Welcome to Acta Agronomica Sinica，

Acta Agronomica Sinica ›› 2023, Vol. 49 ›› Issue (10): 2613-2620.doi: 10.3724/SP.J.1006.2023.33004

• CROP GENETICS & BREEDING·GERMPLASM RESOURCES·MOLECULAR GENETICS • Previous Articles     Next Articles

Map-based cloning and allelic analysis of gene controlling maize kernel mutant crk4

LI Meng-Yuan1(), ZHANG Wen-Cheng2, GAO Yong1, QIN Yong-Tian2, BO Shi-Rong1, SONG Kun-Yang1, TANG Ji-Hua1, FU Zhi-Yuan1()   

  1. 1National Key Laboratory of Wheat and Maize Crop Science / Collaborative Innovation Center of Henan Grain Crops / College of Agronomy, Henan Agricultural University, Zhengzhou 450046, Henan, China
    2Hebi Academy of Agricultural Sciences, Hebi 458030, Henan, China
  • Received:2023-01-14 Accepted:2023-04-17 Online:2023-10-12 Published:2023-04-24
  • Contact: E-mail: fuzhiyuan2004@163.com
  • Supported by:
    Key Technology Research and Development Program of Henan Province(232102111080)

RichHTML415

33

PDF

441

Abstract:

Kernel mutants are the important materials for cloning genes related to grain development and analyzing their genetic regulation mechanism. Crk4 (crumpled kernel 4) is a kernel mutant identified in the course of maize breeding and selection. Compared with the wild type, crk4 showed significantly lower in grain filling, grain weight, and germination rate. Genetic analysis showed that the mutant was controlled by a single recessive nuclear gene, which was mapped to a 614 kb physical distance on chromosome 5 by map-based cloning. In the 614 kb interval, 11 protein-coding genes were expressed in kernel. Sequence analysis revealed that there was a crk4-specific termination mutation in the second exon of Zm00001d017427 gene, which is caused by the deletion of C base. Zm00001d017427 encoded the metal-nicotianamine transporter (Sh4-shrunken4/Ysl2), which had been reported as the target gene of kernel mutant ysl2. The allelism test indicated that crk4 was a new allele mutant of ysl2/sh4. The identification of crk4 provided a new germplasm for elucidating the molecular regulation mechanism of Sh4 on seed development in maize.

Key words: maize, kernel mutant, crk4, map-based cloning, sh4/ysl2

Table 1

Primers for gene mapping"

引物名称
Primer name		 正向引物序列
Forward sequence (5'-3')		 反向引物序列
Reverse sequence (5'-3')
S09840
S09979		 ACGCCAGTGCTAATGGAATCG
ATCGCCCTTGAGGTGAAACAAC		 GCAACACAACACGCCAACAC
AGTCGAAAGCCAACCAAAGGAG
5-14 CATTTTGAGCGCTTTGATGA AGCAGCTCCTGTCGTGAAGT
5-32 GCCAGCGTCTTCTCTGATTC CTTGGTATGTTTCGCCAGGT
303 TCGGGTGGGATGGTTGGGGT GCCGTGGCGCTGAGAACAGT
499 ACTGCGACACTTGACGATGGGT GTGCCGGAGCAAACGAGCCT
5-38 GGTTGGGAGGATGATATCGA TCTCTCACTCTCAGGCAGCA
5-41 TGAGTCCGATGCTCACAGAG CTTTAGCGACGGCACTTACC
592-6 AAAAGCTTATACGGTTACAAGGT TGTTTACTGACATATGATCTCCAA
873-1 GGAAAGCGAAGCAGGTAA GTGGCTCAATCTGGAAACAT
5-284 CCCGAAGCTCGGTGCCAGGA GCAAGGACTTCAGTTGTTATGTTGCTC
S10043 GATTTCCTTGATCCTGGGTGAG TGTGTATGCAAATGGACTTAGC
S10049 TGGCATGGAGTCCACCAATTAC CACGGTGCCCAAACAAAAGAG
S10084 GGGTTGGGTTCAGGTGTTTCC GTCAGAGCACAAGGTGGGATG
S10118 AGAGCAGAGCGGAGCAGAC GTGTCAAGCAAAGCGTGTGTG

Fig. 1

Phenotypic analysis of crk4 A: segregation ears of Mo17×crk4 F3. The red arrows indicate crk4 kernels; bar: 1 cm. B: the comparison WT and crk4 kernels; bar: 1 cm. C: the comparison of kernel length, width, and thickness between WT and crk4. D: the comparison of 100-kernel weight between WT and crk4 with five replicates. E: the comparison of the longitudinal section between WT and crk4 kernels; bar: 1 cm. F: the comparison of the transverse section between WT and crk4 kernels; bar: 1 cm. G: the comparison of germination rate between WT and crk4. Values are represented as means ± SEs on histogram, *: P < 0.05; **: P < 0.01; ***: P < 0.001."

