Welcome to Acta Agronomica Sinica，

Acta Agronomica Sinica ›› 2023, Vol. 49 ›› Issue (10): 2613-2620.doi: 10.3724/SP.J.1006.2023.33004

;

• CROP GENETICS & BREEDING·GERMPLASM RESOURCES·MOLECULAR GENETICS • Previous Articles     Next Articles

Map-based cloning and allelic analysis of gene controlling maize kernel mutant crk4

LI Meng-Yuan1(), ZHANG Wen-Cheng2, GAO Yong1, QIN Yong-Tian2, BO Shi-Rong1, SONG Kun-Yang1, TANG Ji-Hua1, FU Zhi-Yuan1()   

  1. 1National Key Laboratory of Wheat and Maize Crop Science / Collaborative Innovation Center of Henan Grain Crops / College of Agronomy, Henan Agricultural University, Zhengzhou 450046, Henan, China
    2Hebi Academy of Agricultural Sciences, Hebi 458030, Henan, China
  • Received:2023-01-14 Accepted:2023-04-17 Online:2023-10-12 Published:2023-04-24
  • Contact: E-mail: fuzhiyuan2004@163.com
  • Supported by:
    Key Technology Research and Development Program of Henan Province(232102111080)

RichHTML415

40

PDF

519

Abstract:

Kernel mutants are the important materials for cloning genes related to grain development and analyzing their genetic regulation mechanism. Crk4 (crumpled kernel 4) is a kernel mutant identified in the course of maize breeding and selection. Compared with the wild type, crk4 showed significantly lower in grain filling, grain weight, and germination rate. Genetic analysis showed that the mutant was controlled by a single recessive nuclear gene, which was mapped to a 614 kb physical distance on chromosome 5 by map-based cloning. In the 614 kb interval, 11 protein-coding genes were expressed in kernel. Sequence analysis revealed that there was a crk4-specific termination mutation in the second exon of Zm00001d017427 gene, which is caused by the deletion of C base. Zm00001d017427 encoded the metal-nicotianamine transporter (Sh4-shrunken4/Ysl2), which had been reported as the target gene of kernel mutant ysl2. The allelism test indicated that crk4 was a new allele mutant of ysl2/sh4. The identification of crk4 provided a new germplasm for elucidating the molecular regulation mechanism of Sh4 on seed development in maize.

Key words: maize, kernel mutant, crk4, map-based cloning, sh4/ysl2

Table 1

Primers for gene mapping"

引物名称
Primer name		 正向引物序列
Forward sequence (5'-3')		 反向引物序列
Reverse sequence (5'-3')
S09840
S09979		 ACGCCAGTGCTAATGGAATCG
ATCGCCCTTGAGGTGAAACAAC		 GCAACACAACACGCCAACAC
AGTCGAAAGCCAACCAAAGGAG
5-14 CATTTTGAGCGCTTTGATGA AGCAGCTCCTGTCGTGAAGT
5-32 GCCAGCGTCTTCTCTGATTC CTTGGTATGTTTCGCCAGGT
303 TCGGGTGGGATGGTTGGGGT GCCGTGGCGCTGAGAACAGT
499 ACTGCGACACTTGACGATGGGT GTGCCGGAGCAAACGAGCCT
5-38 GGTTGGGAGGATGATATCGA TCTCTCACTCTCAGGCAGCA
5-41 TGAGTCCGATGCTCACAGAG CTTTAGCGACGGCACTTACC
592-6 AAAAGCTTATACGGTTACAAGGT TGTTTACTGACATATGATCTCCAA
873-1 GGAAAGCGAAGCAGGTAA GTGGCTCAATCTGGAAACAT
5-284 CCCGAAGCTCGGTGCCAGGA GCAAGGACTTCAGTTGTTATGTTGCTC
S10043 GATTTCCTTGATCCTGGGTGAG TGTGTATGCAAATGGACTTAGC
S10049 TGGCATGGAGTCCACCAATTAC CACGGTGCCCAAACAAAAGAG
S10084 GGGTTGGGTTCAGGTGTTTCC GTCAGAGCACAAGGTGGGATG
S10118 AGAGCAGAGCGGAGCAGAC GTGTCAAGCAAAGCGTGTGTG

