Welcome to Acta Agronomica Sinica，

Acta Agronomica Sinica ›› 2023, Vol. 49 ›› Issue (11): 3122-3130.doi: 10.3724/SP.J.1006.2023.23076

;

• RESEARCH NOTES • Previous Articles     Next Articles

Map-based cloning and transcriptomic analysis of a maize miniature kernel mutant mn-Mu

DING Meng-Li(), WANG Ru-Yin, SHI Dong-Sheng, LI Ying-Bo, LEI Jie, CHEN Hong-Yu, SHEN Qing-Wen(), WANG Gui-Feng   

  1. College of Agronomy, Henan Agricultural University / State Key Laboratory of Wheat and Maize Crops Science / CIMMYT-China (Henan) Joint Research Center of Wheat and Maize, Zhengzhou 450046, Henan, China
  • Received:2022-11-14 Accepted:2023-05-24 Online:2023-11-12 Published:2023-05-31
  • Supported by:
    National Natural Science Foundation of China(32001562);National Natural Science Foundation of China(U22A20466);Science and Technology Innovation Fund of Henan Agricultural University(KJCX2020A04)

RichHTML416

32

PDF

829

Abstract:

Kernel is the main storage organ, which accumulates nutritional compounds and determinates maize yield. In this study, we identified a miniature kernel mutant, mn-Mu, caused by a random mutator’s insertion. Compared with wild type, mn-Mu had smaller kernels, shrunken pericarp, and decreased significantly kernel weight. Compared with wild type, starch content of mn-Mu kernels decreased slightly, while zein content increased. Cytological observation showed that the development of the central endosperm and the basal endosperm transfer layer (BETL) was impaired in mn-Mu mutant compared with the wild type. Genetic analysis revealed that mn-Mu was a single gene-controlled recessive mutant. Map-based cloning indicated that the mutant gene was positioned in 57.83-61.91 Mb on chromosome 2. In this interval, Zm00001d003776 gene, which encoded CELL WALL INVERTASE 2 (INCW2, Miniature 1, Mn1) previously reported, was found that a 1442 bp transposon derived from Bronze 1 locus inserted into its 5th exon. Allelic test validated that mn-Mu was a new allelic mutant of mn1. Furthermore, transcriptomic analysis revealed that the loss of Mn1 affected gene expression in the processes of carbohydrate metabolism, storage material accumulation, glycosyltransferase activity, cell wall biosynthesis, and cell cycle regulation. In conclusion, a new allelic mutant of maize Mn1 (mn-Mu) was identified and transcriptomic analysis was further performed, which providing a novel maize germplasm and clues toward comprehensive understanding of molecular regulation mechanism of Mn1 on kernel development.

Key words: maize, kernel development, mn-Mu, gene mapping, cell wall invertase, transcriptomic analysis

Table 1

Primers for gene mapping and Mn1 gene amplification in this study"

引物名称
Primer name		 正向引物
Forward sequence (5'-3')		 反向引物
Reverse sequence (5'-3')
Indel-26.11 ACTTGCCTGCTGCGACTGG TCCTGCCCGTCCCGACAG
Indel-34.89 TCGTGGCTGGCTGGAGTG CGGGAAATCGGGTTGTTGATTG
Indel-43.19 TGGTAGGCAGGGCGTTGG TGTCCGTGTAGACTGTAGGAAC
Indel-53.27 GGGAGAGCATCGACAGATACTG GACAATGACTTCGTACCTTCGG
Indel-55.89 GCCGCACACACCCTATGAAG AGCGTGCATGTATCTGGAAGTG
Indel-57.83 GCAATCCCCTTGTCCTGAAAAG CTTCCAACGCAGCAGCAATG
Indel-61.91 AGGTCAACCATCGAATCGAAGC ATCTGCATGGTTCAGAGTCTCC
Indel-83.16 TCCATCTATGGGGAGCGAGTAC GCAGTCCGTGACGACAACC
PDC1R/2F GCAACGGTGCAAGTGAACAA GCGGTACGACTACTACACCG
PDC1F/2R GTCGTAAGTTTCGCTTCGGC TCGTAGAACGTCTTGGACGC

Fig. 1

Phenotypic features of maize mn-Mu kernels A: the typical self-cross mature ear of F1 plant; B-C: the comparison of kernel length (B) and kernel width (C) of the wild type (the upper row) and mn-Mu (the lower row) kernels; D: phenotype of the wild type (the left one) and mn-Mu (the right one) kernels; E: the longitudinal-sectional view of of the wild type (left) and mn-Mu (right) kernels; F: the comparison of 100-kernel weight of randomly selected mature wild type and mn-Mu kernels in the segregated ears. Values are means ±SDs. (**: P< 0.01, Student’s t-test). Bar: 1 cm."

