Welcome to Acta Agronomica Sinica，

Acta Agronomica Sinica ›› 2023, Vol. 49 ›› Issue (11): 3122-3130.doi: 10.3724/SP.J.1006.2023.23076

• RESEARCH NOTES • Previous Articles     Next Articles

Map-based cloning and transcriptomic analysis of a maize miniature kernel mutant mn-Mu

DING Meng-Li(), WANG Ru-Yin, SHI Dong-Sheng, LI Ying-Bo, LEI Jie, CHEN Hong-Yu, SHEN Qing-Wen(), WANG Gui-Feng   

  1. College of Agronomy, Henan Agricultural University / State Key Laboratory of Wheat and Maize Crops Science / CIMMYT-China (Henan) Joint Research Center of Wheat and Maize, Zhengzhou 450046, Henan, China
  • Received:2022-11-14 Accepted:2023-05-24 Online:2023-11-12 Published:2023-05-31
  • Supported by:
    National Natural Science Foundation of China(32001562);National Natural Science Foundation of China(U22A20466);Science and Technology Innovation Fund of Henan Agricultural University(KJCX2020A04)

RichHTML416

15

PDF

395

Abstract:

Kernel is the main storage organ, which accumulates nutritional compounds and determinates maize yield. In this study, we identified a miniature kernel mutant, mn-Mu, caused by a random mutator’s insertion. Compared with wild type, mn-Mu had smaller kernels, shrunken pericarp, and decreased significantly kernel weight. Compared with wild type, starch content of mn-Mu kernels decreased slightly, while zein content increased. Cytological observation showed that the development of the central endosperm and the basal endosperm transfer layer (BETL) was impaired in mn-Mu mutant compared with the wild type. Genetic analysis revealed that mn-Mu was a single gene-controlled recessive mutant. Map-based cloning indicated that the mutant gene was positioned in 57.83-61.91 Mb on chromosome 2. In this interval, Zm00001d003776 gene, which encoded CELL WALL INVERTASE 2 (INCW2, Miniature 1, Mn1) previously reported, was found that a 1442 bp transposon derived from Bronze 1 locus inserted into its 5th exon. Allelic test validated that mn-Mu was a new allelic mutant of mn1. Furthermore, transcriptomic analysis revealed that the loss of Mn1 affected gene expression in the processes of carbohydrate metabolism, storage material accumulation, glycosyltransferase activity, cell wall biosynthesis, and cell cycle regulation. In conclusion, a new allelic mutant of maize Mn1 (mn-Mu) was identified and transcriptomic analysis was further performed, which providing a novel maize germplasm and clues toward comprehensive understanding of molecular regulation mechanism of Mn1 on kernel development.

Key words: maize, kernel development, mn-Mu, gene mapping, cell wall invertase, transcriptomic analysis

Table 1

Primers for gene mapping and Mn1 gene amplification in this study"

引物名称
Primer name		 正向引物
Forward sequence (5'-3')		 反向引物
Reverse sequence (5'-3')
Indel-26.11 ACTTGCCTGCTGCGACTGG TCCTGCCCGTCCCGACAG
Indel-34.89 TCGTGGCTGGCTGGAGTG CGGGAAATCGGGTTGTTGATTG
Indel-43.19 TGGTAGGCAGGGCGTTGG TGTCCGTGTAGACTGTAGGAAC
Indel-53.27 GGGAGAGCATCGACAGATACTG GACAATGACTTCGTACCTTCGG
Indel-55.89 GCCGCACACACCCTATGAAG AGCGTGCATGTATCTGGAAGTG
Indel-57.83 GCAATCCCCTTGTCCTGAAAAG CTTCCAACGCAGCAGCAATG
Indel-61.91 AGGTCAACCATCGAATCGAAGC ATCTGCATGGTTCAGAGTCTCC
Indel-83.16 TCCATCTATGGGGAGCGAGTAC GCAGTCCGTGACGACAACC
PDC1R/2F GCAACGGTGCAAGTGAACAA GCGGTACGACTACTACACCG
PDC1F/2R GTCGTAAGTTTCGCTTCGGC TCGTAGAACGTCTTGGACGC