Fig. 1

Phenotypic analysis of crk4 A: segregation ears of Mo17×crk4 F3. The red arrows indicate crk4 kernels; bar: 1 cm. B: the comparison WT and crk4 kernels; bar: 1 cm. C: the comparison of kernel length, width, and thickness between WT and crk4. D: the comparison of 100-kernel weight between WT and crk4 with five replicates. E: the comparison of the longitudinal section between WT and crk4 kernels; bar: 1 cm. F: the comparison of the transverse section between WT and crk4 kernels; bar: 1 cm. G: the comparison of germination rate between WT and crk4. Values are represented as means ± SEs on histogram, *: P < 0.05; **: P < 0.01; ***: P < 0.001."

Table 2

Statistic analysis of kernels on F2 segregation ears"

果穗
Ear		 正常籽粒个数
No. of normal kernels		 突变籽粒个数
No. of mutant kernels		 籽粒总数
Total kernels		 实际比值
Observed ratio		 卡方值
χ2 test
374-1 329 116 445 2.84:1 0.270<χ20.05
374-2 271 85 356 3.19:1 0.240<χ20.05
374-3 296 98 394 3.02:1 0.003<χ20.05

Fig. 2

Map cloning of crk4 A: map-based cloning of crk4. The red number represents recombinants, and black number represents the population size. The crk4 is localized within a 614 kb interval on chromosome 5, containing 11 genes expressed in kernels. The target gene is indicated with red color. B: the schematic diagram of the structure of CRK4 gene. Black box represents exon, black line represents intron, red arrow indicates the mutation site in crk4, and black arrow indicates the mutation site in allelic mutants of ysl2 and sh4. C: the schematic diagram of the CRK4 protein with the conserved domains."

Table 3

Annotation of genes in the candidate intervals"

基因名称 Gene name 注释Annotation
Zm00001d017422 Homeobox-leucine zipper protein ATHB-6
Zm00001d017423 Origin recognition complex subunit 2
Zm00001d017424 ATP-dependent zinc metalloprotease FTSH 7 chloroplastic
Zm00001d017425 Cytochrome b5 (isoform A-like)
Zm00001d017427 Probable metal-nicotianamine transporter YSL16
Zm00001d017429 Yellow stripe 1
Zm00001d017432 Uncharacterized LOC100275088
Zm00001d017435 Uncharacterized LOC100275801
Zm00001d017438 Uncharacterized LOC100381739
Zm00001d017441 Cyclin-P4-1
Zm00001d017444 Probable WRKY transcription factor 51

Table 4

Primers for candidate genes"

引物名称
Primer name		 正向引物序列
Forward sequence (5'-3')		 反向引物序列
Reverse sequence (5'-3')
17427-1 TTGGCCAGAGAAAGCAACGA ATAAATGGCGGCGACCTCTC
17427-2 CAGGATTCCCCAGGAGAGGA CCAGGATTCGGGTGGATAGC
17427-3 ATGGATTCGGCTCTCATCGC CTCGCCAACGTGATGAAGGA
17427-4 CTTGGGTACGTCAGCTTGTA GGCGACTTTTGCTTCTACGTC
17432-1 ACTCCCTGCTCAGAAGCACT CCCAACTTCGTAGGCACGAT
17432-2 TTTGTAGCAAGACCAACAAGCAAAA TGTGCGAAATTGTGAATGACCA
17432-3 TCCAGACCATACGAGGTCAGT TGCTTCTGAGCAGGGAGTTT
17432-4 TGCCAGGTTTCAATGACCTCT CATTTGGCAGAATCCACGGC
17432-5 CGTCCACAGAGGGGACAAAC GCTCGGTGTCTTTTCAGGGA

Fig. 3

Allelic test of crk4 and ysl2 A: kernels on ysl2/+×crk4/+ hybrid ears, bar: 1 cm. B: kernels on crk4/+×ysl2/+ hybrid ears, bar: 1 cm. C: segregation statistics of kernels on ysl2/+×crk4/+ and crk4/+×ysl2/+ hybrid ears. D-E: mutation sequencing of Zm00001d017427 in mutant kernels from ears of double heterozygotes of crk4 and ysl2. D is for Zm00001d017427 in crk4 and E is for Zm00001d017427 in ysl2."