Table 2

Statistic analysis of kernels on F2 segregation ears"

果穗
Ear		 正常籽粒个数
No. of normal kernels		 突变籽粒个数
No. of mutant kernels		 籽粒总数
Total kernels		 实际比值
Observed ratio		 卡方值
χ2 test
374-1 329 116 445 2.84:1 0.270<χ20.05
374-2 271 85 356 3.19:1 0.240<χ20.05
374-3 296 98 394 3.02:1 0.003<χ20.05

Fig. 2

Map cloning of crk4 A: map-based cloning of crk4. The red number represents recombinants, and black number represents the population size. The crk4 is localized within a 614 kb interval on chromosome 5, containing 11 genes expressed in kernels. The target gene is indicated with red color. B: the schematic diagram of the structure of CRK4 gene. Black box represents exon, black line represents intron, red arrow indicates the mutation site in crk4, and black arrow indicates the mutation site in allelic mutants of ysl2 and sh4. C: the schematic diagram of the CRK4 protein with the conserved domains."

Table 3

Annotation of genes in the candidate intervals"

基因名称 Gene name 注释Annotation
Zm00001d017422 Homeobox-leucine zipper protein ATHB-6
Zm00001d017423 Origin recognition complex subunit 2
Zm00001d017424 ATP-dependent zinc metalloprotease FTSH 7 chloroplastic
Zm00001d017425 Cytochrome b5 (isoform A-like)
Zm00001d017427 Probable metal-nicotianamine transporter YSL16
Zm00001d017429 Yellow stripe 1
Zm00001d017432 Uncharacterized LOC100275088
Zm00001d017435 Uncharacterized LOC100275801
Zm00001d017438 Uncharacterized LOC100381739
Zm00001d017441 Cyclin-P4-1
Zm00001d017444 Probable WRKY transcription factor 51

Table 4

Primers for candidate genes"

引物名称
Primer name		 正向引物序列
Forward sequence (5'-3')		 反向引物序列
Reverse sequence (5'-3')
17427-1 TTGGCCAGAGAAAGCAACGA ATAAATGGCGGCGACCTCTC
17427-2 CAGGATTCCCCAGGAGAGGA CCAGGATTCGGGTGGATAGC
17427-3 ATGGATTCGGCTCTCATCGC CTCGCCAACGTGATGAAGGA
17427-4 CTTGGGTACGTCAGCTTGTA GGCGACTTTTGCTTCTACGTC
17432-1 ACTCCCTGCTCAGAAGCACT CCCAACTTCGTAGGCACGAT
17432-2 TTTGTAGCAAGACCAACAAGCAAAA TGTGCGAAATTGTGAATGACCA
17432-3 TCCAGACCATACGAGGTCAGT TGCTTCTGAGCAGGGAGTTT
17432-4 TGCCAGGTTTCAATGACCTCT CATTTGGCAGAATCCACGGC
17432-5 CGTCCACAGAGGGGACAAAC GCTCGGTGTCTTTTCAGGGA

Fig. 3

Allelic test of crk4 and ysl2 A: kernels on ysl2/+×crk4/+ hybrid ears, bar: 1 cm. B: kernels on crk4/+×ysl2/+ hybrid ears, bar: 1 cm. C: segregation statistics of kernels on ysl2/+×crk4/+ and crk4/+×ysl2/+ hybrid ears. D-E: mutation sequencing of Zm00001d017427 in mutant kernels from ears of double heterozygotes of crk4 and ysl2. D is for Zm00001d017427 in crk4 and E is for Zm00001d017427 in ysl2."