Table 2

Segregation ratio of wild-type and mutant kernels in F2 ears"

果穗
Ear		 正常籽粒数
Wild type		 突变籽粒数
Mutant		 χ2
1 330 89 2.9602
2 295 100 0.0076
3 297 92 0.3093
总计 Total 922 281 1.6428

Fig. 2

Histological observation of mn-Mu mutant kernels A-B: the longitudinal paraffin sections observation of developing wild-type (A) and mn-Mu mutant (B) kernels, Bar: 1 mm; C-D: the embryos of the wild-type (C) and mn-Mu mutant (D) kernels, Bar: 1 mm (C) and 500 μm (D); E-F: the basal endosperm transfer layer of the wild-type (E) and mn-Mu mutant (F) kernels, Bar: 200 μm. Samples were collected at 18 days after pollination."

Fig. 3

Biochemical component of mn-Mu mutant A: starch contents of the wild type and mn-Mu mutant kernels; B-C: zein (B) and non-zein (C) accumulation pattern of wild type and mn-Mu mutant kernels by 15% SDS-PAGE. M: marker; WT: wild type; Re1/Re2/Re3 represent three biological replicants."

Fig. 4

Map-based cloning of mn-Mu gene in maize A: gene mapping of mn-Mu. n: the number of individuals for gene mapping, the number under each InDel marker indicates recombinants in the population. B: schematic diagram of Mn1 gene with the indicated mutator insertion site in mn-Mu by a triangle. C: PCR amplification of Mn1 gene using genomic DNA to detect the mutator insertion in mn-Mu mutant. M: marker; WT: wild type; Z58: the inbred line Zheng 58 as a control."

Fig. 5

Allelism test between mn-Mu and mn1 A-B: the self-pollinated ears of the reciprocally crossed ears between heterozygous mn-Mu and mn1segregate defective kernels at a ratio of 25%. Bar: 1 cm."

Fig. 6

Transcriptome of mn-Mu mutant A: the volcano plot for differentially expressed genes (DEGs) (Fold change > 2 and adjusted P-value < 0.05) between the wild type and mn-Mu mutant; B: significant KEGG pathways in DEGs; C: significant GO terms in DEGs."