[1] Russell S D. Double fertilization. In: Russell S D, Dumas C, eds. International Review of Cytology. Academic Press, 1992. pp 357-388.
[2] Sosso D, Luo D P, Li Q B, Sasse J, Yang J L, Gendrot G, Suzuki M, Koch K E, McCarty D R, Chourey P S, Rogowsky P M, Ross-Ibarra J, Yang B, Frommer W B. Seed filling in domesticated maize and rice depends on sweet-mediated hexose transport. Nat Genet, 2015, 47: 1489-1493.
doi: 10.1038/ng.3422 pmid: 26523777
[3] Chourey P S, Nelson O E. The enzymatic deficiency conditioned by the shrunken-1 mutations in maize. Biochem Genet, 1976, 14: 1041-1055.
doi: 10.1007/BF00485135 pmid: 1016220
[4] Bhave M R, Lawrence S, Barton C, Hannah L C. Identification and molecular characterization of shrunken-2 cDNA clones of maize. Plant Cell, 1990, 2: 581-588.
pmid: 1967077
[5] Qiao Z Y, Qi W W, Wang Q, Feng Y N, Yang Q, Zhang N, Wang S S, Tang Y P, Song R T. ZmMADS47 regulates zein gene transcription through interaction with opaque2. PLoS Genet, 2016, 12: e1005991.
[6] Zhang X, Mogel K J H V, Lor V S, Hirsch C N, Vries B D, Kaeppler H F, Tracy W F, Kaeppler S M. Maize sugary enhancer1 (se1) is a gene affecting endosperm starch metabolism. Proc Natl Acad Sci USA, 2019, 116: 20776-20785.
doi: 10.1073/pnas.1902747116 pmid: 31548423
[7] Schmidt R J, Burr F A, Burr B. Transposon tagging and molecular analysis of the maize regulatory locus opaque-2. Science, 1987, 238: 960-963.
pmid: 2823388
[8] Zhang Z Y, Dong J Q, Ji C, Wu Y R, Messing J. NAC-type transcription factors regulate accumulation of starch and protein in maize seeds. Proc Natl Acad Sci USA, 2019, 116: 11223-11228.
doi: 10.1073/pnas.1904995116 pmid: 31110006
[9] Li C B, Yue Y H, Chen H J, Qi W W, Song R T. The ZmbZIP22transcription factor regulates 27-kD γ-zein gene transcription during maize endosperm development. Plant Cell, 2018, 30: 2402-2424.
doi: 10.1105/tpc.18.00422
[10] Li X J, Zhang Y F, Hou M M, Sun F, Shen Y, Xiu Z H, Wang X M, Chen Z L, Sun S S M, Small I, Tan B C. Small kernel 1 encodes a pentatricopeptide repeat protein required for mitochondrial nad7 transcript editing and seed development in maize (Zea mays) and rice (Oryza sativa). Plant J, 2014, 79: 797-809.
doi: 10.1111/tpj.2014.79.issue-5
[11] Chen X Z, Feng F, Qi W W, Xu L M, Yao D S, Wang Q, Song R T. Dek35 encodes a PPR protein that affects cis-splicing of mitochondrial nad4 intron 1 and seed development in maize. Mol Plant, 2017, 10: 427-441.
doi: 10.1016/j.molp.2016.08.008
[12] Dai D W, Luan S C, Chen X Z, Wang Q, Feng Y, Zhu C G, Qi W W, Song R T. Maize dek37 encodes a P-type PPR protein that affects cis-splicing of mitochondrial nad2 intron 1 and seed development. Genetics, 2018, 208: 1069-1082.
doi: 10.1534/genetics.117.300602
[13] Ren R C, Wang L L, Zhang L, Zhao Y J, Wu J W, Wei Y M, Zhang X S, Zhao X Y. Dek43 is a P-type pentatricopeptide repeat (PPR) protein responsible for the cis-splicing of nad4 in maize mitochondria. J Integr Plant Biol, 2020, 62: 299-313.