[1] Russell S D. Double fertilization. In: Russell S D, Dumas C, eds. International Review of Cytology. Academic Press, 1992. pp 357-388.
[2] Sosso D, Luo D P, Li Q B, Sasse J, Yang J L, Gendrot G, Suzuki M, Koch K E, McCarty D R, Chourey P S, Rogowsky P M, Ross-Ibarra J, Yang B, Frommer W B. Seed filling in domesticated maize and rice depends on sweet-mediated hexose transport. Nat Genet, 2015, 47: 1489-1493.
doi: 10.1038/ng.3422 pmid: 26523777
[3] Chourey P S, Nelson O E. The enzymatic deficiency conditioned by the shrunken-1 mutations in maize. Biochem Genet, 1976, 14: 1041-1055.
doi: 10.1007/BF00485135 pmid: 1016220
[4] Bhave M R, Lawrence S, Barton C, Hannah L C. Identification and molecular characterization of shrunken-2 cDNA clones of maize. Plant Cell, 1990, 2: 581-588.
pmid: 1967077
[5] Qiao Z Y, Qi W W, Wang Q, Feng Y N, Yang Q, Zhang N, Wang S S, Tang Y P, Song R T. ZmMADS47 regulates zein gene transcription through interaction with opaque2. PLoS Genet, 2016, 12: e1005991.
[6] Zhang X, Mogel K J H V, Lor V S, Hirsch C N, Vries B D, Kaeppler H F, Tracy W F, Kaeppler S M. Maize sugary enhancer1 (se1) is a gene affecting endosperm starch metabolism. Proc Natl Acad Sci USA, 2019, 116: 20776-20785.
doi: 10.1073/pnas.1902747116 pmid: 31548423
[7] Schmidt R J, Burr F A, Burr B. Transposon tagging and molecular analysis of the maize regulatory locus opaque-2. Science, 1987, 238: 960-963.
pmid: 2823388
[8] Zhang Z Y, Dong J Q, Ji C, Wu Y R, Messing J. NAC-type transcription factors regulate accumulation of starch and protein in maize seeds. Proc Natl Acad Sci USA, 2019, 116: 11223-11228.
doi: 10.1073/pnas.1904995116 pmid: 31110006
[9] Li C B, Yue Y H, Chen H J, Qi W W, Song R T. The ZmbZIP22transcription factor regulates 27-kD γ-zein gene transcription during maize endosperm development. Plant Cell, 2018, 30: 2402-2424.
doi: 10.1105/tpc.18.00422
[10] Li X J, Zhang Y F, Hou M M, Sun F, Shen Y, Xiu Z H, Wang X M, Chen Z L, Sun S S M, Small I, Tan B C. Small kernel 1 encodes a pentatricopeptide repeat protein required for mitochondrial nad7 transcript editing and seed development in maize (Zea mays) and rice (Oryza sativa). Plant J, 2014, 79: 797-809.
doi: 10.1111/tpj.2014.79.issue-5
[11] Chen X Z, Feng F, Qi W W, Xu L M, Yao D S, Wang Q, Song R T. Dek35 encodes a PPR protein that affects cis-splicing of mitochondrial nad4 intron 1 and seed development in maize. Mol Plant, 2017, 10: 427-441.
doi: 10.1016/j.molp.2016.08.008
[12] Dai D W, Luan S C, Chen X Z, Wang Q, Feng Y, Zhu C G, Qi W W, Song R T. Maize dek37 encodes a P-type PPR protein that affects cis-splicing of mitochondrial nad2 intron 1 and seed development. Genetics, 2018, 208: 1069-1082.
doi: 10.1534/genetics.117.300602
[13] Ren R C, Wang L L, Zhang L, Zhao Y J, Wu J W, Wei Y M, Zhang X S, Zhao X Y. Dek43 is a P-type pentatricopeptide repeat (PPR) protein responsible for the cis-splicing of nad4 in maize mitochondria. J Integr Plant Biol, 2020, 62: 299-313.
doi: 10.1111/jipb.v62.3
[14] Qi W W, Lu L, Huang S C, Song R T. Maize dek44 encodes mitochondrial ribosomal protein L9 and is required for seed development. Plant Physiol, 2019, 180: 2106-2119.
doi: 10.1104/pp.19.00546
[15] Qi W W, Yang Y, Feng X Z, Zhang M L, Song R T. Mitochondrial function and maize kernel development requires dek2, a pentatricopeptide repeat protein involved in nad1 mRNA splicing. Genetics, 2017, 205: 239-249.
doi: 10.1534/genetics.116.196105
[16] Klepek Y S, Geiger D, Stadler R, Klebl F, Landouar-Arsivaud L, Lemoine R, Hedrich R, Sauer N. Arabidopsis POLYOL TRANSPORTER5, a new member of the monosaccharide transporter-like superfamily, mediates H+-Symport of numerous substrates, including myo-inositol, glycerol, and ribose. Plant Cell, 2005, 17: 204-218.