Fig. 1

Phenotypic features of maize mn-Mu kernels A: the typical self-cross mature ear of F1 plant; B-C: the comparison of kernel length (B) and kernel width (C) of the wild type (the upper row) and mn-Mu (the lower row) kernels; D: phenotype of the wild type (the left one) and mn-Mu (the right one) kernels; E: the longitudinal-sectional view of of the wild type (left) and mn-Mu (right) kernels; F: the comparison of 100-kernel weight of randomly selected mature wild type and mn-Mu kernels in the segregated ears. Values are means ±SDs. (**: P< 0.01, Student’s t-test). Bar: 1 cm."

Table 2

Segregation ratio of wild-type and mutant kernels in F2 ears"

果穗
Ear		 正常籽粒数
Wild type		 突变籽粒数
Mutant		 χ2
1 330 89 2.9602
2 295 100 0.0076
3 297 92 0.3093
总计 Total 922 281 1.6428

Fig. 2

Histological observation of mn-Mu mutant kernels A-B: the longitudinal paraffin sections observation of developing wild-type (A) and mn-Mu mutant (B) kernels, Bar: 1 mm; C-D: the embryos of the wild-type (C) and mn-Mu mutant (D) kernels, Bar: 1 mm (C) and 500 μm (D); E-F: the basal endosperm transfer layer of the wild-type (E) and mn-Mu mutant (F) kernels, Bar: 200 μm. Samples were collected at 18 days after pollination."

Fig. 3

Biochemical component of mn-Mu mutant A: starch contents of the wild type and mn-Mu mutant kernels; B-C: zein (B) and non-zein (C) accumulation pattern of wild type and mn-Mu mutant kernels by 15% SDS-PAGE. M: marker; WT: wild type; Re1/Re2/Re3 represent three biological replicants."

Fig. 4

Map-based cloning of mn-Mu gene in maize A: gene mapping of mn-Mu. n: the number of individuals for gene mapping, the number under each InDel marker indicates recombinants in the population. B: schematic diagram of Mn1 gene with the indicated mutator insertion site in mn-Mu by a triangle. C: PCR amplification of Mn1 gene using genomic DNA to detect the mutator insertion in mn-Mu mutant. M: marker; WT: wild type; Z58: the inbred line Zheng 58 as a control."

Fig. 5

Allelism test between mn-Mu and mn1 A-B: the self-pollinated ears of the reciprocally crossed ears between heterozygous mn-Mu and mn1segregate defective kernels at a ratio of 25%. Bar: 1 cm."

Fig. 6

Transcriptome of mn-Mu mutant A: the volcano plot for differentially expressed genes (DEGs) (Fold change > 2 and adjusted P-value < 0.05) between the wild type and mn-Mu mutant; B: significant KEGG pathways in DEGs; C: significant GO terms in DEGs."