[1] 赵久然, 王帅, 李明, 吕慧颖, 王道文, 葛毅强, 魏珣, 杨维才. 玉米育种行业创新现状与发展趋势. 植物遗传资源学报, 2018, 19: 435-446.
doi: 10.13430/j.cnki.jpgr.2018.03.008
Zhao J R, Wang S, Li M, Lyu H Y, Wang D W, Ge Y Q, Wei X, Yang W C. Current status and perspective of maize breeding. J Plant Genet Resour, 2018, 19: 435-446 (in Chinese with English abstract).
[2] Wu H, Becraft P W, Dannenhoffer J M. Maize endosperm development: tissues, cells, molecular regulation and grain quality improvement. Front Plant Sci, 2022, 13: 852082.
doi: 10.3389/fpls.2022.852082
[3] Sabelli P A, Larkins B A. The development of endosperm in grasses. Plant Physiol, 2009, 149: 14-26.
doi: 10.1104/pp.108.129437 pmid: 19126691
[4] Li X J, Zhang Y F, Hou M, Sun F, Shen Y, Xiu Z H, Wang X, Chen Z L, Sun S S, Small I, Tan B C. Small kernel 1 encodes a pentatricopeptide repeat protein required for mitochondrial nad7 transcript editing and seed development in maize (Zea mays) and rice (Oryza sativa). Plant J, 2014, 79: 797-809.
doi: 10.1111/tpj.2014.79.issue-5
[5] Yang Y Z, Ding S, Wang Y, Li C L, Shen Y, Meeley R, McCarty D R, Tan B C. Small kernel2 encodes a glutaminase in Vitamin B(6) biosynthesis essential for maize seed development. Plant Physiol, 2017, 174: 1127-1138.
doi: 10.1104/pp.16.01295 pmid: 28408540
[6] Pan Z Y, Ren X M, Zhao H L, Liu L, Tan Z D, Qiu F Z. A mitochondrial transcription termination factor, ZmSmk3, is required for nad1 intron4 and nad4 intron1 splicing and kernel development in maize. Genes Genet Genomic, 2019, 9: 2677-2686.
[7] Wang H C, Sayyed A, Liu X Y, Yang Y Z, Sun F, Wang Y, Wang M, Tan B C. SMALL KERNEL4 is required for mitochondrial cox1 transcript editing and seed development in maize. J Integr Plant Biol, 2020, 62: 777-792.
doi: 10.1111/jipb.v62.6
[8] Ding S, Liu X Y, Wang H C, Wang Y, Tang J J, Yang Y Z, Tan B C. SMK6 mediates the C-to-U editing at multiple sites in maize mitochondria. J Plant Physiol, 2019, 240: 152992.
doi: 10.1016/j.jplph.2019.152992
[9] Zhao H L, Qin Y, Xiao Z Y, Li Q, Yang N, Pan Z Y, Gong D M, Sun Q, Yang F, Zhang Z X, Wu Y R, Xu C, Qiu F Z. Loss of function of an RNA polymerase III subunit leads to impaired maize kernel development. Plant Physiol, 2020, 184: 359-373.
doi: 10.1104/pp.20.00502 pmid: 32591429
[10] Pan Z Y, Liu M, Xiao Z Y, Ren X M, Zhao H L, Gong D M, Liang K, Tan Z D, Shao Y Q, Qiu F Z. ZmSMK9, a pentatricopeptide repeat protein, is involved in the cis-splicing of nad5, kernel development and plant architecture in maize. Plant Sci, 2019, 288: 110205.
doi: 10.1016/j.plantsci.2019.110205
[11] Lowe J, Nelson O E. Miniature seed: a study in the development of a defective caryopsis in maize. Genetics, 1946, 31: 525-533.
doi: 10.1093/genetics/31.5.525 pmid: 17247216
[12] Dai D W, Ma Z Y, Song R T. Maize endosperm development. J Integr Plant Biol, 2021, 63: 613-627.
doi: 10.1111/jipb.13069
[13] Cheng W H, Taliercio E W, Chourey P S. The Miniature1 seed locus of maize encodes a cell wall invertase required for normal development of endosperm and maternal cells in the pedicel. Plant Cell, 1996, 8: 971-983.
doi: 10.2307/3870209
[14] Chourey P S, Jain M, Li Q B, Carlson S J. Genetic control of cell wall invertases in developing endosperm of maize. Planta, 2006, 223: 159-167.
doi: 10.1007/s00425-005-0039-5 pmid: 16025339
[15] Yi F, Gu W, Li J F, Chen J, Hu L, Cui Y, Zhao H M, Guo Y, Lai J S, Song W B. Miniature Seed6, encoding an endoplasmic reticulum signal peptidase, is critical in seed development. Plant Physiol, 2021, 185: 985-1001.
doi: 10.1093/plphys/kiaa060
