
[10] Ishimaru K, Hirotsu N, Madoka Y, Murakami N, Hara N, Onodera H, Kashiwagi T, Ujiie K, Shimizu B, Onishi A, Miyagawa H, Katoh E . Loss of function of the IAA-glucose hydrolase gene TGW6 enhances rice grain weight and increases yield. Nat Genet, 2013,45:707-711.
doi: 10.1038/ng.2612 pmid: 23583977
[11] Wang S, Wu K, Yuan Q, Liu X, Liu Z, Lin X, Zeng R, Zhu H, Dong G, Qian Q, Zhang G, Fu X . Control of grain size, shape and quality by OsSPL16 in rice. Nat Genet, 2012,44:950-954.
doi: 10.1038/ng.2327 pmid: 22729225
[12] Liu J, Chen J, Zheng X, Wu F, Lin Q, Heng Y, Tian P, Cheng Z, Yu X, Zhou K, Zhang X, Guo X, Wang J, Wang H, Wan J M . GW5 acts in the brassinosteroid signaling pathway to regulate grain width and weight in rice. Nat Plants, 2017,3:17043-17080.
doi: 10.1038/nplants.2017.43 pmid: 28394310
[13] Hong Z, Ueguchi-Tanaka M, Umemura K, Uozu S, Fujioka S, Takatsuto S, Yoshida S, Ashikari M, Kitano H, Matsuoka M . A rice brassinosteroid-deficient mutant,ebisu dwarf (d2), is caused by a loss of function of a new member of cytochrome P450. Plant Cell, 2003,15:2900-2910.
doi: 10.1105/tpc.014712 pmid: 14615594
[14] Liu L, Tong H, Xiao Y, Che R, Xu F, Hu B, Liang C, Chu J, Li J, Chu C . Activation of Big Grain1 significantly improves grain size by regulating auxin transport in rice. Proc Natl Acad Sci USA, 2015,112:11102-11107.
doi: 10.1073/pnas.1512748112 pmid: 26283354
[15] Abbasi F, Onodera H, Toki S, Tanaka H, Komatsu S . OsCDPK13, a calcium-dependent protein kinase gene from rice, is induced in response to cold and gibberellin in rice leaf sheath. Plant Mol Biol, 2004,55:541-552.
doi: 10.1007/s11103-004-1178-y pmid: 15604699
[16] Yamamuro C, Ihara Y, Wu X, Noguchi T, Fujioka S, Takatsuto S, Ashikari M, Kitano H, Matsuoka M . Loss of function of a rice brassinosteroid insensitive1 homolog prevents internode elongation and bending of the lamina joint. Plant Cell, 2000,12:1591-1605.
[17] Liu S, Hua L, Dong S, Chen H, Zhu X, Jiang J, Zhang F, Li Y, Fang X, Chen F . OsMAPK6, a mitogen-activated protein kinase, influences rice grain size and biomass production. Plant J, 2015,84:672-681.
doi: 10.1111/tpj.13025 pmid: 26366992
[18] Xia K, Ou X, Tang H, Wang R, Wu P, Jia Y, Wei X, Xu X, Kang S H, Kim S K, Zhang M . Rice microRNA osa-miR1848 targets the obtusifoliol 14α-demethylase gene OsCYP51G3 and mediates the biosynthesis of phytosterols and brassinosteroids during development and in response to stress. New Phytol, 2015,208:790-802.
[19] Zhang S, Wu T, Liu S, Liu X, Jiang L, Wan J . Disruption of OsARF19 is critical for floral organ development and plant architecture in rice( Oryza sativa L.). Plant Mol Biol Rep, 2016,34:748-760.
doi: 10.1007/s11105-015-0962-y
[20] Horiguchi G, Ferjani A, Fujikura U, Tsukaya H . Coordination of cell proliferation and cell expansion in the control of leaf size in Arabidopsis thaliana. J Plant Res, 2006,119:37-42.
doi: 10.1007/s10265-005-0232-4 pmid: 16284709
[21] Horvath B M, Magyar Z, Zhang Y, Hamburger A W, Bako L, Visser R G, Bachem C W, Bogre L . EBP1 regulates organ size through cell growth and proliferation in plants. EMBO J, 2006,25:4909-4920.