doi: 10.1105/tpc.104.026641
[17] Buttner M. The monosaccharide transporter(-like) gene family in Arabidopsis. FEBS Lett, 2007, 581: 2318-2324.
doi: 10.1016/j.febslet.2007.03.016
[18] Schulz A, Beyhl D, Marten I, Wormit A, Neuhaus E, Poschet G, Büttner M, Schneider S, Sauer N, Hedrich R. Proton-driven sucrose symport and antiport are provided by the vacuolar transporters SUC4 and TMT1/2. Plant J, 2011, 68: 129-136.
doi: 10.1111/j.1365-313X.2011.04672.x
[19] Lalonde S, Wipf D, Frommer W B. Transport mechanisms for organic forms of carbon and nitrogen between source and sink. Annu Rev Plant Biol, 2004, 55: 341-372.
pmid: 15377224
[20] Curie C, Panaviene Z, Loulergue C, Dellaporta S L, Briat J F, Walker E L. Maize yellow stripe1 encodes a membrane protein directly involved in Fe(III) uptake. Nature, 2001, 409: 346-349.
doi: 10.1038/35053080
[21] Roberts L A, Pierson A J, Panaviene Z, Walker E L. Yellow stripe1 expanded roles for the maize iron-phytosiderophore transporter. Plant Physiol, 2004, 135: 112-120.
doi: 10.1104/pp.103.037572 pmid: 15107503
[22] Schaaf G, Ludewig U, Erenoglu B E, Mori S, Kitahara T, von Wirén N. ZmYS1functions as a proton-coupled symporter for phytosiderophore- and nicotianamine-chelated metals. J Biol Chem, 2004, 279: 9091-9096.
doi: 10.1074/jbc.M311799200
[23] Koike S, Inoue H, Mizuno D, Takahashi M, Nakanishi H, Mori S, Nishizawa N K. OsYSL2 is a rice metal-nicotianamine transporter that is regulated by iron and expressed in the phloem. Plant J, 2004, 39: 415-424.
doi: 10.1111/tpj.2004.39.issue-3
[24] Li J K, Fu J J, Chen Y, Fan K J, He C, Zhang Z Q, Li L, Liu Y J, Zheng J, Ren D T, Wang G Y. The U6 biogenesis-like 1 plays an important role in maize kernel and seedling development by affecting the 3' end processing of U6 snRNA. Mol Plant, 2017, 10: 470-482.
doi: S1674-2052(16)30263-5 pmid: 27825944
[25] He Y H, Yang Q, Yang J, Wang Y F, Sun X L, Wang S, Qi W W, Ma Z Y, Song R T. Shrunken4 is a mutant allele of ZmYSL2 that affects aleurone development and starch synthesis in maize. Genetics, 2021, 218: iyab070.
doi: 10.1093/genetics/iyab070
[26] Zang J, Huo Y Q, Liu J, Zhang H R, Liu J, Chen H B. Maize YSL2 is required for iron distribution and development in kernels. J Exp Bot, 2020, 71: 5896-5910.
doi: 10.1093/jxb/eraa332 pmid: 32687576
[27] Yen M R, Tseng Y H, Saier Jr M H. Maize yellow stripe1, an iron-phytosiderophore uptake transporter, is a member of the oligopeptide transporter (OPT) family. Microbiology, 2001, 147: 2881-2883.
pmid: 11700339
[28] Tsai C Y, Nelson O E. Mutations at the shrunken-4 locus in maize that produce three altered phosphorylases. Genetics, 1969, 61: 813-821.
doi: 10.1093/genetics/61.4.813 pmid: 17248442
[29] Doehlert D C, Kuo T M. Sugar metabolism in developing kernels of starch-deficient endosperm mutants of maize. Plant Physiol, 1990, 92: 990-994.
doi: 10.1104/pp.92.4.990 pmid: 16667416
[30] Roschzttardtz H, Conéjéro G, Divol F, Alcon C, Verdeil J L, Curie C, Mari S. New insights into Fe localization in plant tissues. Front Plant Sci, 2013, 4: 350.
doi: 10.3389/fpls.2013.00350 pmid: 24046774
[31] Hannah L C, Boehlein S. Maize kernel development. In: Larkins B A, ed. Biosynthesis in Maize Endosperm. Boston, MA: CABI, 2017. pp 149-159.
[1] AI Rong, ZHANG Chun, YUE Man-Fang, ZOU Hua-Wen, WU Zhong-Yi. Response of maize transcriptional factor ZmEREB211 to abiotic stress [J]. Acta Agronomica Sinica, 2023, 49(9): 2433-2445.