doi: 10.1111/jipb.v62.3
[14] Qi W W, Lu L, Huang S C, Song R T. Maize dek44 encodes mitochondrial ribosomal protein L9 and is required for seed development. Plant Physiol, 2019, 180: 2106-2119.
doi: 10.1104/pp.19.00546
[15] Qi W W, Yang Y, Feng X Z, Zhang M L, Song R T. Mitochondrial function and maize kernel development requires dek2, a pentatricopeptide repeat protein involved in nad1 mRNA splicing. Genetics, 2017, 205: 239-249.
doi: 10.1534/genetics.116.196105
[16] Klepek Y S, Geiger D, Stadler R, Klebl F, Landouar-Arsivaud L, Lemoine R, Hedrich R, Sauer N. Arabidopsis POLYOL TRANSPORTER5, a new member of the monosaccharide transporter-like superfamily, mediates H+-Symport of numerous substrates, including myo-inositol, glycerol, and ribose. Plant Cell, 2005, 17: 204-218.
doi: 10.1105/tpc.104.026641
[17] Buttner M. The monosaccharide transporter(-like) gene family in Arabidopsis. FEBS Lett, 2007, 581: 2318-2324.
doi: 10.1016/j.febslet.2007.03.016
[18] Schulz A, Beyhl D, Marten I, Wormit A, Neuhaus E, Poschet G, Büttner M, Schneider S, Sauer N, Hedrich R. Proton-driven sucrose symport and antiport are provided by the vacuolar transporters SUC4 and TMT1/2. Plant J, 2011, 68: 129-136.
doi: 10.1111/j.1365-313X.2011.04672.x
[19] Lalonde S, Wipf D, Frommer W B. Transport mechanisms for organic forms of carbon and nitrogen between source and sink. Annu Rev Plant Biol, 2004, 55: 341-372.
pmid: 15377224
[20] Curie C, Panaviene Z, Loulergue C, Dellaporta S L, Briat J F, Walker E L. Maize yellow stripe1 encodes a membrane protein directly involved in Fe(III) uptake. Nature, 2001, 409: 346-349.
doi: 10.1038/35053080
[21] Roberts L A, Pierson A J, Panaviene Z, Walker E L. Yellow stripe1 expanded roles for the maize iron-phytosiderophore transporter. Plant Physiol, 2004, 135: 112-120.
doi: 10.1104/pp.103.037572 pmid: 15107503
[22] Schaaf G, Ludewig U, Erenoglu B E, Mori S, Kitahara T, von Wirén N. ZmYS1functions as a proton-coupled symporter for phytosiderophore- and nicotianamine-chelated metals. J Biol Chem, 2004, 279: 9091-9096.
doi: 10.1074/jbc.M311799200
[23] Koike S, Inoue H, Mizuno D, Takahashi M, Nakanishi H, Mori S, Nishizawa N K. OsYSL2 is a rice metal-nicotianamine transporter that is regulated by iron and expressed in the phloem. Plant J, 2004, 39: 415-424.
doi: 10.1111/tpj.2004.39.issue-3
[24] Li J K, Fu J J, Chen Y, Fan K J, He C, Zhang Z Q, Li L, Liu Y J, Zheng J, Ren D T, Wang G Y. The U6 biogenesis-like 1 plays an important role in maize kernel and seedling development by affecting the 3' end processing of U6 snRNA. Mol Plant, 2017, 10: 470-482.
doi: S1674-2052(16)30263-5 pmid: 27825944
[25] He Y H, Yang Q, Yang J, Wang Y F, Sun X L, Wang S, Qi W W, Ma Z Y, Song R T. Shrunken4 is a mutant allele of ZmYSL2 that affects aleurone development and starch synthesis in maize. Genetics, 2021, 218: iyab070.