[16] Miller M E, Chourey P S. The maize invertase-deficient miniature-1 seed mutation is associated with aberrant pedicel and endosperm development. Plant Cell, 1992, 4: 297-305.
doi: 10.2307/3869541
[17] Vilhar B, Kladnik A, Blejec A, Chourey P S, Dermastia M. Cytometrical evidence that the loss of seed weight in the miniature1seed mutant of maize is associated with reduced mitotic activity in the developing endosperm. Plant Physiol, 2002, 129: 23-30.
[18] LeClere S, Schmelz E A, Chourey P S. Cell wall invertase-deficient miniature1 kernels have altered phytohormone levels. Phytochemistry, 2008, 69: 692-699.
doi: 10.1016/j.phytochem.2007.09.011 pmid: 17964617
[19] Chourey P S, Li Q B, Kumar D. Sugar-hormone cross-talk in seed development: two redundant pathways of IAA biosynthesis are regulated differentially in the invertase-deficient miniature1 (mn1) seed mutant in maize. Mol Plant, 2010, 3: 1026-1036.
doi: 10.1093/mp/ssq057 pmid: 20924026
[20] Doll N M, Depège-Fargeix N, Rogowsky P M, Widiez T. Signaling in early maize kernel development. Mol Plant, 2017, 10: 375-388.
doi: S1674-2052(17)30009-6 pmid: 28267956
[21] Rijavec T, Kovac M, Kladnik A, Chourey P S, Dermastia M. A comparative study on the role of cytokinins in caryopsis development in the maize miniature1 seed mutant and its wild type. J Integr Plant Biol, 2009, 51: 840-849.
doi: 10.1111/jipb.2009.51.issue-9
[22] Chourey P S, Li Q B, Cevallos-Cevallos J. Pleiotropy and its dissection through a metabolic gene Miniature1 (Mn1) that encodes a cell wall invertase in developing seeds of maize. Plant Sci, 2012, 184: 45-53.
doi: 10.1016/j.plantsci.2011.12.011 pmid: 22284709
[23] Le C S, Schmelz E A, Chourey P S. Sugar levels regulate tryptophan-dependent auxin biosynthesis in developing maize kernels. Plant Physiol, 2010, 153: 306-318.
doi: 10.1104/pp.110.155226 pmid: 20237017
[24] Li B, Liu H, Zhang Y, Kang T, Zhang L, Tong J H, Xiao L T, Zhang H X. Constitutive expression of cell wall invertase genes increases grain yield and starch content in maize. Plant Biotechnol J, 2013, 11: 1080-1091.
doi: 10.1111/pbi.12102 pmid: 23926950
[25] Tian Q Z, Wang G, Ma X X, Shen Q W, Ding M L, Yang X Y, Luo X L, Li R R, Wang Z H, Wang X Y, Fu Z Y, Yang Q H, Tang J H, Wang G F. Riboflavin integrates cellular energetics and cell cycle to regulate maize seed development. Plant Biotechnol J, 2022, 20: 1487-1501.
doi: 10.1111/pbi.v20.8
[26] Li C B, Song R T. The regulation of zein biosynthesis in maize endosperm. Theor Appl Genet, 2020, 133: 1443-1453.
doi: 10.1007/s00122-019-03520-z pmid: 31897513
[27] Carlson S J, Shanker S, Chourey P S. A point mutation at the Miniature1seed locus reduces levels of the encoded protein, but not its mRNA, in maize. Mol Gene Genet, 2000, 263: 367-373.
[28] Kang B H, Xiong Y, Williams D S, Pozueta-Romero D, Chourey P S. Miniature1-encoded cell wall invertase is essential for assembly and function of wall-in-growth in the maize endosperm transfer cell. Plant Physiol, 2009, 151: 1366-1376.
doi: 10.1104/pp.109.142331
[29] Silva-Sanchez C, Chen S X, Li J X, Chourey P S. A comparative glycoproteome study of developing endosperm in the hexose-deficient miniature1 (mn1) seed mutant and its wild type Mn1 in maize. Front Plant Sci, 2014, 5: 63.
doi: 10.3389/fpls.2014.00063 pmid: 24616729
[30] Taliercio E, Kim J Y, Mahé A, Shanker S, Choi J, Cheng W H, Prioul J L, Chourey P. Isolation, characterization and expression analyses of two cell wall invertase genes in maize. J Plant Physiol, 1999, 155: 197-204.
doi: 10.1016/S0176-1617(99)80007-8
[31] Cheng W H, Chourey P S. Genetic evidence that invertase-mediated release of hexoses is critical for appropriate carbon partitioning and normal seed development in maize. Theor Appl Genet, 1999, 98: 485-495.