[1] 赵久然, 王帅, 李明, 吕慧颖, 王道文, 葛毅强, 魏珣, 杨维才. 玉米育种行业创新现状与发展趋势. 植物遗传资源学报, 2018, 19: 435-446.
doi: 10.13430/j.cnki.jpgr.2018.03.008
Zhao J R, Wang S, Li M, Lyu H Y, Wang D W, Ge Y Q, Wei X, Yang W C. Current status and perspective of maize breeding. J Plant Genet Resour, 2018, 19: 435-446 (in Chinese with English abstract).
[2] Wu H, Becraft P W, Dannenhoffer J M. Maize endosperm development: tissues, cells, molecular regulation and grain quality improvement. Front Plant Sci, 2022, 13: 852082.
doi: 10.3389/fpls.2022.852082
[3] Sabelli P A, Larkins B A. The development of endosperm in grasses. Plant Physiol, 2009, 149: 14-26.
doi: 10.1104/pp.108.129437 pmid: 19126691
[4] Li X J, Zhang Y F, Hou M, Sun F, Shen Y, Xiu Z H, Wang X, Chen Z L, Sun S S, Small I, Tan B C. Small kernel 1 encodes a pentatricopeptide repeat protein required for mitochondrial nad7 transcript editing and seed development in maize (Zea mays) and rice (Oryza sativa). Plant J, 2014, 79: 797-809.
doi: 10.1111/tpj.2014.79.issue-5
[5] Yang Y Z, Ding S, Wang Y, Li C L, Shen Y, Meeley R, McCarty D R, Tan B C. Small kernel2 encodes a glutaminase in Vitamin B(6) biosynthesis essential for maize seed development. Plant Physiol, 2017, 174: 1127-1138.
doi: 10.1104/pp.16.01295 pmid: 28408540
[6] Pan Z Y, Ren X M, Zhao H L, Liu L, Tan Z D, Qiu F Z. A mitochondrial transcription termination factor, ZmSmk3, is required for nad1 intron4 and nad4 intron1 splicing and kernel development in maize. Genes Genet Genomic, 2019, 9: 2677-2686.
[7] Wang H C, Sayyed A, Liu X Y, Yang Y Z, Sun F, Wang Y, Wang M, Tan B C. SMALL KERNEL4 is required for mitochondrial cox1 transcript editing and seed development in maize. J Integr Plant Biol, 2020, 62: 777-792.
doi: 10.1111/jipb.v62.6
[8] Ding S, Liu X Y, Wang H C, Wang Y, Tang J J, Yang Y Z, Tan B C. SMK6 mediates the C-to-U editing at multiple sites in maize mitochondria. J Plant Physiol, 2019, 240: 152992.
doi: 10.1016/j.jplph.2019.152992
[9] Zhao H L, Qin Y, Xiao Z Y, Li Q, Yang N, Pan Z Y, Gong D M, Sun Q, Yang F, Zhang Z X, Wu Y R, Xu C, Qiu F Z. Loss of function of an RNA polymerase III subunit leads to impaired maize kernel development. Plant Physiol, 2020, 184: 359-373.
doi: 10.1104/pp.20.00502 pmid: 32591429
[10] Pan Z Y, Liu M, Xiao Z Y, Ren X M, Zhao H L, Gong D M, Liang K, Tan Z D, Shao Y Q, Qiu F Z. ZmSMK9, a pentatricopeptide repeat protein, is involved in the cis-splicing of nad5, kernel development and plant architecture in maize. Plant Sci, 2019, 288: 110205.
doi: 10.1016/j.plantsci.2019.110205
[11] Lowe J, Nelson O E. Miniature seed: a study in the development of a defective caryopsis in maize. Genetics, 1946, 31: 525-533.
doi: 10.1093/genetics/31.5.525 pmid: 17247216
[12] Dai D W, Ma Z Y, Song R T. Maize endosperm development. J Integr Plant Biol, 2021, 63: 613-627.
doi: 10.1111/jipb.13069
[13] Cheng W H, Taliercio E W, Chourey P S. The Miniature1 seed locus of maize encodes a cell wall invertase required for normal development of endosperm and maternal cells in the pedicel. Plant Cell, 1996, 8: 971-983.
doi: 10.2307/3870209
[14] Chourey P S, Jain M, Li Q B, Carlson S J. Genetic control of cell wall invertases in developing endosperm of maize. Planta, 2006, 223: 159-167.
doi: 10.1007/s00425-005-0039-5 pmid: 16025339
[15] Yi F, Gu W, Li J F, Chen J, Hu L, Cui Y, Zhao H M, Guo Y, Lai J S, Song W B. Miniature Seed6, encoding an endoplasmic reticulum signal peptidase, is critical in seed development. Plant Physiol, 2021, 185: 985-1001.