doi: 10.1093/genetics/iyab070
[26] Zang J, Huo Y Q, Liu J, Zhang H R, Liu J, Chen H B. Maize YSL2 is required for iron distribution and development in kernels. J Exp Bot, 2020, 71: 5896-5910.
doi: 10.1093/jxb/eraa332 pmid: 32687576
[27] Yen M R, Tseng Y H, Saier Jr M H. Maize yellow stripe1, an iron-phytosiderophore uptake transporter, is a member of the oligopeptide transporter (OPT) family. Microbiology, 2001, 147: 2881-2883.
pmid: 11700339
[28] Tsai C Y, Nelson O E. Mutations at the shrunken-4 locus in maize that produce three altered phosphorylases. Genetics, 1969, 61: 813-821.
doi: 10.1093/genetics/61.4.813 pmid: 17248442
[29] Doehlert D C, Kuo T M. Sugar metabolism in developing kernels of starch-deficient endosperm mutants of maize. Plant Physiol, 1990, 92: 990-994.
doi: 10.1104/pp.92.4.990 pmid: 16667416
[30] Roschzttardtz H, Conéjéro G, Divol F, Alcon C, Verdeil J L, Curie C, Mari S. New insights into Fe localization in plant tissues. Front Plant Sci, 2013, 4: 350.
doi: 10.3389/fpls.2013.00350 pmid: 24046774
[31] Hannah L C, Boehlein S. Maize kernel development. In: Larkins B A, ed. Biosynthesis in Maize Endosperm. Boston, MA: CABI, 2017. pp 149-159.
[1] Liang Jin-Yu, Yin Jia-De, Wang Hong-Li, Zhang Guo-Ping, Hou Hui-Zhi, Dong Bo, Ma Ming-Sheng. Estimation of leaf nitrogen content in dryland forage maize using UAV-based hyperspectral imaging and machine learning [J]. Acta Agronomica Sinica, 2026, 52(6): 1788-1801.
[2] Yang Yang, Chang Shi-Hui, Tian Hong-Li, Yi Hong-Mei, Wang Lu, Ren Jie, Fan Ya-Ming, Liu Ya-Wei, Wang Feng-Ge, Zhao Jiu-Ran. Genetic diversity analysis of nationally approved maize varieties in different ecological regions [J]. Acta Agronomica Sinica, 2026, 52(5): 1352-1364.
[3] Yang Xin-Yu, Cui Wen-Tao, Dilinigeer Alimu, Wang Kai-Xiang, Wu Peng-Hao, Ren Jiao-Jiao. Genome-wide association and genomic selection analysis of the number of leaves above the ear in maize [J]. Acta Agronomica Sinica, 2026, 52(5): 1573-1590.
[4] Han Ya-Xin, He Guan-Hua, Zhang Xiao-Qiong, Zhang Deng-Feng, Li Yong-Xiang, Liu Xu-Yang, Wang Tian-Yu, Li Yu, Zou Hua-Wen, Li Chun-Hui. Identification of maize lateral root density genes resources through integrated RNA-seq and BSA-seq analyses [J]. Acta Agronomica Sinica, 2026, 52(5): 1341-1352.
[5] Sun Shu-Feng, Xu Zhen-Nan, Huang Jia-Xin, Weng Jian-Feng, Li Xin-Hai. Genome-wide identification of the maize MAPK gene family and its response to Fusarium verticillioides infection [J]. Acta Agronomica Sinica, 2026, 52(5): 1291-1308.
[6] Zhang Ning-Ning, Teng Yu-Fei, Ren Na-Na, Wei Xing-Zhuo, Yan Shu-Hao, Fan Ke-Xin, Wang Yong-Hong, Chen Wen-Kang, Zhang Xing-Hua, Zhu Wan-Chao, Xu Shu-Tu, Xue Ji-Quan. Phenotypic evaluation and plasticity analysis of drought resistance in 201 maize inbred lines [J]. Acta Agronomica Sinica, 2026, 52(5): 1309-1325.