doi: 10.1007/s001220051096
[32] Liao S J, Wang L, Li J, Ruan Y L. Cell wall invertase is essential for ovule development through sugar signaling rather than provision of carbon nutrients. Plant Physiol, 2020, 183: 1126-1144.
doi: 10.1104/pp.20.00400 pmid: 32332089
[33] Silva-Sanchez C, Chen S, Zhu N, Li Q B, Chourey P S. Proteomic comparison of basal endosperm in maize miniature1 mutant and its wild-type Mn1. Front Plant Sci, 2013, 4: 211.
doi: 10.3389/fpls.2013.00211 pmid: 23805148
[34] Weber H, Borisjuk L, Wobus U. Molecular physiology of legume seed development. Annu Rev Plant Biol, 2005, 56: 253-279.
pmid: 15862096
[35] Thompson R D, Hueros G, Becker H, Maitz M. Development and functions of seed transfer cells. Plant Sci, 2001, 160: 775-783.
pmid: 11297774
[36] Zheng Y, Wang Z. Current opinions on endosperm transfer cells in maize. Plant Cell Rep, 2010, 29: 935-942.
doi: 10.1007/s00299-010-0891-z pmid: 20585949
[37] Bergareche D, Royo J, Muñiz L M, Hueros G. Cell wall invertase activity regulates the expression of the transfer cell-specific transcription factor ZmMRP-1. Planta, 2018, 247: 429-442.
doi: 10.1007/s00425-017-2800-y pmid: 29071379
[38] Wang E T, Wang J J, Zhu X D, Hao W, Wang L Y, Li Q, Zhang L X, He W, Lu B R, Lin H X, Ma H, Zhang G Q, He Z H. Control of rice grain-filling and yield by a gene with a potential signature of domestication. Nat Genet, 2008, 40: 1370-1374.
doi: 10.1038/ng.220 pmid: 18820698
[39] Zanor M I, Osorio S, Nunes-Nesi A, Carrari F, Lohse M, Usadel B, Kühn C, Bleiss W, Giavalisco P, Willmitzer L, Sulpice R, Zhou Y H, Fernie A R. RNA interference of LIN5 in tomato confirms its role in controlling Brix content, uncovers the influence of sugars on the levels of fruit hormones, and demonstrates the importance of sucrose cleavage for normal fruit development and fertility. Plant Physiol, 2009, 150: 1204-1218.
doi: 10.1104/pp.109.136598
[40] Jin Y, Ni D A, Ruan Y L. Posttranslational elevation of cell wall invertase activity by silencing its inhibitor in tomato delays leaf senescence and increases seed weight and fruit hexose level. Plant Cell, 2009, 21: 2072-2089.
doi: 10.1105/tpc.108.063719 pmid: 19574437
[41] Li J, Foster R, Ma S, Liao S J, Bliss S, Kartika D, Wang L, Wu L M, Eamens A L, Ruan Y L. Identification of transcription factors controlling cell wall invertase gene expression for reproductive development via bioinformatic and transgenic analyses. Plant J, 2021, 106: 1058-1074.
doi: 10.1111/tpj.v106.4
[42] Zha K Y, Xie H X, Ge M, Wang Z M, Wang Y, Si W N, Gu L J. Expression of maize MADS transcription factor ZmES22 negatively modulates starch accumulation in rice endosperm. Int J Mol Sci, 2019, 20: 483.
doi: 10.3390/ijms20030483
[1] Liang Jin-Yu, Yin Jia-De, Wang Hong-Li, Zhang Guo-Ping, Hou Hui-Zhi, Dong Bo, Ma Ming-Sheng. Estimation of leaf nitrogen content in dryland forage maize using UAV-based hyperspectral imaging and machine learning [J]. Acta Agronomica Sinica, 2026, 52(6): 1788-1801.
[2] Yang Xin-Yu, Cui Wen-Tao, Dilinigeer Alimu, Wang Kai-Xiang, Wu Peng-Hao, Ren Jiao-Jiao. Genome-wide association and genomic selection analysis of the number of leaves above the ear in maize [J]. Acta Agronomica Sinica, 2026, 52(5): 1573-1590.
[3] Han Ya-Xin, He Guan-Hua, Zhang Xiao-Qiong, Zhang Deng-Feng, Li Yong-Xiang, Liu Xu-Yang, Wang Tian-Yu, Li Yu, Zou Hua-Wen, Li Chun-Hui. Identification of maize lateral root density genes resources through integrated RNA-seq and BSA-seq analyses [J]. Acta Agronomica Sinica, 2026, 52(5): 1341-1352.