doi: 10.1093/plphys/kiaa060
[16] Miller M E, Chourey P S. The maize invertase-deficient miniature-1 seed mutation is associated with aberrant pedicel and endosperm development. Plant Cell, 1992, 4: 297-305.
doi: 10.2307/3869541
[17] Vilhar B, Kladnik A, Blejec A, Chourey P S, Dermastia M. Cytometrical evidence that the loss of seed weight in the miniature1seed mutant of maize is associated with reduced mitotic activity in the developing endosperm. Plant Physiol, 2002, 129: 23-30.
[18] LeClere S, Schmelz E A, Chourey P S. Cell wall invertase-deficient miniature1 kernels have altered phytohormone levels. Phytochemistry, 2008, 69: 692-699.
doi: 10.1016/j.phytochem.2007.09.011 pmid: 17964617
[19] Chourey P S, Li Q B, Kumar D. Sugar-hormone cross-talk in seed development: two redundant pathways of IAA biosynthesis are regulated differentially in the invertase-deficient miniature1 (mn1) seed mutant in maize. Mol Plant, 2010, 3: 1026-1036.
doi: 10.1093/mp/ssq057 pmid: 20924026
[20] Doll N M, Depège-Fargeix N, Rogowsky P M, Widiez T. Signaling in early maize kernel development. Mol Plant, 2017, 10: 375-388.
doi: S1674-2052(17)30009-6 pmid: 28267956
[21] Rijavec T, Kovac M, Kladnik A, Chourey P S, Dermastia M. A comparative study on the role of cytokinins in caryopsis development in the maize miniature1 seed mutant and its wild type. J Integr Plant Biol, 2009, 51: 840-849.
doi: 10.1111/jipb.2009.51.issue-9
[22] Chourey P S, Li Q B, Cevallos-Cevallos J. Pleiotropy and its dissection through a metabolic gene Miniature1 (Mn1) that encodes a cell wall invertase in developing seeds of maize. Plant Sci, 2012, 184: 45-53.
doi: 10.1016/j.plantsci.2011.12.011 pmid: 22284709
[23] Le C S, Schmelz E A, Chourey P S. Sugar levels regulate tryptophan-dependent auxin biosynthesis in developing maize kernels. Plant Physiol, 2010, 153: 306-318.
doi: 10.1104/pp.110.155226 pmid: 20237017
[24] Li B, Liu H, Zhang Y, Kang T, Zhang L, Tong J H, Xiao L T, Zhang H X. Constitutive expression of cell wall invertase genes increases grain yield and starch content in maize. Plant Biotechnol J, 2013, 11: 1080-1091.
doi: 10.1111/pbi.12102 pmid: 23926950
[25] Tian Q Z, Wang G, Ma X X, Shen Q W, Ding M L, Yang X Y, Luo X L, Li R R, Wang Z H, Wang X Y, Fu Z Y, Yang Q H, Tang J H, Wang G F. Riboflavin integrates cellular energetics and cell cycle to regulate maize seed development. Plant Biotechnol J, 2022, 20: 1487-1501.
doi: 10.1111/pbi.v20.8
[26] Li C B, Song R T. The regulation of zein biosynthesis in maize endosperm. Theor Appl Genet, 2020, 133: 1443-1453.
doi: 10.1007/s00122-019-03520-z pmid: 31897513
[27] Carlson S J, Shanker S, Chourey P S. A point mutation at the Miniature1seed locus reduces levels of the encoded protein, but not its mRNA, in maize. Mol Gene Genet, 2000, 263: 367-373.
[28] Kang B H, Xiong Y, Williams D S, Pozueta-Romero D, Chourey P S. Miniature1-encoded cell wall invertase is essential for assembly and function of wall-in-growth in the maize endosperm transfer cell. Plant Physiol, 2009, 151: 1366-1376.
doi: 10.1104/pp.109.142331
[29] Silva-Sanchez C, Chen S X, Li J X, Chourey P S. A comparative glycoproteome study of developing endosperm in the hexose-deficient miniature1 (mn1) seed mutant and its wild type Mn1 in maize. Front Plant Sci, 2014, 5: 63.
doi: 10.3389/fpls.2014.00063 pmid: 24616729