[22] Ishimaru K, Hirotsu N, Madoka Y, Murakami N, Hara N, Onodera H, Kashiwagi T, Ujiie K, Shimizu B, Onishi A, Miyagawa H, Katoh E . Loss of function of the IAA-glucose hydrolase gene TGW6 enhances rice grain weight and increases yield. Nat Genet, 2013,45:707-718.
doi: 10.1038/ng.2612 pmid: 23583977
[23] Nakamura A, Matsuoka M . The role of OsBRI1 and its homologous genes, OsBRL1 and OsBRL3, in rice. Plant Physiol, 2006,140:580-590.
[24] Andrzej B . Metabolism of brassinosteroids in plants. Plant Physiol Biochem, 2007,45:95-107.
doi: 10.1016/j.plaphy.2007.01.002 pmid: 17346983
[25] Hong Z, Ueguchitanaka M, Shimizusato S, Inukai Y, Fujioka S, Shimada Y, Takatsuto S, Agetsuma M, Yoshida S, Watanabe Y, Uozu S, Kitano H, Ashikari M, Matsuoka M . Loss-of-function of a rice brassinosteroid biosynthetic enzyme, C-6 oxidase, prevents the organized arrangement and polar elongation of cells in the leaves and stem. Plant J, 2002,32:495-508.
doi: 10.1046/j.1365-313X.2002.01438.x
[26] Sakamoto T, Morinaka Y, Inukai Y, Kitano H, Fujioka S . Auxin signal transcription factor regulates expression of the brassinosteroid receptor gene in rice. Plant J, 2013,73:676-688.
doi: 10.1111/tpj.12071 pmid: 23146214
[27] Gui J, Zheng S, Liu C, Shen J, Li J, Li L . OsREM4.1 interacts with OsSERK1 to coordinate the interlinking between abscisic acid and brassinosteroid signaling in rice. Dev Cell, 2016,38:201-214.
doi: 10.1016/j.devcel.2016.06.011 pmid: 27424498
[28] Zhu X, Liang W, Cui X, Chen M, Yin C, Luo Z, Zhu J, Lucas W J, Wang Z, Zhang D . Brassinosteroids promote development of rice pollen grains and seeds by triggering expression of Carbon Starved Anther, a MYB domain protein. Plant J, 2015,82:570-581.
doi: 10.1111/tpj.12820 pmid: 25754973
[29] Bai M Y, Zhang L Y, Gampala S S, Zhu S W, Song W Y, Chong K, Wang Z Y . Functions of OsBZR1 and 14-3-3 proteins in brassinosteroid signaling in rice. Proc Natl Acad Sci USA, 2007,104:13839-13844.
doi: 10.1073/pnas.0706386104
[1] Ye Fan, Li Shuai, Li Si-Yu, Chen Yun, Dou Chao-Yin, Liu Li-Jun. Effects of water-saving irrigation on rice yield and population quality in Northeast China [J]. Acta Agronomica Sinica, 2026, 52(3): 895-907.
[2] YANG Si-Jie, DU Qi-Di, CHAI Shou-Xi, XIONG Hong-Chun, XIE Yong-Dun, ZHAO Lin-Shu, GU Jia-Yu, GUO Hui-Jun, LIU Lu-Xiang. Genetic mapping of mutant genes on flag leaf length and width in wheat [J]. Acta Agronomica Sinica, 2025, 51(6): 1548-1557.
[3] YUAN Xin, ZHAO Zhuo-Fan, ZHAO Rui-Qing, LIU Xiao-Wei, ZHENG Ming-Min, LIU Yu-Sheng, DONG Hao-Sheng, DENG Li-Juan, CAO Mo-Ju, HUANG Qiang. Genetic analysis and molecular identification of a small kernel mutant mn-like1 in maize [J]. Acta Agronomica Sinica, 2025, 51(6): 1569-1581.
[4] JIA Shu-Han, HE Can, CHEN Min, LIU Jia-Xin, HU Wei-Min, HU Jin, GUAN Ya-Jing. Study on the quality differences of seeds with different pre-harvest sprouting levels and the grading of pre-harvest sprouting in hybrid rice [J]. Acta Agronomica Sinica, 2024, 50(9): 2310-2322.
[5] SU Shuai, LIU Xiao-Wei, NIU Qun-Kai, SHI Zi-Wen, HOU Yu-Wei, FENG Kai-Jie, RONG Ting-Zhao, CAO Mo-Ju. Identification and gene cloning of leafy dwarf mutant lyd1 in maize [J]. Acta Agronomica Sinica, 2024, 50(5): 1124-1135.