[2] HUANG Yu-Jie, ZHANG Xiao-Tian, CHEN Hui-Li, WANG Hong-Wei, DING Shuang-Cheng. Identification of ZmC2s gene family and functional analysis of ZmC2-15 under heat tolerance in maize [J]. Acta Agronomica Sinica, 2023, 49(9): 2331-2343.
[3] YANG Wen-Yu, WU Cheng-Xiu, XIAO Ying-Jie, YAN Jian-Bing. ALGWAS: two-stage Adaptive Lasso-based genome-wide association study [J]. Acta Agronomica Sinica, 2023, 49(9): 2321-2330.
[4] BAI Yan, GAO Ting-Ting, LU Shi, ZHENG Shu-Bo, LU Ming. A retrospective analysis of the historical evolution and developing trend of maize mega varieties in China from 1982 to 2020 [J]. Acta Agronomica Sinica, 2023, 49(8): 2064-2076.
[5] WANG Xing-Rong, ZHANG Yan-Jun, TU Qi-Qi, GONG Dian-Ming, QIU Fa-Zhan. Identification and gene localization of a novel maize nuclear male sterility mutant ms6 [J]. Acta Agronomica Sinica, 2023, 49(8): 2077-2087.
[6] WANG Juan, XU Xiang-Bo, ZHANG Mao-Lin, LIU Tie-Shan, XU Qian, DONG Rui, LIU Chun-Xiao, GUAN Hai-Ying, LIU Qiang, WANG Li-Ming, HE Chun-Mei. Characterization and genetic analysis of a new allelic mutant of Miniature1 gene in maize [J]. Acta Agronomica Sinica, 2023, 49(8): 2088-2096.
[7] WEI Jin-Gui, GUO Yao, CHAI Qiang, YIN Wen, FAN Zhi-Long, HU Fa-Long. Yield and yield components of maize response to high plant density under reduced water and nitrogen supply [J]. Acta Agronomica Sinica, 2023, 49(7): 1919-1929.
[8] LI Rong, MIAN You-Ming, HOU Xian-Qing, LI Pei-Fu, WANG Xi-Na. Effects of nitrogen application on decomposition and nutrient release of returning straw, soil fertility, and maize yield [J]. Acta Agronomica Sinica, 2023, 49(7): 2012-2022.
[9] MEI Xiu-Peng, ZHAO Zi-Kun, JIA Xin-Yao, BAI Yang, LI Mei, GAN Yu-Ling, YANG Qiu-Yue, CAI Yi-Lin. Heat-inducible transcription factor ZmNF-YC13 regulates heat stress response genes to improve heat tolerance in maize [J]. Acta Agronomica Sinica, 2023, 49(7): 1747-1757.
[10] CHANG Li-Juan, LIANG Jing-Gang, SONG Jun, LIU Wen-Juan, FU Cheng-Ping, DAI Xiao-Hang, WANG Dong, WEI Chao, XIONG Mei. Event-specific PCR detection method of transgenic maize ND207 and its standardization [J]. Acta Agronomica Sinica, 2023, 49(7): 1818-1828.
[11] ZHANG Zhen-Bo, JIA Chun-Lan, REN Bai-Zhao, LIU Peng, ZHAO Bin, ZHANG Ji-Wang. Effects of combined application of nitrogen and phosphorus on yield and leaf senescence physiological characteristics in summer maize [J]. Acta Agronomica Sinica, 2023, 49(6): 1616-1629.
[12] LI Lu-Lu, MING Bo, GAO Shang, XIE Rui-Zhi, WANG Ke-Ru, HOU Peng, XUE Jun, LI Shao-Kun. Characteristic difference in grain in-field drydown between maize cultivars with various maturation [J]. Acta Agronomica Sinica, 2023, 49(6): 1643-1652.
[13] WANG Yu-Long, YU Ai-Zhong, LYU Han-Qiang, LYU Yi-Tong, SU Xiang-Xiang, WANG Peng-Fei, CHAI Jian. Effects of green manure replanting and returning after wheat on following year’s maize root traits and water use efficiency in oasis irrigation area [J]. Acta Agronomica Sinica, 2023, 49(5): 1350-1362.
[14] LI Hui, WANG Xu-Min, LIU Miao, LIU Peng-Zhao, LI Qiao-Li, WANG Xiao-Li, WANG Rui, LI Jun. Water and nitrogen reduction scheme optimization based on yield and nitrogen utilization of summer maize [J]. Acta Agronomica Sinica, 2023, 49(5): 1292-1304.
[15] ZHANG Jun-Jie, CHEN Jin-Ping, TANG Yu-Lou, ZHANG Rui, CAO Hong-Zhang, WANG Li-Juan, MA Meng-Jin, WANG Hao, WANG Yong-Chao, GUO Jia-Meng, KRISHNA SV Jagadish, YANG Qing-Hua, SHAO Rui-Xin. Effects of drought stress before and after anthesis on photosynthetic characteristics and yield of summer maize after re-watering [J]. Acta Agronomica Sinica, 2023, 49(5): 1397-1409.
Viewed
Full text