[30] Taliercio E, Kim J Y, Mahé A, Shanker S, Choi J, Cheng W H, Prioul J L, Chourey P. Isolation, characterization and expression analyses of two cell wall invertase genes in maize. J Plant Physiol, 1999, 155: 197-204.
doi: 10.1016/S0176-1617(99)80007-8
[31] Cheng W H, Chourey P S. Genetic evidence that invertase-mediated release of hexoses is critical for appropriate carbon partitioning and normal seed development in maize. Theor Appl Genet, 1999, 98: 485-495.
doi: 10.1007/s001220051096
[32] Liao S J, Wang L, Li J, Ruan Y L. Cell wall invertase is essential for ovule development through sugar signaling rather than provision of carbon nutrients. Plant Physiol, 2020, 183: 1126-1144.
doi: 10.1104/pp.20.00400 pmid: 32332089
[33] Silva-Sanchez C, Chen S, Zhu N, Li Q B, Chourey P S. Proteomic comparison of basal endosperm in maize miniature1 mutant and its wild-type Mn1. Front Plant Sci, 2013, 4: 211.
doi: 10.3389/fpls.2013.00211 pmid: 23805148
[34] Weber H, Borisjuk L, Wobus U. Molecular physiology of legume seed development. Annu Rev Plant Biol, 2005, 56: 253-279.
pmid: 15862096
[35] Thompson R D, Hueros G, Becker H, Maitz M. Development and functions of seed transfer cells. Plant Sci, 2001, 160: 775-783.
pmid: 11297774
[36] Zheng Y, Wang Z. Current opinions on endosperm transfer cells in maize. Plant Cell Rep, 2010, 29: 935-942.
doi: 10.1007/s00299-010-0891-z pmid: 20585949
[37] Bergareche D, Royo J, Muñiz L M, Hueros G. Cell wall invertase activity regulates the expression of the transfer cell-specific transcription factor ZmMRP-1. Planta, 2018, 247: 429-442.
doi: 10.1007/s00425-017-2800-y pmid: 29071379
[38] Wang E T, Wang J J, Zhu X D, Hao W, Wang L Y, Li Q, Zhang L X, He W, Lu B R, Lin H X, Ma H, Zhang G Q, He Z H. Control of rice grain-filling and yield by a gene with a potential signature of domestication. Nat Genet, 2008, 40: 1370-1374.
doi: 10.1038/ng.220 pmid: 18820698
[39] Zanor M I, Osorio S, Nunes-Nesi A, Carrari F, Lohse M, Usadel B, Kühn C, Bleiss W, Giavalisco P, Willmitzer L, Sulpice R, Zhou Y H, Fernie A R. RNA interference of LIN5 in tomato confirms its role in controlling Brix content, uncovers the influence of sugars on the levels of fruit hormones, and demonstrates the importance of sucrose cleavage for normal fruit development and fertility. Plant Physiol, 2009, 150: 1204-1218.
doi: 10.1104/pp.109.136598
[40] Jin Y, Ni D A, Ruan Y L. Posttranslational elevation of cell wall invertase activity by silencing its inhibitor in tomato delays leaf senescence and increases seed weight and fruit hexose level. Plant Cell, 2009, 21: 2072-2089.
doi: 10.1105/tpc.108.063719 pmid: 19574437
[41] Li J, Foster R, Ma S, Liao S J, Bliss S, Kartika D, Wang L, Wu L M, Eamens A L, Ruan Y L. Identification of transcription factors controlling cell wall invertase gene expression for reproductive development via bioinformatic and transgenic analyses. Plant J, 2021, 106: 1058-1074.
doi: 10.1111/tpj.v106.4
[42] Zha K Y, Xie H X, Ge M, Wang Z M, Wang Y, Si W N, Gu L J. Expression of maize MADS transcription factor ZmES22 negatively modulates starch accumulation in rice endosperm. Int J Mol Sci, 2019, 20: 483.
doi: 10.3390/ijms20030483
[1] AI Rong, ZHANG Chun, YUE Man-Fang, ZOU Hua-Wen, WU Zhong-Yi. Response of maize transcriptional factor ZmEREB211 to abiotic stress [J]. Acta Agronomica Sinica, 2023, 49(9): 2433-2445.