[6] WAN Ying-Chun, BAN Yi-Jie, JIANG Yu-Dong, WANG Ya-Xin, LIU Jing-Jing, LIU Xiao-Qing, CHENG Yu-Lin, WANG Nan, FENG Ping. Phenotypic identification and fine mapping of male sterile mutant tpa1 in rice [J]. Acta Agronomica Sinica, 2024, 50(5): 1104-1114.
[7] YU Yao, WANG Zi-Yao, ZHOU Si-Rui, LIU Peng-Cheng, YE Ya-Feng, MA Bo-Jun, LIU Bin-Mei, CHEN Xi-Feng. Phenotypic identification and disease resistance mechanism analysis of rice lesion mutant lms1 [J]. Acta Agronomica Sinica, 2024, 50(4): 857-870.
[8] JIA Lu-Qi, SUN You, TIAN Ran, ZHANG Xue-Fei, DAI Yong-Dong, CUI Zhi-Bo, LI Yang-Yang, FENG Xin-Yu, SANG Xian-Chun, and WANG Xiao-Wen. Identification of the rgs1 mutant with rapid germination of seed and isolation of the regulated gene in rice [J]. Acta Agronomica Sinica, 2023, 49(8): 2288-2295.
[9] TANG Jie, LONG Tuan, WU Chun-Yu, LI Xin-Peng, ZENG Xiang, WU Yong-Zhong, HUANG Pei-Jin. Identification of OsGMS2 and construction of seed production system for genic male sterile line in rice [J]. Acta Agronomica Sinica, 2023, 49(8): 2025-2038.
[10] WANG Xing-Rong, ZHANG Yan-Jun, TU Qi-Qi, GONG Dian-Ming, QIU Fa-Zhan. Identification and gene localization of a novel maize nuclear male sterility mutant ms6 [J]. Acta Agronomica Sinica, 2023, 49(8): 2077-2087.
[11] LIN Xiao-Xin, HUANG Ming-Jiang, WEI Yi, ZHU Hong-Hui, WANG Zi-Yi, LI Zhong-Cheng, ZHUANG Hui, LI Yan-Xi, LI Yun-Feng, CHEN Rui. Identification and gene mapping of long grain and degenerated palea (lgdp) in rice (Oryza sativa L.) [J]. Acta Agronomica Sinica, 2023, 49(6): 1699-1707.
[12] DING Jie-Rong, MA Ya-Mei, PAN Fa-Zhi, JIANG Li-Qun, HUANG Wen-Jie, SUN Bing-Rui, ZHANG Jing, LYU Shu-Wei, MAO Xing-Xue, YU Hang, LI Chen, LIU Qing. Ubiquitin receptor protein OsDSK2b plays a negative role in rice leaf blast resistance and osmotic stress tolerance [J]. Acta Agronomica Sinica, 2023, 49(6): 1466-1479.
[13] DAI Wen-Hui, ZHU Qi, ZHANG Xiao-Fang, LYU Shen-Yang, XIANG Xian-Bo, MA Tao, CHEN Yu-Jie, ZHU Shi-Hua, DING Wo-Na. Identification and gene mapping of brittle culm mutant bc21 in rice [J]. Acta Agronomica Sinica, 2023, 49(5): 1426-1431.
[14] YAN Xin, XIANG Chao, LIU Rong, LI Guan, LI Meng-Wei, LI Zheng-Li, ZONG Xu-Xiao, YANG Tao. Fine mapping of flower colour gene in pea (Pisum sativum L.) based on BSA-seq technique [J]. Acta Agronomica Sinica, 2023, 49(4): 1006-1015.
[15] LI Qiu-Ping, ZHANG Chun-Long, YANG Hong, WANG Tuo, LI Juan, JIN Shou-Lin, HUANG Da-Jun, LI Dan-Dan, WEN Jian-Cheng. Physiological characteristics analysis and gene mapping of a semi-sterility plant mutant sfp10 in rice (Oryza sativa L.) [J]. Acta Agronomica Sinica, 2023, 49(3): 634-646.
Viewed
Full text


Abstract

Cited
  Shared   
  Discussed   
No Suggested Reading articles found!
Add: No. 80 Xueyuan South Rd, Beijing 100081, P. R. China E-mail: zwxb301@caas.cn
Supported by Beijing Magtech Co.Ltd