[7] Zhang Hong-Rong, Wang Fei-Er, Li Pan, Qiu Hai-Long, Zhu Jing, Zhao Lian-Hao, Nan Yun-You, He Wei, Fan Zhi-Long, Hu Fa-Long, Chai Qiang, Yin Wen. Photosynthetic characteristics of 20% reduced irrigation combined with 25% organic substitution for chemical fertilizer in increasing silage maize yield [J]. Acta Agronomica Sinica, 2026, 52(5): 1487-1500.
[8] Cai Hong-Wei, Yu Ai-Zhong, Jiang Ke-Qiang, Wang Peng-Fei, Wang Yu-Long, Huo Jian-Zhe, Pang Xiao-Neng, Yin Bo, Shang Yong-Pan. Key mechanisms underlying the enhancement of sweet maize yield through partial substitution of chemical fertilizers with organic manure in arid irrigation districts [J]. Acta Agronomica Sinica, 2026, 52(4): 1166-1180.
[9] Tian Hong-Li, Yang Yang, Fan Ya-Ming, Yi Hong-Mei, Guo Dan-Dan, Wang Feng-Ge, Zhao Jiu-Ran. A novel set of tri-allelic variant SNP loci suitable for maize variety identification [J]. Acta Agronomica Sinica, 2026, 52(4): 993-1005.
[10] Guo Xiang-Yang, Tu Liang, Wang Dong, Liu Peng-Fei, Wang An-Gui, Yi Qiang, Ren Hong, Li Gang, Zhu Yun-Fang, Wu Xun, Jiang Yu-Lin, Tian Feng, Chen Ze-Hui. Application and prospects of Suwan germplasm in maize breeding in China [J]. Acta Agronomica Sinica, 2026, 52(3): 655-664.
[11] Meng Cheng, Wang Zhe. Genome-wide identification and expression analysis of the ZmPFK gene family under biotic and abiotic stresses in maize [J]. Acta Agronomica Sinica, 2026, 52(3): 764-779.
[12] Li Xin-Hao, Xing Meng-Ke, Zhou Zi-Hui, Li Si-Ye, Ren Hao, Wang Hong-Zhang, Lai Hua-Jiang. Exogenous melatonin enhances heat tolerance of maize at the seedling stage by coordinating light and dark reactions [J]. Acta Agronomica Sinica, 2026, 52(3): 839-856.
[13] Ma Liang, Ma Lu, Zhang Shu-Yu, Zhang Hui-Min, Wang Ren-Ming, Song Xu-Dong, Zhang Zhen-Liang, Mao Yu-Xiang, Lu Hu-Hua, Chen Guo-Qing, Hao De-Rong, Zhou Guang-Fei. Transcriptome analysis and identification of candidate genes associated with husk number in maize [J]. Acta Agronomica Sinica, 2026, 52(3): 790-801.
[14] Liu Ji-Chang, Li Si-Ye, Li Xue-Ting, Wang Hong-Zhang, Liu Peng, Zhang Ji-Wang, Zhao Bin, Ren Bai-Zhao, Ren Hao. Effects of salt stress on root growth and nutrient absorption efficiency of different salt-tolerant summer maize varieties [J]. Acta Agronomica Sinica, 2026, 52(2): 565-577.
[15] Lin Zi-Qing, Zhong Xing-Yu, Liu Fan, Ren Zi-Ao, Ma Rui, Deng Xiu-Feng, Wang Dong-Wei, Liu Shao-Peng, Chen Kang, Zhang Ming-Cai, Li Zhao-Hu, Zhou Yu-Yi, Duan Liu-Sheng. Development of ultra-high-yield technology for a wheat-maize double cropping system achieving a 2-ton annual grain yield per mu in the coastal plain of Northern Shandong peninsula, China [J]. Acta Agronomica Sinica, 2026, 52(2): 631-643.
Viewed
Full text


Abstract

Cited
  Shared   
  Discussed   
No Suggested Reading articles found!
Add: No. 80 Xueyuan South Rd, Beijing 100081, P. R. China E-mail: zwxb301@caas.cn
Supported by Beijing Magtech Co.Ltd