[4] Sun Shu-Feng, Xu Zhen-Nan, Huang Jia-Xin, Weng Jian-Feng, Li Xin-Hai. Genome-wide identification of the maize MAPK gene family and its response to Fusarium verticillioides infection [J]. Acta Agronomica Sinica, 2026, 52(5): 1291-1308.
[5] Zhang Ning-Ning, Teng Yu-Fei, Ren Na-Na, Wei Xing-Zhuo, Yan Shu-Hao, Fan Ke-Xin, Wang Yong-Hong, Chen Wen-Kang, Zhang Xing-Hua, Zhu Wan-Chao, Xu Shu-Tu, Xue Ji-Quan. Phenotypic evaluation and plasticity analysis of drought resistance in 201 maize inbred lines [J]. Acta Agronomica Sinica, 2026, 52(5): 1309-1325.
[6] Zhang Hong-Rong, Wang Fei-Er, Li Pan, Qiu Hai-Long, Zhu Jing, Zhao Lian-Hao, Nan Yun-You, He Wei, Fan Zhi-Long, Hu Fa-Long, Chai Qiang, Yin Wen. Photosynthetic characteristics of 20% reduced irrigation combined with 25% organic substitution for chemical fertilizer in increasing silage maize yield [J]. Acta Agronomica Sinica, 2026, 52(5): 1487-1500.
[7] Yang Yang, Chang Shi-Hui, Tian Hong-Li, Yi Hong-Mei, Wang Lu, Ren Jie, Fan Ya-Ming, Liu Ya-Wei, Wang Feng-Ge, Zhao Jiu-Ran. Genetic diversity analysis of nationally approved maize varieties in different ecological regions [J]. Acta Agronomica Sinica, 2026, 52(5): 1352-1364.
[8] Cai Hong-Wei, Yu Ai-Zhong, Jiang Ke-Qiang, Wang Peng-Fei, Wang Yu-Long, Huo Jian-Zhe, Pang Xiao-Neng, Yin Bo, Shang Yong-Pan. Key mechanisms underlying the enhancement of sweet maize yield through partial substitution of chemical fertilizers with organic manure in arid irrigation districts [J]. Acta Agronomica Sinica, 2026, 52(4): 1166-1180.
[9] Tian Hong-Li, Yang Yang, Fan Ya-Ming, Yi Hong-Mei, Guo Dan-Dan, Wang Feng-Ge, Zhao Jiu-Ran. A novel set of tri-allelic variant SNP loci suitable for maize variety identification [J]. Acta Agronomica Sinica, 2026, 52(4): 993-1005.
[10] Yang Ya-Li, Xu Ming-Rui, Ma Yue-Fei, Hai Yi-Rui, Liu Kai-Dong, Liu Wan-Mao, Sun Ying. Comparative transcriptome analysis of maize root tips and whole roots in response to iron deficiency [J]. Acta Agronomica Sinica, 2026, 52(4): 1006-1021.
[11] Guo Xiang-Yang, Tu Liang, Wang Dong, Liu Peng-Fei, Wang An-Gui, Yi Qiang, Ren Hong, Li Gang, Zhu Yun-Fang, Wu Xun, Jiang Yu-Lin, Tian Feng, Chen Ze-Hui. Application and prospects of Suwan germplasm in maize breeding in China [J]. Acta Agronomica Sinica, 2026, 52(3): 655-664.
[12] Meng Cheng, Wang Zhe. Genome-wide identification and expression analysis of the ZmPFK gene family under biotic and abiotic stresses in maize [J]. Acta Agronomica Sinica, 2026, 52(3): 764-779.
[13] Li Xin-Hao, Xing Meng-Ke, Zhou Zi-Hui, Li Si-Ye, Ren Hao, Wang Hong-Zhang, Lai Hua-Jiang. Exogenous melatonin enhances heat tolerance of maize at the seedling stage by coordinating light and dark reactions [J]. Acta Agronomica Sinica, 2026, 52(3): 839-856.
[14] Ma Liang, Ma Lu, Zhang Shu-Yu, Zhang Hui-Min, Wang Ren-Ming, Song Xu-Dong, Zhang Zhen-Liang, Mao Yu-Xiang, Lu Hu-Hua, Chen Guo-Qing, Hao De-Rong, Zhou Guang-Fei. Transcriptome analysis and identification of candidate genes associated with husk number in maize [J]. Acta Agronomica Sinica, 2026, 52(3): 790-801.
[15] Liu Ji-Chang, Li Si-Ye, Li Xue-Ting, Wang Hong-Zhang, Liu Peng, Zhang Ji-Wang, Zhao Bin, Ren Bai-Zhao, Ren Hao. Effects of salt stress on root growth and nutrient absorption efficiency of different salt-tolerant summer maize varieties [J]. Acta Agronomica Sinica, 2026, 52(2): 565-577.
Viewed
Full text


Abstract

Cited
  Shared   
  Discussed   
No Suggested Reading articles found!
Add: No. 80 Xueyuan South Rd, Beijing 100081, P. R. China E-mail: zwxb301@caas.cn
Supported by Beijing Magtech Co.Ltd