Abstract

Cited
  Shared   
  Discussed   
[1] Li Shaoqing, Li Yangsheng, Wu Fushun, Liao Jianglin, Li Damo. Optimum Fertilization and Its Corresponding Mechanism under Complete Submergence at Booting Stage in Rice[J]. Acta Agronomica Sinica, 2002, 28(01): 115 -120 .
[2] Wang Lanzhen;Mi Guohua;Chen Fanjun;Zhang Fusuo. Response to Phosphorus Deficiency of Two Winter Wheat Cultivars with Different Yield Components[J]. Acta Agron Sin, 2003, 29(06): 867 -870 .
[3] YANG Jian-Chang;ZHANG Jian-Hua;WANG Zhi-Qin;ZH0U Qing-Sen. Changes in Contents of Polyamines in the Flag Leaf and Their Relationship with Drought-resistance of Rice Cultivars under Water Deficiency Stress[J]. Acta Agron Sin, 2004, 30(11): 1069 -1075 .
[4] Wang Yongsheng;Wang Jing;Duan Jingya;Wang Jinfa;Liu Liangshi. Isolation and Genetic Research of a Dwarf Tiilering Mutant Rice[J]. Acta Agron Sin, 2002, 28(02): 235 -239 .
[5] WANG Li-Yan;ZHAO Ke-Fu. Some Physiological Response of Zea mays under Salt-stress[J]. Acta Agron Sin, 2005, 31(02): 264 -268 .
[6] TIAN Meng-Liang;HUNAG Yu-Bi;TAN Gong-Xie;LIU Yong-Jian;RONG Ting-Zhao. Sequence Polymorphism of waxy Genes in Landraces of Waxy Maize from Southwest China[J]. Acta Agron Sin, 2008, 34(05): 729 -736 .
[7] HU Xi-Yuan;LI Jian-Ping;SONG Xi-Fang. Efficiency of Spatial Statistical Analysis in Superior Genotype Selection of Plant Breeding[J]. Acta Agron Sin, 2008, 34(03): 412 -417 .
[8] WANG Yan;QIU Li-Ming;XIE Wen-Juan;HUANG Wei;YE Feng;ZHANG Fu-Chun;MA Ji. Cold Tolerance of Transgenic Tobacco Carrying Gene Encoding Insect Antifreeze Protein[J]. Acta Agron Sin, 2008, 34(03): 397 -402 .
[9] ZHENG Xi;WU Jian-Guo;LOU Xiang-Yang;XU Hai-Ming;SHI Chun-Hai. Mapping and Analysis of QTLs on Maternal and Endosperm Genomes for Histidine and Arginine in Rice (Oryza sativa L.) across Environments[J]. Acta Agron Sin, 2008, 34(03): 369 -375 .
[10] XING Guang-Nan, ZHOU Bin, ZHAO Tuan-Jie, YU De-Yue, XING Han, HEN Shou-Yi, GAI Jun-Yi. Mapping QTLs of Resistance to Megacota cribraria (Fabricius) in Soybean[J]. Acta Agronomica Sinica, 2008, 34(03): 361 -368 .
Add: No. 80 Xueyuan South Rd, Beijing 100081, P. R. China E-mail: zwxb301@caas.cn
Supported by Beijing Magtech Co.Ltd