[2] HUANG Yu-Jie, ZHANG Xiao-Tian, CHEN Hui-Li, WANG Hong-Wei, DING Shuang-Cheng. Identification of ZmC2s gene family and functional analysis of ZmC2-15 under heat tolerance in maize [J]. Acta Agronomica Sinica, 2023, 49(9): 2331-2343.
[3] YANG Wen-Yu, WU Cheng-Xiu, XIAO Ying-Jie, YAN Jian-Bing. ALGWAS: two-stage Adaptive Lasso-based genome-wide association study [J]. Acta Agronomica Sinica, 2023, 49(9): 2321-2330.
[4] TANG Jie, LONG Tuan, WU Chun-Yu, LI Xin-Peng, ZENG Xiang, WU Yong-Zhong, HUANG Pei-Jin. Identification of OsGMS2 and construction of seed production system for genic male sterile line in rice [J]. Acta Agronomica Sinica, 2023, 49(8): 2025-2038.
[5] BAI Yan, GAO Ting-Ting, LU Shi, ZHENG Shu-Bo, LU Ming. A retrospective analysis of the historical evolution and developing trend of maize mega varieties in China from 1982 to 2020 [J]. Acta Agronomica Sinica, 2023, 49(8): 2064-2076.
[6] WANG Xing-Rong, ZHANG Yan-Jun, TU Qi-Qi, GONG Dian-Ming, QIU Fa-Zhan. Identification and gene localization of a novel maize nuclear male sterility mutant ms6 [J]. Acta Agronomica Sinica, 2023, 49(8): 2077-2087.
[7] WANG Juan, XU Xiang-Bo, ZHANG Mao-Lin, LIU Tie-Shan, XU Qian, DONG Rui, LIU Chun-Xiao, GUAN Hai-Ying, LIU Qiang, WANG Li-Ming, HE Chun-Mei. Characterization and genetic analysis of a new allelic mutant of Miniature1 gene in maize [J]. Acta Agronomica Sinica, 2023, 49(8): 2088-2096.
[8] WEI Jin-Gui, GUO Yao, CHAI Qiang, YIN Wen, FAN Zhi-Long, HU Fa-Long. Yield and yield components of maize response to high plant density under reduced water and nitrogen supply [J]. Acta Agronomica Sinica, 2023, 49(7): 1919-1929.
[9] LI Rong, MIAN You-Ming, HOU Xian-Qing, LI Pei-Fu, WANG Xi-Na. Effects of nitrogen application on decomposition and nutrient release of returning straw, soil fertility, and maize yield [J]. Acta Agronomica Sinica, 2023, 49(7): 2012-2022.
[10] MEI Xiu-Peng, ZHAO Zi-Kun, JIA Xin-Yao, BAI Yang, LI Mei, GAN Yu-Ling, YANG Qiu-Yue, CAI Yi-Lin. Heat-inducible transcription factor ZmNF-YC13 regulates heat stress response genes to improve heat tolerance in maize [J]. Acta Agronomica Sinica, 2023, 49(7): 1747-1757.
[11] CHANG Li-Juan, LIANG Jing-Gang, SONG Jun, LIU Wen-Juan, FU Cheng-Ping, DAI Xiao-Hang, WANG Dong, WEI Chao, XIONG Mei. Event-specific PCR detection method of transgenic maize ND207 and its standardization [J]. Acta Agronomica Sinica, 2023, 49(7): 1818-1828.
[12] LIN Xiao-Xin, HUANG Ming-Jiang, WEI Yi, ZHU Hong-Hui, WANG Zi-Yi, LI Zhong-Cheng, ZHUANG Hui, LI Yan-Xi, LI Yun-Feng, CHEN Rui. Identification and gene mapping of long grain and degenerated palea (lgdp) in rice (Oryza sativa L.) [J]. Acta Agronomica Sinica, 2023, 49(6): 1699-1707.
[13] ZHANG Zhen-Bo, JIA Chun-Lan, REN Bai-Zhao, LIU Peng, ZHAO Bin, ZHANG Ji-Wang. Effects of combined application of nitrogen and phosphorus on yield and leaf senescence physiological characteristics in summer maize [J]. Acta Agronomica Sinica, 2023, 49(6): 1616-1629.
[14] LI Lu-Lu, MING Bo, GAO Shang, XIE Rui-Zhi, WANG Ke-Ru, HOU Peng, XUE Jun, LI Shao-Kun. Characteristic difference in grain in-field drydown between maize cultivars with various maturation [J]. Acta Agronomica Sinica, 2023, 49(6): 1643-1652.
[15] WANG Yu-Long, YU Ai-Zhong, LYU Han-Qiang, LYU Yi-Tong, SU Xiang-Xiang, WANG Peng-Fei, CHAI Jian. Effects of green manure replanting and returning after wheat on following year’s maize root traits and water use efficiency in oasis irrigation area [J]. Acta Agronomica Sinica, 2023, 49(5): 1350-1362.
Viewed
Full text


Abstract

Cited
  Shared   
  Discussed   
[1] Li Shaoqing, Li Yangsheng, Wu Fushun, Liao Jianglin, Li Damo. Optimum Fertilization and Its Corresponding Mechanism under Complete Submergence at Booting Stage in Rice[J]. Acta Agronomica Sinica, 2002, 28(01): 115 -120 .
[2] YANG Jian-Chang;ZHANG Jian-Hua;WANG Zhi-Qin;ZH0U Qing-Sen. Changes in Contents of Polyamines in the Flag Leaf and Their Relationship with Drought-resistance of Rice Cultivars under Water Deficiency Stress[J]. Acta Agron Sin, 2004, 30(11): 1069 -1075 .
[3] Yan Mei;Yang Guangsheng;Fu Tingdong;Yan Hongyan. Studies on the Ecotypical Male Sterile-fertile Line of Brassica napus L.Ⅲ. Sensitivity to Temperature of 8-8112AB and Its Inheritance[J]. Acta Agron Sin, 2003, 29(03): 330 -335 .
[4] Wang Yongsheng;Wang Jing;Duan Jingya;Wang Jinfa;Liu Liangshi. Isolation and Genetic Research of a Dwarf Tiilering Mutant Rice[J]. Acta Agron Sin, 2002, 28(02): 235 -239 .
[5] WANG Li-Yan;ZHAO Ke-Fu. Some Physiological Response of Zea mays under Salt-stress[J]. Acta Agron Sin, 2005, 31(02): 264 -268 .
[6] TIAN Meng-Liang;HUNAG Yu-Bi;TAN Gong-Xie;LIU Yong-Jian;RONG Ting-Zhao. Sequence Polymorphism of waxy Genes in Landraces of Waxy Maize from Southwest China[J]. Acta Agron Sin, 2008, 34(05): 729 -736 .
[7] HU Xi-Yuan;LI Jian-Ping;SONG Xi-Fang. Efficiency of Spatial Statistical Analysis in Superior Genotype Selection of Plant Breeding[J]. Acta Agron Sin, 2008, 34(03): 412 -417 .
[8] WANG Yan;QIU Li-Ming;XIE Wen-Juan;HUANG Wei;YE Feng;ZHANG Fu-Chun;MA Ji. Cold Tolerance of Transgenic Tobacco Carrying Gene Encoding Insect Antifreeze Protein[J]. Acta Agron Sin, 2008, 34(03): 397 -402 .
[9] ZHENG Xi;WU Jian-Guo;LOU Xiang-Yang;XU Hai-Ming;SHI Chun-Hai. Mapping and Analysis of QTLs on Maternal and Endosperm Genomes for Histidine and Arginine in Rice (Oryza sativa L.) across Environments[J]. Acta Agron Sin, 2008, 34(03): 369 -375 .
[10] XING Guang-Nan, ZHOU Bin, ZHAO Tuan-Jie, YU De-Yue, XING Han, HEN Shou-Yi, GAI Jun-Yi. Mapping QTLs of Resistance to Megacota cribraria (Fabricius) in Soybean[J]. Acta Agronomica Sinica, 2008, 34(03): 361 -368 .
Add: No. 80 Xueyuan South Rd, Beijing 100081, P. R. China E-mail: zwxb301@caas.cn
Supported by Beijing Magtech Co.Ltd